585 chrI 864 890 3500432823 26 864 890 8421504 1 26 0 g 350043282300000004 20-46 17038564 10.1101/gr.5560806 1088-9051 Genome Research Flexibility and constraint in the nucleosome core landscape of Caenorhabditis elegans chromatin Johnson 2006 14 585 chrI 10996 11028 3500377578 32 10996 11028 8421504 1 32 0 g 350037757800000008 0-32 Complet list of 1lqa hssp file Complet list of cnptia.embrapa.br 0 0 585 chrI 106405 107807 3500343811 48 106405 107807 8421504 4 9,6,14,19 0,12,23,1383 c,g 350034381100001485,350034381100000054,350034381100000054 20-49,6-25,6-25 1531 26.93 2.31 1.16 sequence_4 1 432 (149568) + Gypsy12-ZM_I LTR/Gypsy nomics.purdue.edu 0 0 585 chrI 109276 110044 3500282684 48 109276 110044 8421504 2 24,24 0,744 c,g 350028268400000001,350028268400000001,350028268400000000,350028268400000000 0-24,0-24,0-24,0-24 MATURATION IN CAENORHABDITIS ELEGANS ry.vanderbilt.edu 0 0 585 chrI 111291 111425 3500288532 134 111291 111425 8421504 1 134 0 c,g 350028853200000021,350028853200000021 0-134,0-134 ScienceDirect.com - Genomics - A combined computational and experimental analysis of two families of snoRNA genes from Caenorhabditis elegans, revealing the expression and evolution pattern of snoRNAs in nematodes sciencedirect.com 0 0 586 chrI 138393 143652 3500459034 102 138393 143652 8421504 6 26,28,1,6,15,26 0,611,4545,4613,4620,5233 c,g 350045903400000000,350045903400000001,350045903400000001,350045903400000002,350045903400000003,350045903400000003 0-26,0-28,0-28,1-23,0-26,0-26 Nucleic acid nematicides Atkinson 2005 0 586 chrI 138393 143652 3500076416 102 138393 143652 8421504 6 26,28,1,6,15,26 0,611,4545,4613,4620,5233 c,g 350007641600000000,350007641600000001,350007641600000001,350007641600000002,350007641600000003,350007641600000003 0-26,0-28,0-28,1-23,0-26,0-26 NUCLEIC ACID NEMATICIDES - THE UNIVERSITY OF LEEDS www.sumobrain.com 0 0 586 chrI 138393 143652 3500033100 102 138393 143652 8421504 6 26,28,1,6,15,26 0,611,4545,4613,4620,5233 c,g 350003310000000000,350003310000000001,350003310000000001,350003310000000002,350003310000000003,350003310000000003 0-26,0-28,0-28,1-23,0-26,0-26 Nucleic acid nematicides Atkinson 2005 0 586 chrI 144265 154840 3500275560 135 144265 154840 8421504 5 22,22,23,25,43 0,2371,5128,6465,10532 c,g 350027556000000020,350027556000000021,350027556000000021,350027556000000009,350027556000000009,350027556000000017,350027556000000008,350027556000000023 10-32,10-32,10-32,0-23,0-23,0-25,12-34,10-36 Dual oxidases as mitogenic and endocrine regulators Lambeth 2001 0 586 chrI 144265 154820 3500154179 148 144265 154820 8421504 6 22,33,22,23,25,23 0,2360,2811,5128,6465,10532 c,g 350015417900000025,350015417900000016,350015417900000016,350015417900000026,350015417900000026,350015417900000024,350015417900000024,350015417900000014,350015417900000014,350015417900000022,350015417900000013 10-32,10-32,10-32,10-32,10-32,9-31,9-31,0-23,0-23,0-25,11-34 Article jcb.rupress.org 0 0 586 chrI 144265 154819 3500425716 147 144265 154819 8421504 6 22,33,22,23,25,22 0,2360,2811,5128,6465,10532 c,g 350042571600000025,350042571600000016,350042571600000026,350042571600000026,350042571600000024,350042571600000014,350042571600000014,350042571600000022,350042571600000013 10-32,10-32,10-32,10-32,9-31,0-23,0-23,0-25,12-34 Article thology.emory.edu 0 0 586 chrI 147834 147859 3500081732 24 147834 147859 8421504 2 4,20 0,5 c 350008173200000000 16-40 뎁손을 유효성분으로 함유하는 노화조절용 및/또는 수명연장용 조성물 Park 2010 0 586 chrI 147885 149083 3500142263 147 147885 149083 8421504 3 69,54,24 0,284,1174 p 350014226300015059 0-147 [tel-00157749, v1] Etude de 2 gènes cibles de la protéine P53 : siah (seven in absentia human homologue) et tsap6 (tumor suppressor activated pathway 6) hives-ouvertes.fr 0 0 586 chrI 159085 159110 3500348158 25 159085 159110 8421504 1 25 0 g 350034815800000042 0-25 <Html><Title> Complet list of 1r9d hssp file Complet list of cnptia.embrapa.br 0 0 586 chrI 174295 174321 3500024482 23 174295 174321 8421504 2 15,8 0,18 g 350002448200000040 0-24 <!DOCTYPE HTML PUBLIC i3/4-//IETF//DTD HTML 3.0//ENi3/4> <!- SPECIFICATION OF LANGUAGE-> <HTML> wheat.pw.usda.gov 0 0 586 chrI 207226 207763 3500136159 39 207226 207763 8421504 2 20,19 0,518 c,g 350013615900000026,350013615900000026,350013615900000027,350013615900000027 0-20,0-20,0-19,0-19 Supporting Information www.pnas.org 0 0 586 chrI 220505 220530 3500184047 23 220505 220530 8421504 2 16,7 0,18 c 350018404700000002 16-39 正则表达式: 不以@或+开头,含非A-Z的字符,且含A或@ 怎么写? www.lampchina.net 0 0 586 chrI 221434 255719 3500197929 39 221434 255719 8421504 4 16,4,14,5 0,17,34263,34280 g 350019792900001697,350019792900003221 0-20,4-23 TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca term.cbcb.umd.edu 0 0 73 chrI 238094 311920 3500271198 59 238094 311920 8421504 5 6,13,20,15,5 0,10,49603,73801,73821 c,g 350027119800003921,350027119800003399,350027119800000396 10-29,27-48,22-42 TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca term.cbcb.umd.edu 0 0 586 chrI 238908 238931 3500279177 23 238908 238931 8421504 1 23 0 c 350027917700001599,350027917700001450,350027917700001209,350027917700003841,350027917700003278,350027917700002851,350027917700003040,350027917700001268,350027917700001438,350027917700002790,350027917700001239,350027917700000136,350027917700000748,350027917700002487,350027917700001052 0-23,0-20,0-23,1-23,0-22,0-19,10-31,3-24,1-22,0-20,3-24,0-21,3-24,10-31,19-40 NG-5226_9I1_4_1_3244_7526 99 gi|49256807|emb|Y08501.2| 61018 29 83M = 61177 203 AATTATATACCTGCTAATCC .toulouse.inra.fr 0 0 586 chrI 238909 238934 3500461888 25 238909 238934 8421504 1 25 0 c 350046188800000440,350046188800002221,350046188800000536,350046188800002276,350046188800003777,350046188800001716,350046188800000395,350046188800000315 3-25,3-24,3-23,26-47,16-37,3-25,0-21,20-39 Galaxy | Dataset | FASTQ to Tabular popgenie.org:8080 0 0 586 chrI 238910 238933 3500096011 23 238910 238933 8421504 1 23 0 c 350009601100000290,350009601100000303 27-49,26-48 <Html><Title> Complet list of 2vex hssp file Complet list of cnptia.embrapa.br 0 0 587 chrI 270389 270417 3500058223 24 270389 270417 8421504 2 16,8 0,20 g 350005822300000046 3-27 <Html><Title> Complet list of 1ua2 hssp file Complet list of cnptia.embrapa.br 0 0 587 chrI 298409 298435 3500045451 23 298409 298435 8421504 3 13,6,4 0,15,22 g 350004545100000009 10-33 Method for diagnosing testicular seminomas Nakamura 2003 0 587 chrI 302605 302629 3500429510 23 302605 302629 8421504 2 7,16 0,8 c 350042951000000221 2-25 DNA molecules encoding plant protoporphyrinogen oxidase and inhibitor-resistant mutant thereof S*L*Wo La Si 1999 0 587 chrI 302605 302629 3500406790 23 302605 302629 8421504 2 7,16 0,8 c 350040679000000225 2-25 Patent Operation for onzyme activity of protoporphyrin prooxidase in eukaryotic organism (Patent CN:1193096) E*R*Wa De 2005 0 587 chrI 302605 302629 3500343408 23 302605 302629 8421504 2 7,16 0,8 c 350034340800000111 2-25 Herbicide-tolerant protoporphyrinogen oxidase ("protox") genes Volrath 1998 0 587 chrI 302605 302629 3500301711 23 302605 302629 8421504 2 7,16 0,8 c 350030171100000113 2-25 Dna molecules encoding plant protoporphyrinogen oxidase and inhibitor-resistant mutants thereof Heifetz 1997 0 587 chrI 302605 302629 3500283769 23 302605 302629 8421504 2 7,16 0,8 c 350028376900000113 2-25 Dna molecules encoding plant protoporphyrinogen oxidase and inhibitor-resistant mutants thereof Heifetz 1998 0 587 chrI 302605 302629 3500244951 23 302605 302629 8421504 2 7,16 0,8 c 350024495100000125 2-25 Operation of enzymatic vitality of protoporphyrin primary oxidase in eukaryote E*R*Wa De 2001 0 587 chrI 302605 302629 3500236342 23 302605 302629 8421504 2 7,16 0,8 c 350023634200000125 2-25 Manipulation of protoporphyrinogen oxidase enzyme activity in eukaryotic organisms E*R*Wa De 1997 0 587 chrI 302605 302629 3500229078 23 302605 302629 8421504 2 7,16 0,8 c 350022907800000227 2-25 Patent Operation of enzymatic vitality of protoporphyrinogen oxidase in eukaryote (Patent CN:1263856) E*R*Wa De 2006 0 587 chrI 331591 333813 3500183388 66 331591 333813 8421504 3 22,22,22 0,1334,2200 c,g 350018338800000000,350018338800000003,350018338800000003,350018338800000002,350018338800000002 0-22,0-22,0-22,0-22,0-22 21124861 10.1371/journal.pgen.1001211 1553-7404 PLOS Genetics PLOS Genetics: A Novel zf-MYND Protein, CHB-3, Mediates Guanylyl Cyclase Localization to Sensory Cilia and Controls Body Size of Caenorhabditis elegans Fujiwara 2010 0 587 chrI 360603 360627 3500414846 24 360603 360627 8421504 1 24 0 c 350041484600001717 4-28 Rank Transcription unit Names NtcA site Downstream of ntcA site Position of ntcA site Score -10 like coitweb.uncc.edu 0 0 588 chrI 437629 437657 3500443211 23 437629 437657 8421504 2 6,17 0,11 g 350044321100001625 16-39 TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca term.cbcb.umd.edu 0 0 588 chrI 459597 459957 3500249133 100 459597 459957 8421504 2 50,50 0,310 c,g 350024913300000017,350024913300000017,350024913300000018,350024913300000018 0-50,0-50,0-50,0-50 roarrays.ucsd.edu 0 0 588 chrI 462469 462497 3500299309 24 462469 462497 8421504 2 12,12 0,16 c 350029930900000237 9-33 Methods For Increasing The Resistance In Plants To Biotropic Fungi .freshpatents.com 0 0 588 chrI 462469 462497 3500275463 24 462469 462497 8421504 2 12,12 0,16 c 350027546300000023 9-33 Method For Producing Polyunsaturated Fatty Acids In Transgenic Organisms .freshpatents.com 0 0 588 chrI 462469 462497 3500144883 24 462469 462497 8421504 2 12,12 0,16 c 350014488300000878 9-33 Method for producing polyunsaturated fatty acids in transgenic plants - Patent application www.faqs.org 0 0 588 chrI 462469 462497 3500063158 24 462469 462497 8421504 2 12,12 0,16 c 350006315800000181 9-33 Method for Producing Polyunsaturated C20 and C22 Fatty Acids with at Least Four Double Bonds in Transgenic Plants - Patent application www.faqs.org 0 0 588 chrI 487879 487903 3500289693 23 487879 487903 8421504 2 5,18 0,6 c 350028969300000196 10-33 5’ binding in Red color (shadow in green) www.nature.com 0 0 588 chrI 493438 493465 3500434239 26 493438 493465 8421504 2 16,10 0,17 c 350043423900000000 0-26 19403699 10.1091/mbc.E08-09-0912 1059-1524 Molecular Biology of the Cell Normal Formation of a Subset of Intestinal Granules in Caenorhabditis elegans Requires ATP-binding Cassette Transporters HAF-4 and HAF-9, Which Are Highly Homologous to Human Lysosomal Peptide Transporter TAP-Like Kawai 2009 5 588 chrI 494493 494516 3500009833 23 494493 494516 8421504 1 23 0 c 350000983300000074 3-26 Multiple drug resistance gene of Aureobasidium pullulans - Patent # 5516655 - PatentGenius .patentgenius.com 0 0 588 chrI 503777 504125 3500276014 39 503777 504125 8421504 2 20,19 0,329 c,g 350027601400000000,350027601400000001,350027601400000001 0-20,0-19,0-19 Chromosome-Wide Regulation of Meiotic Crossover Formation in Caenorhabditis elegans Requires Properly Assembled Chromosome Axes www.genetics.org 0 0 588 chrI 506479 508963 3500459432 40 506479 508963 8421504 2 20,20 0,2464 c,g 350045943200000000,350045943200000000,350045943200000001 0-20,0-20,0-20 DEPS-1 promotes P-granule assembly and RNA interference in C. elegans germ cells ev.biologists.org 0 0 588 chrI 506479 508963 3500380080 40 506479 508963 8421504 2 20,20 0,2464 c,g 350038008000000000,350038008000000000,350038008000000001 0-20,0-20,0-20 18234720 10.1242/dev.015552 0950-1991 Development DEPS-1 promotes P-granule assembly and RNA interference in C. elegans germ cells Spike 2008 7 589 chrI 533063 533091 3500348158 23 533063 533091 8421504 2 8,15 0,13 g 350034815800000247 5-28 <Html><Title> Complet list of 1r9d hssp file Complet list of cnptia.embrapa.br 0 0 589 chrI 536496 541634 3500314777 2418 536496 541634 8421504 11 20,125,258,230,210,275,208,321,261,222,288 0,625,809,1112,2208,2959,3307,3570,4229,4570,4850 p,c,g 350031477700000010,350031477700000002,350031477700000003,350031477700000016,350031477700000012,350031477700000012,350031477700000004,350031477700000004,350031477700015003,350031477700015004,350031477700015005,350031477700015007,350031477700015008,350031477700015009,350031477700015010,350031477700015012,350031477700015013,350031477700015014,350031477700015015,350031477700015017,350031477700015018,350031477700015019,350031477700015020,350031477700015022,350031477700015023,350031477700015024,350031477700015025,350031477700015027,350031477700015028,350031477700015029,350031477700015030,350031477700015033,350031477700015034,350031477700015035,350031477700015037,350031477700015038,350031477700015039,350031477700015040,350031477700015042,350031477700015043,350031477700015044,350031477700015045,350031477700015047,350031477700015048,350031477700015050,350031477700000013,350031477700000005 8-28,0-20,0-19,16-2395,0-30,0-30,0-30,0-30,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-30,0-30 Increasing lifespan by modulation of WWP-1 and UBC-18 - Patent application www.faqs.org 0 0 589 chrI 536496 541634 3500220984 99 536496 541634 8421504 3 20,49,30 0,625,5108 c,g 350022098400000002,350022098400000003,350022098400000004,350022098400000004,350022098400000005 0-20,0-19,0-30,0-30,0-30 Increasing Lifespan By Modulation Of Wwp-1 And Ubc-18 .freshpatents.com 0 0 589 chrI 570905 570932 3500000260 23 570905 570932 8421504 2 10,13 0,14 g 350000026000000035 0-24 Ligand - Patent application www.faqs.org 0 0 589 chrI 648265 648291 3500038735 23 648265 648291 8421504 2 6,17 0,9 g 350003873500000861 5-28 TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca term.cbcb.umd.edu 0 0 590 chrI 664491 664568 3500006718 27 664491 664568 8421504 3 6,3,18 0,9,59 c 350000671800000128 0-27 CHIMERIC THERAPEUTICS, COMPOSITIONS, AND METHODS FOR USING SAME - Patent application www.faqs.org 0 0 590 chrI 709512 709535 3500115005 23 709512 709535 8421504 1 23 0 g 350011500500000125 2-25 <Html><Title> Complet list of 2x4z hssp file Complet list of cnptia.embrapa.br 0 0 590 chrI 719297 719326 3500165221 23 719297 719326 8421504 3 5,6,12 0,6,17 g 350016522100000067 6-29 Ortsgerichtete Rekombination in Chlamydomonas reinhardtii uni-regensburg.de 0 0 590 chrI 738945 738970 3500090659 25 738945 738970 8421504 1 25 0 g 350009065900000133 0-25 <Html><Title> Complet list of 1l1f hssp file Complet list of cnptia.embrapa.br 0 0 590 chrI 754682 754766 3500415441 84 754682 754766 8421504 1 84 0 c 350041544100000636,350041544100000632,350041544100000628,350041544100000630,350041544100000631 0-84,0-84,0-84,0-84,4-77 Genomic tRNA Database: Caenorhabditis brenneri (WUGSC 4.0 Jan 2007) gtrnadb.ucsc.edu 0 0 590 chrI 754689 754728 3500386452 39 754689 754728 8421504 1 39 0 c 350038645200000474,350038645200000472 7-46,7-46 NEUROPROTECTIVE MOLECULES AND METHODS OF TREATING NEUROLOGICAL DISORDERS AND INDUCING STRESS GRANULES Anderson 2011 0 591 chrI 794529 826353 3500197891 42 794529 826353 8421504 2 19,23 0,31801 g 350019789100000400,350019789100000030 11-30,13-36 Index Seq ID Count Primer type Orientation Start Len tm GC% Any compl 3' compl Seq Prod size Seq len openwetware.org 0 0 591 chrI 797160 797186 3500158435 24 797160 797186 8421504 2 5,19 0,7 g 350015843500000163 4-28 <Html><Title> Complet list of 1ccg hssp file Complet list of cnptia.embrapa.br 0 0 591 chrI 816152 816180 3500233403 23 816152 816180 8421504 2 15,8 0,20 c 350023340300000428 0-23 TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca term.cbcb.umd.edu 0 0 591 chrI 842451 842482 3500084045 26 842451 842482 8421504 2 15,11 0,20 c 350008404500000048 0-26 <Html><Title> Complet list of 1xhy hssp file Complet list of cnptia.embrapa.br 0 0 591 chrI 846222 846258 3500310341 36 846222 846258 8421504 1 36 0 c 350031034100000068 0-36 An overview of the Biostrings/BSgenome framework .bioconductor.org 0 0 591 chrI 846222 846258 3500126654 36 846222 846258 8421504 1 36 0 c 350012665400000037 0-36 A Tour of the IRanges/Biostrings/BSgenome Framework .bioconductor.org 0 0 591 chrI 875561 876726 3500390138 43 875561 876726 8421504 2 21,22 0,1143 c,g 350039013800000011,350039013800000011,350039013800000010 0-21,0-21,0-22 22090313 10.1096/fj.11-197798 0892-6638 The FASEB Journal Light-sensitive coupling of rhodopsin and melanopsin to Gi/o and Gq signal transduction in Caenorhabditis elegans Cao 2012 6 591 chrI 903386 903412 3500405897 26 903386 903412 8421504 1 26 0 c 350040589700000000 0-26 Embryonic handedness choice in C. elegansinvolves the G protein GPA-16 ev.biologists.org 0 0 73 chrI 917223 926880 3500438339 239 917223 926880 8421504 6 23,28,33,45,45,65 0,62,1742,1872,9297,9592 p,c,g 350043833900000003,350043833900000004,350043833900000004,350043833900015000,350043833900015002,350043833900015004,350043833900000000,350043833900000000,350043833900015007,350043833900000002,350043833900000002,350043833900000001,350043833900000001,350043833900015006,350043833900015008 0-23,0-28,0-28,0-78,0-96,0-78,0-24,0-24,0-45,0-25,0-25,0-28,0-28,0-63,0-63 Bioinformation open access ioinformation.net 0 0 73 chrI 917223 926880 3500155113 239 917223 926880 8421504 6 23,28,33,45,45,65 0,62,1742,1872,9297,9592 p,c,g 350015511300000003,350015511300000004,350015511300000004,350015511300015000,350015511300015002,350015511300015004,350015511300000000,350015511300000000,350015511300015007,350015511300000002,350015511300000002,350015511300000001,350015511300015006,350015511300015008 0-23,0-28,0-28,0-78,0-96,0-78,0-24,0-24,0-45,0-25,0-25,0-28,0-63,0-63 Identification and comparative analysis of novel alternatively spliced transcripts of RhoGEF domain encoding gene in C. elegans and C. briggsae | Mohammad Tabish - Academia.edu www.academia.edu 0 0 592 chrI 922688 922711 3500128195 23 922688 922711 8421504 1 23 0 g 350012819500000077 10-35 degree Philosophiae Doctor in the Department of Plant Sciences (Plant Breeding) November 2010 Promotor: Prof. Liezel Herselman (PhD) etd.uovs.ac.za 0 0 592 chrI 989632 989666 3500406671 29 989632 989666 8421504 3 5,17,7 0,6,27 g 350040667100000448 4-33 <Html><Title> Complet list of 3eew hssp file Complet list of cnptia.embrapa.br 0 0 592 chrI 992620 992646 3500450683 23 992620 992646 8421504 2 17,6 0,20 g 350045068300000029 0-27 transcription machinery - g-rich - 4g+3g PF11 www.docstoc.com 0 0 9 chrI 1024578 1060412 3500344389 43 1024578 1060412 8421504 5 5,14,5,14,5 0,6,22,35812,35829 g 350034438900001537,350034438900000832 0-24,27-46 TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca term.cbcb.umd.edu 0 0 592 chrI 1024578 1024605 3500190843 24 1024578 1024605 8421504 3 5,14,5 0,6,22 g 350019084300001535 0-24 TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca term.cbcb.umd.edu 0 0 592 chrI 1037624 1037649 3500007258 24 1037624 1037649 8421504 2 11,13 0,12 c 350000725800000003 25-49 Synthetic Ultrashort Cationic Lipopeptides Induce Systemic Plant Defense Responses against Bacterial and Fungal Pathogens aem.asm.org 0 0 592 chrI 1046513 1046537 3500375948 24 1046513 1046537 8421504 1 24 0 c 350037594800000266 20-44 Method for Rapidly Screening Microbial Hosts to Identify Certain Strains with Improved Yield and/or Quality in the Expression of Heterologous Proteins - Patent application www.faqs.org 0 0 592 chrI 1046513 1046537 3500163662 24 1046513 1046537 8421504 1 24 0 c 350016366200000266 20-44 Method for Rapidly Screening Microbial Hosts to Identify Certain Strains with Improved Yield and/or Quality in the Expression of Heterologous Proteins - US Patent Application 20100137162 Description ww.patentstorm.us 0 0 592 chrI 1047686 1047712 3500226882 23 1047686 1047712 8421504 3 5,4,14 0,7,12 g 350022688200000027 1-24 Instrumentation free DNA testing w.plosbiology.org 0 0 592 chrI 1048359 1048383 3500148407 24 1048359 1048383 8421504 1 24 0 g 350014840700000061 7-38 Modified Aerolysin And Methods Of Use For Treating Lung Cancer .freshpatents.com 0 0 593 chrI 1050550 1050573 3500245053 23 1050550 1050573 8421504 1 23 0 c 350024505300000835 18-41 TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca term.cbcb.umd.edu 0 0 593 chrI 1068465 1068493 3500396445 23 1068465 1068493 8421504 2 12,11 0,17 g 350039644500000006 0-23 Volume 6 Number 25 5 November, 2011 demicjournals.org 0 0 593 chrI 1071488 1074650 3500390138 44 1071488 1074650 8421504 2 22,22 0,3140 c,g 350039013800000020,350039013800000020,350039013800000021 0-22,0-22,0-22 22090313 10.1096/fj.11-197798 0892-6638 The FASEB Journal Light-sensitive coupling of rhodopsin and melanopsin to Gi/o and Gq signal transduction in Caenorhabditis elegans Cao 2012 6 593 chrI 1074280 1074343 3500070749 63 1074280 1074343 8421504 1 63 0 p 350007074900015003 0-63 Chimeric G proteins and uses thereof Jones 1999 0 GNAS 593 chrI 1074322 1074347 3500446041 25 1074322 1074347 8421504 1 25 0 g 350044604100000005 5-30 22323705 10.1523/JNEUROSCI.2064-11.2012 0270-6474 The Journal of Neuroscience Serotonin Activates Overall Feeding by Activating Two Separate Neural Pathways in Caenorhabditis elegans Song 2012 7 593 chrI 1074322 1074347 3500369237 25 1074322 1074347 8421504 1 25 0 g 350036923700000005 5-30 Behavioral/Systems/Cognitive SerotoninActivatesOverallFeedingbyActivatingTwo SeparateNeuralPathwaysin Caenorhabditiselegans egans.som.vcu.edu 0 0 593 chrI 1074803 1074831 3500237231 26 1074803 1074831 8421504 2 20,6 0,22 g 350023723100001039 3-29 HWI-ST314_0081:5:1:20393:6442#0 89 gi|110640213|ref|NC_008253.1| 2540934 37 101M = 2540934 0 GAATGCC .toulouse.inra.fr 0 0 593 chrI 1079186 1079212 3500422547 24 1079186 1079212 8421504 2 18,6 0,20 c 350042254700000037 0-24 0009-7330 Forkhead Transcription Factors Coordinate Expression of Myocardial KATP Channel Subunits and Energy Metabolism s.ahajournals.org 0 9 593 chrI 1089123 1089149 3500368889 24 1089123 1089149 8421504 2 11,13 0,13 c 350036888900000418 7-31 <Html><Title> Complet list of 3gsb hssp file Complet list of cnptia.embrapa.br 0 0 593 chrI 1146313 1146346 3500143070 26 1146313 1146346 8421504 3 13,7,6 0,15,27 g 350014307000000129 0-26 <Html><Title> Complet list of 3a2p hssp file Complet list of cnptia.embrapa.br 0 0 593 chrI 1153914 1153947 3500008109 24 1153914 1153947 8421504 3 12,6,6 0,16,27 c 350000810900000230 9-33 Parasitic nematode transglutaminase proteins and uses thereof Chandrashekar 1997 0 74 chrI 1166267 1189126 3500463133 306 1166267 1189126 8421504 13 24,24,24,19,24,24,23,24,24,24,24,24,24 0,147,4554,7527,7579,9282,9429,10290,11653,14889,16181,21173,22835 c,g 350046313300000009,350046313300000009,350046313300000008,350046313300000008,350046313300000007,350046313300000007,350046313300000001,350046313300000006,350046313300000006,350046313300000005,350046313300000005,350046313300000004,350046313300000004,350046313300000010,350046313300000010,350046313300000011,350046313300000011,350046313300000013,350046313300000013,350046313300000012,350046313300000014,350046313300000014,350046313300000015 0-24,0-24,0-24,0-24,0-24,0-24,0-19,0-24,0-24,0-24,0-24,0-23,0-23,0-24,0-24,0-24,0-24,0-24,0-24,0-24,0-24,0-24,0-24 RNA Helicase 1 interacts with an ABC Transporter: Genetic Interactions with haf-6 holarworks.ku.edu 0 0 593 chrI 1166559 1167687 3500395114 41 1166559 1167687 8421504 2 20,21 0,1107 c,g 350039511400000031,350039511400000031,350039511400000030 0-20,0-20,0-21 23103171 10.1016/j.celrep.2012.09.019 2211-1247 Cell Reports Cell Reports - Antagonism between MES-4 and Polycomb Repressive Complex 2 Promotes Appropriate Gene Expression in C. elegans Germ Cells Gaydos 2012 0 593 chrI 1166559 1167687 3500150118 41 1166559 1167687 8421504 2 20,21 0,1107 c,g 350015011800000031,350015011800000031,350015011800000030 0-20,0-20,0-21 23103171 10.1016/j.celrep.2012.09.019 2211-1247 Cell Reports Cell Reports - Antagonism between MES-4 and Polycomb Repressive Complex 2 Promotes Appropriate Gene Expression in C. elegans Germ Cells Gaydos 2012 0 593 chrI 1173794 1176517 3500358796 84 1173794 1176517 8421504 3 19,25,40 0,1937,2683 c,g 350035879600000001,350035879600000002,350035879600000002,350035879600000004,350035879600000004 0-19,0-25,0-25,0-40,0-40 ATP-binding cassette transporters are required for efficient RNA interference in Caenorhabditis elegans. - ResearchGate .researchgate.net 0 0 593 chrI 1173794 1176517 3500052689 84 1173794 1176517 8421504 3 19,25,40 0,1937,2683 c,g 350005268900000001,350005268900000002,350005268900000002,350005268900000004 0-19,0-25,0-25,0-40 16723499 10.1091/mbc.E06-03-0192 1059-1524 Molecular Biology of the Cell ATP-binding Cassette Transporters Are Required for Efficient RNA Interference in Caenorhabditis elegans Sundaram 2006 5 595 chrI 1329762 1329803 3500138837 41 1329762 1329803 8421504 1 41 0 g 350013883700000009 9-50 20585459 10.1371/journal.pone.0011217 PLoS ONE Small DNA Pieces in C. elegans Are Intermediates of DNA Fragmentation during Apoptosis P. 2010 0 595 chrI 1339682 1341559 3500342593 44 1339682 1341559 8421504 2 24,20 0,1857 c,g 350034259300000000,350034259300000001,350034259300000001 0-24,0-20,0-20 The small ubiquitin-like modifier (SUMO) is required for gonadal and uterine–vulval morphogenesis in Caenorhabditis elegans enesdev.cshlp.org 0 0 595 chrI 1341134 1341157 3500173641 23 1341134 1341157 8421504 1 23 0 g 350017364100000000 0-23 Sumoylation of LIN-1 promotes transcriptional repression and inhibition of vulval cell fates devbio.wustl.edu 0 0 595 chrI 1379080 1382530 3500115005 42 1379080 1382530 8421504 3 15,5,22 0,17,3428 c 350011500500000171,350011500500000206 0-20,11-33 <Html><Title> Complet list of 2x4z hssp file Complet list of cnptia.embrapa.br 0 0 595 chrI 1382474 1382530 3500319585 46 1382474 1382530 8421504 4 21,5,15,5 0,26,34,51 c 350031958500000184,350031958500000290 0-21,3-28 <Html><Title> Complet list of 3ckx hssp file Complet list of cnptia.embrapa.br 0 0 595 chrI 1382499 1382530 3500251711 30 1382499 1382530 8421504 2 6,24 0,7 c 350025171100000478,350025171100000292,350025171100000698,350025171100000099 0-20,8-35,17-39,8-29 <Html><Title> Complet list of 1ea9 hssp file Complet list of cnptia.embrapa.br 0 0 595 chrI 1382500 1382530 3500428528 27 1382500 1382530 8421504 2 5,22 0,8 c 350042852800000076 0-27 <Html><Title> Complet list of 2zux hssp file Complet list of cnptia.embrapa.br 0 0 595 chrI 1382500 1382530 3500341598 27 1382500 1382530 8421504 2 5,22 0,8 c 350034159800000179,350034159800000226 15-42,19-39 <Html><Title> Complet list of 1asz hssp file Complet list of cnptia.embrapa.br 0 0 595 chrI 1382500 1382530 3500331014 25 1382500 1382530 8421504 3 5,15,5 0,8,25 c 350033101400000129 12-37 <Html><Title> Complet list of 1wsr hssp file Complet list of cnptia.embrapa.br 0 0 595 chrI 1382500 1382530 3500129293 25 1382500 1382530 8421504 3 5,15,5 0,8,25 c 350012929300000198 4-29 <Html><Title> Complet list of 2wta hssp file Complet list of cnptia.embrapa.br 0 0 595 chrI 1382500 1382530 3500006669 27 1382500 1382530 8421504 2 5,22 0,8 c 350000666900000161 1-28 <Html><Title> Complet list of 1vly hssp file Complet list of cnptia.embrapa.br 0 0 595 chrI 1382500 1382529 3500458978 26 1382500 1382529 8421504 2 5,21 0,8 c 350045897800000231 0-26 <Html><Title> Complet list of 1v9n hssp file Complet list of cnptia.embrapa.br 0 0 595 chrI 1382500 1382528 3500467340 25 1382500 1382528 8421504 2 5,20 0,8 c 350046734000000092 4-29 <Html><Title> Complet list of 1kw3 hssp file Complet list of cnptia.embrapa.br 0 0 595 chrI 1382500 1382528 3500125682 25 1382500 1382528 8421504 2 5,20 0,8 c 350012568200000575 0-25 <Html><Title> Complet list of 1lqa hssp file Complet list of cnptia.embrapa.br 0 0 595 chrI 1382500 1382527 3500331756 24 1382500 1382527 8421504 2 5,19 0,8 c 350033175600000031 0-24 <Html><Title> Complet list of 2v23 hssp file Complet list of cnptia.embrapa.br 0 0 595 chrI 1382500 1382527 3500158435 24 1382500 1382527 8421504 2 5,19 0,8 c 350015843500000321 8-32 <Html><Title> Complet list of 1ccg hssp file Complet list of cnptia.embrapa.br 0 0 595 chrI 1382508 1382532 3500008851 23 1382508 1382532 8421504 2 5,18 0,6 c 350000885100000052 0-23 <Html><Title> Complet list of 1e32 hssp file Complet list of cnptia.embrapa.br 0 0 595 chrI 1397115 1397138 3500295681 23 1397115 1397138 8421504 1 23 0 g 350029568100000037 10-33 TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca term.cbcb.umd.edu 0 0 595 chrI 1433022 1433051 3500017403 25 1433022 1433051 8421504 2 15,10 0,19 c 350001740300000482 16-41 TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca term.cbcb.umd.edu 0 0 596 chrI 1447139 1447212 3500415441 73 1447139 1447212 8421504 1 73 0 c 350041544100000148,350041544100000138 0-73,0-73 Genomic tRNA Database: Caenorhabditis brenneri (WUGSC 4.0 Jan 2007) gtrnadb.ucsc.edu 0 0 596 chrI 1447145 1447205 3500386452 60 1447145 1447205 8421504 1 60 0 c 350038645200000238 6-66 NEUROPROTECTIVE MOLECULES AND METHODS OF TREATING NEUROLOGICAL DISORDERS AND INDUCING STRESS GRANULES Anderson 2011 0 596 chrI 1447145 1447205 3500235647 60 1447145 1447205 8421504 1 60 0 c 350023564700000238,350023564700001031 6-66,6-66 NEUROPROTECTIVE MOLECULES AND METHODS OF TREATING NEUROLOGICAL DISORDERS AND INDUCING STRESS GRANULES - Patent application www.faqs.org 0 0 596 chrI 1447145 1447188 3500055919 43 1447145 1447188 8421504 1 43 0 c 350005591900000001 15-58 Patent HUMAN SUPPRESSOR tRNA OLIGONUCLEOTIDES AND METHODS OF USE FOR SAME (Patent EP:1045902) Charles 2005 0 596 chrI 1447162 1447185 3500449356 23 1447162 1447185 8421504 1 23 0 c 350044935600000012 0-23 Table S1 Oligonucleotides used in this study (A mcb.asm.org 0 0 596 chrI 1447552 1447982 3500197883 78 1447552 1447982 8421504 2 7,71 0,359 p 350019788300015030 288-366 Vol. Multiple actin-based motor genes Dictyostelium w.molbiolcell.org 0 0 596 chrI 1504858 1504883 3500143070 23 1504858 1504883 8421504 2 6,17 0,8 g 350014307000000519 6-29 <Html><Title> Complet list of 3a2p hssp file Complet list of cnptia.embrapa.br 0 0 596 chrI 1506289 1515391 3500022998 47 1506289 1515391 8421504 5 15,5,7,5,15 0,17,9070,9080,9087 c,g 350002299800000067,350002299800000506 21-41,4-35 Novel Acetylcholinesterase Gene Responsible for Insecticide Resistance and Applications Thereof - Patent application www.faqs.org 0 0 596 chrI 1539136 1539164 3500020487 23 1539136 1539164 8421504 2 16,7 0,21 g 350002048700000001 0-23 Recognition Specificity and RAR1/SGT1 Dependence in Barley Mla Disease Resistance Genes to the Powdery Mildew Fungus www.plantcell.org 0 0 597 chrI 1577669 1577697 3500260141 28 1577669 1577697 8421504 1 28 0 c,g 350026014100000441,350026014100000441 0-28,0-28 <HTML> <HEAD><TITLE>Show BLAST File

Show BLAST File

Complet list of 1axn hssp file Complet list of cnptia.embrapa.br 0 0 597 chrI 1682877 1683402 3500102666 405 1682877 1683402 8421504 9 45,45,45,45,45,45,45,45,45 0,48,96,144,240,288,336,384,480 p 350010266600015062,350010266600015063,350010266600015064,350010266600015065,350010266600015067,350010266600015068,350010266600015069,350010266600015070,350010266600015072 0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45 DRG11-RESPONSIVE (DRAGON) GENE AND USES THEREOF - Patent application www.faqs.org 0 0 598 chrI 1709538 1711017 3500212106 38 1709538 1711017 8421504 2 19,19 0,1460 g 350021210600000012,350021210600000013 0-19,0-19 Supplementary Information ans.imbb.forth.gr 0 0 598 chrI 1738641 1738721 3500195762 80 1738641 1738721 8421504 1 80 0 c,g 350019576200000006,350019576200000006 0-80,0-80 Statistical Inference for Well-ordered Structures in Nucleotide Sequences nces.computer.org 0 0 598 chrI 1738651 1738675 3500350956 24 1738651 1738675 8421504 1 24 0 c,g 350035095600000035,350035095600000035,350035095600000034,350035095600000034 0-22,0-22,0-24,0-24 24037191 10.1590/0074-0276108062013005 0074-0276 Memórias do Instituto Oswaldo Cruz Memórias do Instituto Oswaldo Cruz - Identification and characterisation of microRNAs in young adults of Angiostrongylus cantonensis via a deep-sequencing approach Chang 2013 2 598 chrI 1738651 1738675 3500019132 24 1738651 1738675 8421504 1 24 0 c,g 350001913200000035,350001913200000035,350001913200000034,350001913200000034 0-22,0-22,0-24,0-24 24037191 10.1590/0074-0276108062013005 0074-0276 Memórias do Instituto Oswaldo Cruz Memórias do Instituto Oswaldo Cruz - Identification and characterisation of microRNAs in young adults of Angiostrongylus cantonensis via a deep-sequencing approach Chang 2013 2 598 chrI 1738651 1738675 3500011796 24 1738651 1738675 8421504 1 24 0 c,g 350001179600000022,350001179600000022 0-24,0-24 Wyman Supplemental Methods genome.cshlp.org 0 0 598 chrI 1811073 1811097 3500023334 24 1811073 1811097 8421504 1 24 0 c 350002333400000346 23-47 Proteins, Polynucleotides Encoding Them And Methods Of Using The Same .freshpatents.com 0 0 599 chrI 1835931 1840890 3500070749 135 1835931 1840890 8421504 4 24,21,7,83 0,3138,4490,4876 p,c,g 350007074900000011,350007074900000013,350007074900000013,350007074900000029,350007074900015001,350007074900000025,350007074900000014,350007074900000014,350007074900000017,350007074900000017,350007074900000012 8-32,0-21,0-21,27-57,0-63,0-22,0-20,0-20,3-23,3-23,8-35 Chimeric G proteins and uses thereof Jones 1999 0 599 chrI 1835935 1840891 3500428968 40 1835935 1840891 8421504 2 20,20 0,4936 g 350042896800000004,350042896800000005 20-40,15-35 17021164 10.1523/JNEUROSCI.0819-06.2006 0270-6474 The Journal of Neuroscience Starvation Induces cAMP Response Element-Binding Protein-Dependent Gene Expression through Octopamine–Gq Signaling in Caenorhabditis elegans Suo 2006 7 599 chrI 1835936 1840908 3500141678 50 1835936 1840908 8421504 2 25,25 0,4947 g 350014167800000010,350014167800000011 5-30,6-31 ScienceDirect.com - Neuron - Dopamine Mediates Context-Dependent Modulation of Sensory Plasticity in C. elegans sciencedirect.com 0 0 599 chrI 1835937 1841705 3500455460 90 1835937 1841705 8421504 3 24,42,24 0,4912,5744 c,g 350045546000000000,350045546000000000,350045546000000002,350045546000000002,350045546000000001,350045546000000001,350045546000000006,350045546000000010 0-24,0-24,0-38,0-38,0-39,0-39,15-40,9-33 12925583 10.1242/dev.00670 0950-1991 Development Modulation of EGF receptor-mediated vulva development by the heterotrimeric G-protein Gαq and excitable cells in C. elegans Moghal 2003 7 599 chrI 1835937 1841705 3500264911 90 1835937 1841705 8421504 3 24,42,24 0,4912,5744 c,g 350026491100000005,350026491100000000,350026491100000000,350026491100000002,350026491100000002,350026491100000001,350026491100000001,350026491100000006,350026491100000010 20-44,0-24,0-24,0-38,0-38,0-39,0-39,15-40,9-33 Modulation of EGF receptor-mediated vulva development by the heterotrimeric G-protein G q and excitable cells in C. elegans ev.biologists.org 0 0 599 chrI 1836033 1839337 3500046024 126 1836033 1839337 8421504 3 22,56,48 0,2127,3256 p 350004602400015043,350004602400015133 111-189,0-48 Yeast cells engineered to produce pheromone system protein surrogates, and uses therefor - US Patent 7235648 Description ww.patentstorm.us 0 0 599 chrI 1836033 1838216 3500152838 78 1836033 1838216 8421504 2 22,56 0,2127 p 350015283800015037 111-189 US Patent # 5,876,951. Yeast cells engineered to produce pheromone system protein surrogates and uses therefor - Patents.com www.patents.com 0 0 GNA14 599 chrI 1836905 1838942 3500283640 82 1836905 1838942 8421504 4 20,20,22,20 0,111,1910,2017 c,g 350028364000000006,350028364000000007,350028364000000008,350028364000000008,350028364000000009,350028364000000009 0-20,0-20,0-22,0-22,0-20,0-20 23263989 10.1128/MCB.01462-12 Molecular and Cellular Biology The Conserved PHD1-PHD2 Domain of ZFP-1/AF10 Is a Discrete Functional Module Essential for Viability in Caenorhabditis elegans Daphne 2013 0 599 chrI 1839087 1839527 3500390138 43 1839087 1839527 8421504 2 20,23 0,417 c,g 350039013800000002,350039013800000002,350039013800000003 0-20,0-20,0-23 22090313 10.1096/fj.11-197798 0892-6638 The FASEB Journal Light-sensitive coupling of rhodopsin and melanopsin to Gi/o and Gq signal transduction in Caenorhabditis elegans Cao 2012 6 599 chrI 1839159 1840887 3500054924 318 1839159 1840887 8421504 4 35,115,88,80 0,93,1181,1648 p 350005492400015003,350005492400015005,350005492400015034 0-150,9-177,0-48 GNA11 AND GNAQ EXON 4 MUTATIONS IN MELANOMA - Patent application www.faqs.org 0 0 599 chrI 1840340 1840887 3500346787 168 1840340 1840887 8421504 2 88,80 0,467 p 350034678700015007 9-177 GNA11 MUTATIONS IN MELANOMA Bastian 2010 0 599 chrI 1840340 1840887 3500253137 168 1840340 1840887 8421504 2 88,80 0,467 p 350025313700015009 9-177 GNA11 AND GNAQ EXON 4 MUTATIONS IN MELANOMA Griewank 2011 0 599 chrI 1840394 1840818 3500167995 45 1840394 1840818 8421504 2 34,11 0,413 p 350016799500015021 0-45 GNAQ MUTATIONS IN MELANOMA - Patent application www.faqs.org 0 0 599 chrI 1840403 1840887 3500405757 105 1840403 1840887 8421504 2 25,80 0,404 p 350040575700015045 0-105 protein a subunit specifically expressed hematopoietic cells brary.caltech.edu 0 0 599 chrI 1840412 1840836 3500442741 45 1840412 1840836 8421504 2 16,29 0,395 p 350044274100015122 0-45 Method For The Detection Of Post-translational Modifications .freshpatents.com 0 0 599 chrI 1840412 1840836 3500370950 45 1840412 1840836 8421504 2 16,29 0,395 p 350037095000015103 0-45 Methods Of Using GPR101 Receptors To Identify Modulators Of Hypothalamic Proopiomelanocortin (POMC) www.docstoc.com 0 0 599 chrI 1841683 1843234 3500314113 41 1841683 1843234 8421504 2 21,20 0,1531 g 350031411300000003,350031411300000002 0-21,0-20 22171324 10.1091/mbc.E11-06-0505 1059-1524 Molecular Biology of the Cell Ce-emerin and LEM-2: essential roles in Caenorhabditis elegans development, muscle function, and mitosis Barkan 2012 5 599 chrI 1843408 1843769 3500260730 117 1843408 1843769 8421504 6 21,18,6,27,24,21 0,175,250,262,295,340 p,c,g 350026073000000000,350026073000000000,350026073000015011,350026073000015010,350026073000015013,350026073000015015,350026073000015017,350026073000015005,350026073000015016,350026073000000001,350026073000000001 0-21,0-21,0-75,0-75,24-96,0-78,0-75,0-51,30-81,0-21,0-21 Gene expression and pharmacology of nematode NLP-12 neuropeptides www.mcgill.ca 0 0 599 chrI 1863009 1863035 3500231029 23 1863009 1863035 8421504 2 13,10 0,16 c 350023102900003707 26-49 TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca term.cbcb.umd.edu 0 0 599 chrI 1869608 1905418 3500115005 38 1869608 1905418 8421504 3 6,13,19 0,11,35791 g 350011500500000218,350011500500000207 7-26,15-34 <Html><Title> Complet list of 2x4z hssp file Complet list of cnptia.embrapa.br 0 0 599 chrI 1882136 1882697 3500276014 38 1882136 1882697 8421504 2 19,19 0,542 c,g 350027601400000003,350027601400000003,350027601400000002 0-19,0-19,0-19 Chromosome-Wide Regulation of Meiotic Crossover Formation in Caenorhabditis elegans Requires Properly Assembled Chromosome Axes www.genetics.org 0 0 599 chrI 1883419 1883444 3500290538 24 1883419 1883444 8421504 2 8,16 0,9 c 350029053800000422 20-44 TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca term.cbcb.umd.edu 0 0 599 chrI 1883419 1883444 3500241007 24 1883419 1883444 8421504 2 8,16 0,9 c 350024100700000461 20-44 TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca term.cbcb.umd.edu 0 0 599 chrI 1924374 1932034 3500112419 61 1924374 1932034 8421504 3 21,20,20 0,82,7640 c,g 350011241900000013,350011241900000013,350011241900000006,350011241900000007,350011241900000007 0-21,0-21,8-28,7-27,7-27 10.1074/jbc.M704235200 The Journal of biological chemistry BIOSYNTHESIS OF TRUNCATED N-LINKED OLIGOSACCHARIDES RESULTS FROM NON-ORTHOLOGOUS HEXOSAMINIDASE-MEDIATED MECHANISMS IN NEMATODES, PLANTS AND INSECTS Martin 2007 0 599 chrI 1924374 1932034 3500053064 61 1924374 1932034 8421504 3 21,20,20 0,82,7640 c,g 350005306400000013,350005306400000013,350005306400000006,350005306400000006,350005306400000007,350005306400000007 0-21,0-21,8-28,8-28,7-27,7-27 17636254 10.1074/jbc.M704235200 0021-9258 Journal of Biological Chemistry Biosynthesis of Truncated N-Linked Oligosaccharides Results from Non-orthologous Hexosaminidase-mediated Mechanisms in Nematodes, Plants, and Insects Gutternigg 2007 5 600 chrI 1973044 1973071 3500084894 24 1973044 1973071 8421504 2 13,11 0,16 g 350008489400000421 9-33 Compositions And Methods For Inhibiting Expression Of A Gene From The Ebola Virus - Patent application www.faqs.org 0 0 600 chrI 1974180 2010394 3500115005 38 1974180 2010394 8421504 2 19,19 0,36195 g 350011500500000071,350011500500000226 11-30,8-27 <Html><Title> Complet list of 2x4z hssp file Complet list of cnptia.embrapa.br 0 0 600 chrI 1974188 1974215 3500464204 23 1974188 1974215 8421504 2 13,10 0,17 g 350046420400000026 9-32 <Html><Title> Complet list of 1xjl hssp file Complet list of cnptia.embrapa.br 0 0 600 chrI 1997777 1997802 3500004993 23 1997777 1997802 8421504 2 8,15 0,10 c 350000499300000004 16-39 SourceForge.net: SAM tools: samtools-help sourceforge.net 0 0 600 chrI 2000781 2001381 3500289420 600 2000781 2001381 8421504 1 600 0 g 350028942000000003 0-600 No Slide Title mainland.cctt.org 0 0 600 chrI 2000781 2001381 3500074092 600 2000781 2001381 8421504 1 600 0 g 350007409200000000 0-600 ماهو الدنا aculty.ksu.edu.sa 0 0 600 chrI 2027807 2029452 3500195910 248 2027807 2029452 8421504 6 40,42,41,42,41,42 0,380,564,1460,1524,1603 g 350019591000000001 0-492 Transfer Learning in Computational Biology raetschlab.org 0 0 600 chrI 2038805 2038831 3500325016 24 2038805 2038831 8421504 2 15,9 0,17 c 350032501600000001 1-25 <HEAD><TITLE>yitV 

 
Similar regions between promoters 	dbtbs.hgc.jp	0	0		
600	chrI	2065109	2093355	3500031175	40		2065109	2093355	8421504	3	13,7,20	0,16,28226	c,g	350003117500000226,350003117500000120	20-40,6-27						Prf protein and nucleic acid sequences: compositions and methods for plant pathogen resistance - Patent # 6245510 - PatentGenius	.patentgenius.com	0	0		
600	chrI	2069271	2069447	3500464597	43		2069271	2069447	8421504	2	23,20	0,156	c,g	350046459700000017,350046459700000017,350046459700000016,350046459700000016	0-23,0-23,0-20,0-20		21858156	10.1371/journal.pone.0023527	1932-6203	PLOS ONE	PLOS ONE: Lifespan-Extending Effects of Royal Jelly and Its Related Substances on the Nematode Caenorhabditis elegans	Honda	2011	4		
600	chrI	2070590	2072731	3500034134	59		2070590	2072731	8421504	3	20,19,20	0,1689,2121	c,g	350003413400000000,350003413400000001,350003413400000001,350003413400000009,350003413400000009	0-20,0-19,0-19,0-20,0-20						Prohibitin couples diapause signalling to mitochondrial metabolism during ageing in C. elegans	ans.imbb.forth.gr	0	0		
600	chrI	2070920	2072326	3500005954	80		2070920	2072326	8421504	4	20,20,20,20	0,449,1307,1386	c,g	350000595400000000,350000595400000002,350000595400000002,350000595400000003,350000595400000003,350000595400000001	0-20,0-20,0-20,0-20,0-20,0-20						ナショナルバイオリソースプロジェクト (NBRP) C.elegans Mutants	.shigen.nig.ac.jp	0	0		
600	chrI	2071447	2072256	3500062085	42		2071447	2072256	8421504	2	21,21	0,788	c,g	350006208500000002,350006208500000002,350006208500000003,350006208500000003,350006208500000007,350006208500000007	0-21,0-21,0-21,0-21,0-21,0-21		12794069	10.1074/jbc.M304877200	0021-9258	Journal of Biological Chemistry	The Mitochondrial Prohibitin Complex Is Essential for Embryonic Viability and Germline Function in Caenorhabditis elegans	Sanz	2003	5		
600	chrI	2072691	2076100	3500389640	1017		2072691	2076100	8421504	5	118,467,72,249,111	0,730,1206,2018,3298	p	350038964000015013,350038964000015044,350038964000015045,350038964000015069	0-348,0-237,0-102,0-330						Characterization of a ranavirus inhibitor of the antiviral protein kinase PKR	biomedcentral.com	0	0		
600	chrI	2073453	2073600	3500353221	147		2073453	2073600	8421504	1	147	0	p	350035322100015012	0-147						THÈSE / UNIVERSITÉ DE RENNES 1 sous le seau de lUniversité Européenne de Bretagne	m.univ-rennes1.fr	0	0		
600	chrI	2073453	2073600	3500011552	147		2073453	2073600	8421504	1	147	0	p	350001155200015012	0-147						THÈSE / UNIVERSITÉ DE RENNES 1 sous le seau de lUniversité Européenne de Bretagne	m.univ-rennes1.fr	0	0		
601	chrI	2102155	2102179	3500254907	23		2102155	2102179	8421504	2	7,16	0,8	c	350025490700000208	7-36					Patent	DNA molecules that code for enzymes involved in starch synthesis, vectors, bacteria, transgenic plant cells and plants containing said molecules (Patent US:6130367)	Abel	2000	0		
601	chrI	2112721	2112749	3500231029	25		2112721	2112749	8421504	3	15,5,5	0,16,23	g	350023102900000702	10-35						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
601	chrI	2179650	2179737	3500361188	41		2179650	2179737	8421504	2	20,21	0,66	g	350036118800000008,350036118800000009	0-20,0-21						Genetik İfade Profilleri Belirlenmesi C. elegans… (Translated to Turkish) | JoVE Video	www.jove.com	0	0		
601	chrI	2187233	2187259	3500014029	23		2187233	2187259	8421504	2	7,16	0,10	g	350001402900000230	0-23						Développement d’une méthodologie d’analyse de la conservation de synténie chez les plantes. Du génome d’Arabidopsis à celui du Tournesol	s.inp-toulouse.fr	0	0		
601	chrI	2202509	2216398	3500344284	44		2202509	2216398	8421504	4	4,6,15,19	0,5,16,13870	g	350034428400000062,350034428400000717	10-35,9-28						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
601	chrI	2228145	2228177	3500366087	27		2228145	2228177	8421504	2	17,10	0,22	g	350036608700000011	0-27						  Complet list of	cnptia.embrapa.br	0	0		
602	chrI	2247226	2247253	3500264407	23		2247226	2247253	8421504	2	18,5	0,22	c	350026440700000040	0-23						<Html><Title> Complet list of 3qic hssp file Complet list of	cnptia.embrapa.br	0	0		
602	chrI	2258698	2258727	3500384227	23		2258698	2258727	8421504	3	12,6,5	0,17,24	c	350038422700000185	0-23						Precursor miRNA loop-modulated target regulation - Patent application	www.faqs.org	0	0		
602	chrI	2306766	2346361	3500423818	42		2306766	2346361	8421504	3	15,8,19	0,20,39576	g	350042381800001203,350042381800001445	0-23,0-19						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
602	chrI	2308751	2357871	3500197929	39		2308751	2357871	8421504	4	5,14,9,11	0,8,49096,49109	c,g	350019792900003421,350019792900001999	27-46,0-20						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
602	chrI	2331568	2331602	3500019686	26		2331568	2331602	8421504	3	15,3,8	0,20,26	c	350001968600000124	0-26						<!DOCTYPE HTML PUBLIC i3/4-//IETF//DTD HTML 3.0//ENi3/4> <!- SPECIFICATION OF LANGUAGE-> <HTML> 	wheat.pw.usda.gov	0	0		
603	chrI	2410175	2410283	3500451686	108		2410175	2410283	8421504	1	108	0	g	350045168600000001	0-108						Florentina's Blog	w.summerschool.at	0	0		
75	chrI	2469116	2496953	3500070088	39		2469116	2496953	8421504	4	15,5,6,13	0,16,27817,27824	c,g	350007008800000167,350007008800000233	22-42,8-27						RNAI INHIBITION OF INFLUENZA VIRUS REPLICATION	Fougerolles	2006	0		
603	chrI	2472048	2485410	3500314924	2529		2472048	2485410	8421504	9	458,354,626,573,265,69,20,78,86	0,1264,2966,6181,8257,10304,11447,13151,13276	c,g	350031492400000090,350031492400000077,350031492400000077,350031492400000074,350031492400000074,350031492400000076,350031492400000078,350031492400000078,350031492400000065,350031492400000065,350031492400000075,350031492400000075,350031492400000069,350031492400000069,350031492400000064,350031492400000064,350031492400000066,350031492400000066,350031492400000063,350031492400000063,350031492400000071,350031492400000071,350031492400000072,350031492400000072,350031492400000073,350031492400000073,350031492400000070	0-2502,12-35,12-35,11-31,11-31,0-20,0-21,0-21,0-20,0-20,0-21,0-21,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20,12-39,12-39,0-20,0-20,10-33,10-33,12-41						DEPARTAMENTO DE GENÓMICA Y PROTEÓMICA	www.tdx.cat	0	0		
603	chrI	2472048	2485410	3500158449	2529		2472048	2485410	8421504	9	458,354,626,573,265,69,20,78,86	0,1264,2966,6181,8257,10304,11447,13151,13276	c,g	350015844900000090,350015844900000077,350015844900000074,350015844900000074,350015844900000076,350015844900000076,350015844900000078,350015844900000078,350015844900000065,350015844900000065,350015844900000075,350015844900000075,350015844900000069,350015844900000069,350015844900000064,350015844900000064,350015844900000066,350015844900000066,350015844900000063,350015844900000063,350015844900000071,350015844900000071,350015844900000072,350015844900000072,350015844900000073,350015844900000073,350015844900000070	0-2502,12-35,11-31,11-31,0-20,0-20,0-21,0-21,0-20,0-20,0-21,0-21,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20,12-39,12-39,0-20,0-20,10-33,10-33,12-41						DEPARTAMENTO DE GENÓMICA Y PROTEÓMICA	digital.csic.es	0	0		
604	chrI	2492292	2492315	3500344284	23		2492292	2492315	8421504	1	23	0	g	350034428400000313	6-29						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
604	chrI	2605360	2605430	3500238225	41		2605360	2605430	8421504	3	14,7,20	0,17,50	c	350023822500000206,350023822500000176	13-34,16-36						Index Seq ID Count Primer type Orientation Start Len tm GC% Any compl 3' compl Seq Prod size Seq len	openwetware.org	0	0		
604	chrI	2620295	2620319	3500416808	23		2620295	2620319	8421504	2	11,12	0,12	g	350041680800000242	15-38					Patent	Recombinant herpesvirus of turkeys and uses thereof (Patent US:5853733)	Cochran	1998	0		
605	chrI	2673252	2673303	3500033101	51		2673252	2673303	8421504	1	51	0	p	350003310100015116	57-108						The wheat orthologs of the barley cleistogamy gene: characterization and potential exploitation for wheat improvement	ane.ll.chiba-u.jp	0	0		
605	chrI	2688989	2689016	3500110061	27		2688989	2689016	8421504	1	27	0	g	350011006100000111	54-81						5.8S-T-14 HBII-239 GCGATGGATCGGTTGCATCGAGTAT 5.8S-G-75 U96a,U96b AATTGCAGACGCTTAGAGTGGTGAA 18S-A-2	pbase.sysu.edu.cn	0	0		
605	chrI	2700923	2700951	3500403017	25		2700923	2700951	8421504	2	16,9	0,19	c	350040301700000477,350040301700000391	8-33,0-24						US Patent # 6,943,281. Expression of Cry3B insecticidal protein in plants - Patents.com	www.patents.com	0	0		
605	chrI	2700924	2700951	3500077533	24		2700924	2700951	8421504	2	15,9	0,18	c	350007753300000391	0-24						Expression of Cry3B insecticidal protein in plants - Patent # 6943281 - PatentGenius	.patentgenius.com	0	0		
605	chrI	2707630	2717358	3500246077	122		2707630	2717358	8421504	4	51,22,26,23	0,7341,9625,9705	c,g	350024607700000013,350024607700000013,350024607700000012,350024607700000012,350024607700000014,350024607700000014,350024607700000018,350024607700000018,350024607700000019,350024607700000019,350024607700000031,350024607700000031,350024607700000032,350024607700000032,350024607700000015,350024607700000033	7-58,7-58,4-55,4-55,14-35,14-35,14-35,14-35,12-34,12-34,13-35,13-35,0-26,0-26,11-34,11-34						130 Supplemental Data Wnt Signaling Positions Neuromuscular Connectivity by Inhibiting Synapse Formation in C. elegans	download.cell.com	0	0		
605	chrI	2708121	2711173	3500218415	270		2708121	2711173	8421504	8	45,39,6,45,45,42,3,45	0,48,1800,1809,1857,1905,3001,3007	p	350021841500015161,350021841500015162,350021841500015163,350021841500015164,350021841500015165,350021841500015166	0-45,0-45,0-45,0-45,0-45,0-45						Corin, a serine protease	Morser	2002	0		
605	chrI	2711297	2717353	3500129768	77		2711297	2717353	8421504	3	22,26,29	0,41,6027	c,g	350012976800000002,350012976800000002,350012976800000001,350012976800000001,350012976800000003,350012976800000003	0-22,0-22,0-26,0-26,9-38,9-38		17942487	10.1242/dev.005363	0950-1991	Development	The C. elegans ROR receptor tyrosine kinase, CAM-1, non-autonomously inhibits the Wnt pathway	Green	2007	7		
606	chrI	2760455	2760970	3500118398	23		2760455	2760970	8421504	2	2,21	0,494	c	350011839800000762	13-36						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
606	chrI	2810616	2810639	3500452309	23		2810616	2810639	8421504	1	23	0	g	350045230900000005	9-32						統合DB講習会	s.genes.nig.ac.jp	0	0		
606	chrI	2823826	2823928	3500091014	102		2823826	2823928	8421504	1	102	0	p	350009101400015007	0-102						Mol. Cell. Biol. doi:10.1128/MCB.02132-06 A unique DNA binding domain converts TCFs into strong Wnt effectors ACCEPTED	mcb.asm.org	0	0		
606	chrI	2832882	2832906	3500177899	24		2832882	2832906	8421504	1	24	0	c	350017789900000028	10-34						<Html><Title> Complet list of 3f55 hssp file Complet list of	cnptia.embrapa.br	0	0		
606	chrI	2856950	2856973	3500000908	23		2856950	2856973	8421504	1	23	0	g	350000090800000022	0-23						Genes and gene products related to Werner's syndrome	Fu	1996	0		TRMT5
606	chrI	2875435	2876304	3500026934	48		2875435	2876304	8421504	2	26,22	0,847	c	350002693400000007,350002693400000006	14-40,12-34			10.1093/nar/gkm318		Nucleic Acids Research	RNA chaperone activity of L1 ribosomal proteins: phylogenetic conservation and splicing inhibition	Stefan	June	0		
606	chrI	2875594	2875665	3500015921	23		2875594	2875665	8421504	2	9,14	0,57	c	350001592100000037	0-23							biomedcentral.com	0	0		
606	chrI	2876106	2876146	3500350746	40		2876106	2876146	8421504	1	40	0	g	350035074600000003,350035074600000000	0-40,0-40						怎么根据已知序列的GC含量产生相应长度的随机序列-Perl-ChinaUnix.net	bbs.chinaunix.net	0	0		
607	chrI	2883868	2893697	3500278641	68		2883868	2893697	8421504	2	45,23	0,9806	p,c,g	350027864100015000,350027864100000001,350027864100000001,350027864100000003,350027864100000003,350027864100000000,350027864100000000,350027864100000002,350027864100000002	3-48,20-41,20-41,9-30,9-30,8-31,8-31,8-30,8-30		12640035	10.1242/jcs.00362	0021-9533	Journal of Cell Science	Essential role of the C. elegans Arp2/3 complex in cell migration during ventral enclosure	Sawa	2003	6		
607	chrI	2883868	2893697	3500278160	68		2883868	2893697	8421504	2	45,23	0,9806	p,c,g	350027816000015000,350027816000000001,350027816000000001,350027816000000003,350027816000000003,350027816000000000,350027816000000000,350027816000000002,350027816000000002	3-48,20-41,20-41,9-30,9-30,8-31,8-31,8-30,8-30						Essential role of the C. elegansArp2/3 complex in cell migration during ventral enclosure	cs.biologists.org	0	0		
607	chrI	2885862	2885984	3500467559	44		2885862	2885984	8421504	2	22,22	0,100	c,g	350046755900000020,350046755900000020,350046755900000019,350046755900000019	0-22,0-22,0-22,0-22						Supplementary Materials for	ww.sciencemag.org	0	0		
607	chrI	2890579	2890603	3500108945	24		2890579	2890603	8421504	1	24	0	c	350010894500000247	0-25						X1 ATACACACACACAC X2 GAAAAAAAAAAAAAAA X3 TATATATATATGT X4 AAAAAAAAAAAAAAAAAAAAAAAAAAAA X5 CTATCTATCT	www.ucl.ac.uk	0	0		
607	chrI	2915879	2915902	3500036492	23		2915879	2915902	8421504	1	23	0	c	350003649200000226	12-35						UNIVERSIDAD DE SALAMANCA	gredos.usal.es	0	0		
607	chrI	2929943	2932833	3500358534	57		2929943	2932833	8421504	3	19,19,19	0,401,2871	c,g	350035853400000002,350035853400000003,350035853400000003,350035853400000004,350035853400000004	0-19,0-19,0-19,0-19,0-19			10.1261/rna.5420503		RNA	The Ref/Aly proteins are dispensable for mRNA export and development in Caenorhabditis elegans	DASA	July	0		
607	chrI	2931462	2934139	3500282573	45		2931462	2934139	8421504	2	23,22	0,2655	c,g	350028257300000000,350028257300000000,350028257300000001	22-45,22-45,21-43						The conserved oligomeric Golgi complex acts in organ morphogenesis via glycosylation of an ADAM protease in C. elegans — Supplementary Material 	ev.biologists.org	0	0		
607	chrI	2935770	2935958	3500451686	188		2935770	2935958	8421504	1	188	0	g	350045168600000002	0-188						Florentina's Blog	w.summerschool.at	0	0		
607	chrI	2959883	2966598	3500261505	39		2959883	2966598	8421504	3	13,7,19	0,17,6696	g	350026150500000737,350026150500001519	3-23,5-24						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
607	chrI	2966605	2966629	3500016279	23		2966605	2966629	8421504	2	6,17	0,7	g	350001627900000302	0-23						Development of microsatellite markers from four Hawaiian corals: Acropora cytherea, Fungia scutaria, Montipora capitata and Porites lobata | Rob Toonen - Academia.edu	www.academia.edu	0	0		
607	chrI	3008747	3008813	3500327386	66		3008747	3008813	8421504	1	66	0	p	350032738600015029	0-66						Site-Specific Incorporation of Phosphoserine Into Proteins in Escherichia Coli	Park	2011	0		MAP2K2
607	chrI	3012447	3012473	3500364807	26		3012447	3012473	8421504	1	26	0	g	350036480700000014	0-26			10.1371/journal.pgen.0030056		PLoS Genetics	Lifespan Regulation by Evolutionarily Conserved Genes Essential for Viability	Sean	2007	0		
608	chrI	3064916	3064944	3500197929	25		3064916	3064944	8421504	2	5,20	0,8	c,g	350019792900000740,350019792900000740	16-42,16-42						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
608	chrI	3064974	3065001	3500033414	23		3064974	3065001	8421504	3	12,5,6	0,13,21	g	350003341400000362	11-34						<Html><Title> Complet list of 1ea9 hssp file Complet list of	cnptia.embrapa.br	0	0		
608	chrI	3069500	3069548	3500278641	48		3069500	3069548	8421504	1	48	0	p	350027864100015001	3-51		12640035	10.1242/jcs.00362	0021-9533	Journal of Cell Science	Essential role of the C. elegans Arp2/3 complex in cell migration during ventral enclosure	Sawa	2003	6		
608	chrI	3069500	3069548	3500278160	48		3069500	3069548	8421504	1	48	0	p	350027816000015001	3-51						Essential role of the C. elegansArp2/3 complex in cell migration during ventral enclosure	cs.biologists.org	0	0		
608	chrI	3101533	3101560	3500256268	27		3101533	3101560	8421504	1	27	0	g	350025626800000280	7-34						<Html><Title> Complet list of 3h1v hssp file Complet list of	cnptia.embrapa.br	0	0		
608	chrI	3104369	3109524	3500209948	60		3104369	3109524	8421504	3	19,20,21	0,3516,5134	c,g	350020994800000002,350020994800000000,350020994800000000,350020994800000003	4-23,0-20,0-20,0-21		20360843	10.1371/journal.pone.0009869		PLoS ONE	The Role of Nuclear Receptor NHR-64 in Fat Storage Regulation in Caenorhabditis elegans	Bin	2010	0		
608	chrI	3108705	3109475	3500333817	40		3108705	3109475	8421504	2	20,20	0,750	c,g	350033381700000014,350033381700000014,350033381700000015,350033381700000015	0-20,0-20,0-20,0-20			10.1534/genetics.107.078071		Genetics	Revisiting the X:A Signal That Specifies Caenorhabditis elegans Sexual Fate	John	2007	0		
9	chrI	3125544	3239685	3500149397	126		3125544	3239685	8421504	3	42,70,14	0,113973,114127	g	350014939700000016	4-130						Functional tests of enhancer conservation between distantly related species	ev.biologists.org	0	0		
608	chrI	3133049	3133077	3500344270	23		3133049	3133077	8421504	3	6,13,4	0,10,24	g	350034427000000474	2-28						@IL23_3198:2:1:0:199/1 NCGGAACCGGGCGGAAACACCATCGTATGCCGTCTTC + &0;;;;:9:;:7;;;;;;;;;;;;;;;;;;;;;;;:8	rse.iop.kcl.ac.uk	0	0		
608	chrI	3145278	3145309	3500300591	28		3145278	3145309	8421504	4	7,13,4,4	0,8,22,27	c	350030059100000285	3-37						Novel Plant Acyltransferases Specific For Long-Chained, Multiply Unsaturated Fatty Acids - Patent application	www.faqs.org	0	0		
609	chrI	3156454	3156481	3500148210	24		3156454	3156481	8421504	2	5,19	0,8	g	350014821000000005	3-27						P. persica ANÁLISIS DE LA DIVERSIDAD GENÉTICA EN MELOCOTONERO (L.) Batsch]Y EN Prunus Científicas	digital.csic.es	0	0		
609	chrI	3211119	3214129	3500218521	42		3211119	3214129	8421504	3	2,19,21	0,54,2989	c	350021852100000000,350021852100000001	0-21,0-21		16000383	10.1242/dev.01921	0950-1991	Development	Dose-dependent control of proliferation and sperm specification by FOG-1/CPEB	Thompson	2005	7		
609	chrI	3211119	3214129	3500009395	42		3211119	3214129	8421504	3	2,19,21	0,54,2989	c	350000939500000000,350000939500000001	0-21,0-21			10.1242/dev.01921		Development (Cambridge, England)	Dose-dependent control of proliferation and sperm specification by FOG-1/CPEB	Beth	2005	0		
609	chrI	3233392	3255497	3500282573	106		3233392	3255497	8421504	4	22,29,23,32	0,4938,19619,22073	c,g	350028257300000002,350028257300000002,350028257300000003,350028257300000004,350028257300000004,350028257300000005	22-44,22-44,21-50,22-45,22-45,22-54						The conserved oligomeric Golgi complex acts in organ morphogenesis via glycosylation of an ADAM protease in C. elegans — Supplementary Material 	ev.biologists.org	0	0		
609	chrI	3233458	3234422	3500155098	54		3233458	3234422	8421504	2	2,52	0,912	p	350015509800015000	0-54						The conserved oligomeric Golgi complex acts in organ morphogenesis via glycosylation of an ADAM protease in C. elegans	ev.biologists.org	0	0		
609	chrI	3244578	3246063	3500443242	41		3244578	3246063	8421504	2	22,19	0,1466	c,g	350044324200000002,350044324200000002,350044324200000001,350044324200000001	6-28,6-28,0-19,0-19						mab-31 and the TGF-β pathway act in the ray lineage to pattern C. elegans male sensory rays	eta.semantico.com	0	0		
609	chrI	3244578	3246063	3500434344	41		3244578	3246063	8421504	2	22,19	0,1466	c,g	350043434400000003,350043434400000003,350043434400000002,350043434400000002	6-28,6-28,0-19,0-19		20687916			BMC Developmental Biology	mab-31 and the TGF-β pathway act in the ray lineage to pattern C. elegans male sensory rays - Scolaris	Wong	2010	0		
609	chrI	3244578	3246063	3500173885	41		3244578	3246063	8421504	2	22,19	0,1466	c,g	350017388500000003,350017388500000003,350017388500000002,350017388500000002	6-28,6-28,0-19,0-19		20687916	10.1186/1471-213X-10-82	1471-213X	BMC Developmental Biology	 mab-31 and the TGF-β pathway act in the ray lineage to pattern C. elegans male sensory rays	Wong	2010	3		
609	chrI	3245378	3259732	3500359712	38		3245378	3259732	8421504	4	5,8,6,19	0,63,75,14335	c,g	350035971200002901,350035971200000542	25-44,20-39						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
609	chrI	3250736	3250760	3500381654	24		3250736	3250760	8421504	1	24	0	g	350038165400000011	0-34					Patent	Artificial binding proteins based on a modified alpha helical region of ubiquitin (Patent EP:2094845)	Fiedler	2011	0		
609	chrI	3250736	3250760	3500012849	24		3250736	3250760	8421504	1	24	0	g	350001284900000011	0-34						ARTIFICIAL BINDING PROTEINS BASED ON A MODIFIED ALPHA HELICAL REGION OF UBIQUITIN	Schraeml	2007	0		
609	chrI	3260636	3260663	3500025790	25		3260636	3260663	8421504	2	6,19	0,8	c	350002579000000058	0-25						ABSTRACT	tory.lib.ncsu.edu	0	0		
609	chrI	3260636	3260661	3500461888	23		3260636	3260661	8421504	2	6,17	0,8	c	350046188800003199	3-26						 Galaxy | Dataset | FASTQ to Tabular	popgenie.org:8080	0	0		
609	chrI	3264062	3264089	3500380586	25		3264062	3264089	8421504	2	14,11	0,16	c	350038058600000461	12-41						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
609	chrI	3265744	3265769	3500437975	24		3265744	3265769	8421504	2	4,20	0,5	g	350043797500000013	2-32						 Directed Mutagenesis Using the Polymerase Chain Reaction - Current Protocols 	rentprotocols.com	0	0		
609	chrI	3265744	3265769	3500435920	24		3265744	3265769	8421504	2	4,20	0,5	g	350043592000000013	2-32						 Directed Mutagenesis Using the Polymerase Chain Reaction - Current Protocols 	rentprotocols.com	0	0		
609	chrI	3265744	3265769	3500370234	24		3265744	3265769	8421504	2	4,20	0,5	g	350037023400000013	2-32						 Directed Mutagenesis Using the Polymerase Chain Reaction - Current Protocols 	rentprotocols.com	0	0		
609	chrI	3265744	3265769	3500218674	24		3265744	3265769	8421504	2	4,20	0,5	g	350021867400000013	2-32						 Directed Mutagenesis Using the Polymerase Chain Reaction - Current Protocols 	rentprotocols.com	0	0		
609	chrI	3265744	3265769	3500172731	24		3265744	3265769	8421504	2	4,20	0,5	g	350017273100000013	2-32						 Directed Mutagenesis Using the Polymerase Chain Reaction - Current Protocols 	rentprotocols.com	0	0		
609	chrI	3273157	3273183	3500401980	23		3273157	3273183	8421504	2	17,6	0,20	c,g	350040198000000039,350040198000000039	0-23,0-23						Modifying insect cell gylcosylation pathways with baculovirus expression vectors	Jarvis	1999	0		
610	chrI	3304690	3304723	3500348158	27		3304690	3304723	8421504	3	8,5,14	0,13,19	g	350034815800000238	2-29						<Html><Title> Complet list of 1r9d hssp file Complet list of	cnptia.embrapa.br	0	0		
76	chrI	3306506	3581423	3500373146	27		3306506	3581423	8421504	2	11,16	0,274901	c	350037314600000301	0-27						X1 ATACACACACACAC X2 GAAAAAAAAAAAAAAA X3 TATATATATATGT X4 AAAAAAAAAAAAAAAAAAAAAAAAAAAA X5 CTATCTATCT	www.ucl.ac.uk	0	0		
610	chrI	3338316	3338354	3500397262	29		3338316	3338354	8421504	4	6,14,4,5	0,11,26,33	g	350039726200000012	4-34						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
610	chrI	3354724	3354751	3500355690	24		3354724	3354751	8421504	3	5,8,11	0,6,16	g	350035569000000160	13-41						GENETIC ANALYSIS OF PLANT MORPHOLOGY IN BAMBARA GROUNDNUT	.nottingham.ac.uk	0	0		
610	chrI	3402037	3402067	3500420077	25		3402037	3402067	8421504	2	8,17	0,13	g	350042007700000002	2-27						Morphological variation between juvenile white bass and juvenile hybrid striped bass	alcommons.unl.edu	0	0		
611	chrI	3430107	3431118	3500141310	225		3430107	3431118	8421504	8	45,15,30,24,21,19,26,45	0,48,200,233,797,869,937,966	p	350014131000015022,350014131000015023,350014131000015024,350014131000015026,350014131000015027	0-45,0-45,0-45,0-45,0-45						BPC-1: A SECRETED BRAIN-SPECIFIC PROTEIN EXPRESSED AND SECRETED BY PROSTATE AND BLADDER CANCER CELLS - Patent application	www.faqs.org	0	0		
611	chrI	3437840	3437864	3500211834	23		3437840	3437864	8421504	2	16,7	0,17	g	350021183400000175	19-42						Genetic analysis of quantitative trait loci for cocoon and silk production quantity in Bombyx mori (Lepidoptera: Bombycidae)	www.eje.cz/pdfart	0	0		
611	chrI	3453999	3465874	3500197929	46		3453999	3465874	8421504	4	13,8,14,11	0,16,11846,11864	c,g	350019792900002443,350019792900004055	10-32,11-36						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
611	chrI	3455694	3455722	3500431569	26		3455694	3455722	8421504	3	9,13,4	0,10,24	g	350043156900000201	15-41						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
611	chrI	3470309	3471477	3500402797	81		3470309	3471477	8421504	4	19,20,22,20	0,518,956,1148	c,g	350040279700000004,350040279700000002,350040279700000002,350040279700000005,350040279700000005,350040279700000003,350040279700000003	0-19,0-20,0-20,0-22,0-22,0-20,0-20						Mitochondrial Dysfunction Confers Resistance to Multiple Drugs in Caenorhabditis elegans	w.molbiolcell.org	0	0		
611	chrI	3471232	3471277	3500385499	45		3471232	3471277	8421504	1	45	0	p	350038549900015172	3-48						US Patent # 6,603,060. Method for regulating cell death - Patents.com	www.patents.com	0	0		
612	chrI	3562780	3562806	3500409988	23		3562780	3562806	8421504	2	11,12	0,14	g	350040998800000007	0-23						 Luận văn Xây dựng cơ sở dữ liệu hai gene 16S và 23S ribosom RNA ở vi khuẩn – ứng dụng cơ sở dữ liệu hai gene 16s và 23s ribosom	tai-lieu.com	0	0		
612	chrI	3565905	3574460	3500344389	42		3565905	3574460	8421504	4	13,7,13,9	0,17,8529,8546	g	350034438900001453,350034438900000971	2-22,24-46						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
612	chrI	3596788	3596817	3500253345	24		3596788	3596817	8421504	3	14,5,5	0,17,24	g	350025334500000001,350025334500000045,350025334500000027	19-43,0-24,1-25						CACNA1G polynucleotide, polypeptide and methods of use therefor	Issa	2005	0		
612	chrI	3596788	3596817	3500245504	24		3596788	3596817	8421504	3	14,5,5	0,17,24	g	350024550400000027,350024550400000045,350024550400000001	1-25,0-24,19-43						PITX2 Polynucleotide, Polypeptide and Methods of Use Therefor	Issa	2009	0		
76	chrI	3630708	3675056	3500391068	45		3630708	3675056	8421504	4	12,9,16,8	0,15,44322,44340	c,g	350039106800002318,350039106800002479	21-42,10-45						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
612	chrI	3639600	3639623	3500190843	23		3639600	3639623	8421504	1	23	0	g	350019084300001236	14-37						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
612	chrI	3646209	3646233	3500021563	23		3646209	3646233	8421504	2	14,9	0,15	c	350002156300000006	1-24							ww3.botany.ubc.ca	0	0		
612	chrI	3654505	3654858	3500420240	111		3654505	3654858	8421504	8	16,7,23,8,21,7,14,15	0,31,84,197,226,273,285,338	g	350042024000000015	46-195						Sequence dependence of DNA bending rigidity	crab.chem.nyu.edu	0	0		
613	chrI	3675566	3675589	3500026956	23		3675566	3675589	8421504	1	23	0	g	350002695600000011	18-41							ww3.botany.ubc.ca	0	0		
613	chrI	3683020	3683045	3500207768	25		3683020	3683045	8421504	1	25	0	g	350020776800000001	14-39		20573983	10.1091/mbc.E10-02-0149	1059-1524	Molecular Biology of the Cell	EHBP-1 Functions with RAB-10 during Endocytic Recycling in Caenorhabditis elegans	Shi	2010	5		
613	chrI	3683725	3683838	3500133767	66		3683725	3683838	8421504	2	58,8	0,105	p	350013376700015002	0-66		21262767	10.1128/MCB.00834-10	0270-7306	Molecular and Cellular Biology	Tctex-1, a Novel Interaction Partner of Rab3D, Is Required for Osteoclastic Bone Resorption	Pavlos	2011	6		RAB3C
613	chrI	3697685	3697886	3500145835	42		3697685	3697886	8421504	2	20,22	0,179	g	350014583500000000,350014583500000002	0-20,0-22						ScienceDirect.com - Current Biology - Caenorhabditis elegans HUS-1 Is a DNA Damage Checkpoint Protein Required for Genome Stability and EGL-1-Mediated Apoptosis	sciencedirect.com	0	0		
613	chrI	3710359	3710384	3500271198	23		3710359	3710384	8421504	3	12,5,6	0,13,19	g	350027119800004058	9-38						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
613	chrI	3728252	3728275	3500040919	23		3728252	3728275	8421504	1	23	0	c,g	350004091900001328,350004091900001328	2-28,2-28						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
613	chrI	3758988	3759014	3500457280	23		3758988	3759014	8421504	2	9,14	0,12	g	350045728000000030	3-26						CNSH trong b_nh cGy [15]	vi.scribd.com	0	0		
613	chrI	3774472	3774496	3500341598	23		3774472	3774496	8421504	2	14,9	0,15	c	350034159800000153	5-28						<Html><Title> Complet list of 1asz hssp file Complet list of	cnptia.embrapa.br	0	0		
613	chrI	3774472	3774496	3500158624	23		3774472	3774496	8421504	2	14,9	0,15	c	350015862400000156	5-28						<Html><Title> Complet list of 1asy hssp file Complet list of	cnptia.embrapa.br	0	0		
613	chrI	3780514	3780540	3500415126	23		3780514	3780540	8421504	3	11,7,5	0,12,21	c	350041512600000100	11-34						Inbred Corn Line De811asr(bc5) 	.freshpatents.com	0	0		
613	chrI	3780514	3780540	3500390816	23		3780514	3780540	8421504	3	11,7,5	0,12,21	c	350039081600000100	11-34						Polynucleotides and methods for making plants resistant to fungal pathogens - Patent application	www.faqs.org	0	0		
613	chrI	3790765	3790788	3500245053	23		3790765	3790788	8421504	1	23	0	c,g	350024505300002672,350024505300002672	8-33,8-33						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
76	chrI	3799173	3805708	3500364078	47		3799173	3805708	8421504	2	25,22	0,6513	c,g	350036407800000004,350036407800000003	9-34,8-30		10397769	10.1091/mbc.10.7.2343	1059-1524	Molecular Biology of the Cell	UNC-11, a Caenorhabditis elegans AP180 Homologue, Regulates the Size and Protein Composition of Synaptic Vesicles	Nonet	1999	5		
614	chrI	3809383	3809466	3500138774	23		3809383	3809466	8421504	4	3,3,11,6	0,56,63,77	c	350013877400000008	9-32						QPCR Primer Table	w.its.caltech.edu	0	0		
614	chrI	3820143	3820170	3500343811	23		3820143	3820170	8421504	2	6,17	0,10	c	350034381100003151	21-44						1531 26.93 2.31 1.16 sequence_4 1 432 (149568) + Gypsy12-ZM_I LTR/Gypsy 	nomics.purdue.edu	0	0		
614	chrI	3825337	3825365	3500207088	23		3825337	3825365	8421504	3	6,11,6	0,9,22	c	350020708800000093	5-28						None	hera.ugr.es	0	0		
614	chrI	3838397	3839191	3500036764	135		3838397	3839191	8421504	3	45,45,45	0,701,749	p	350003676400015114,350003676400015091,350003676400015090	0-45,0-45,0-45						COMPOUNDS, COMPOSITIONS AND METHODS FOR CONTROLLING INVERTEBRATE PESTS - Patent application	www.faqs.org	0	0		
614	chrI	3862974	3863259	3500404771	42		3862974	3863259	8421504	2	23,19	0,266	c,g	350040477100000006,350040477100000006,350040477100000005	0-23,0-23,0-19		15767665	10.1128/MCB.25.7.2583-2592.2005	0270-7306	Molecular and Cellular Biology	HCP-4/CENP-C Promotes the Prophase Timing of Centromere Resolution by Enabling the Centromere Association of HCP-6 in Caenorhabditis elegans	Moore	2005	6		
614	chrI	3864010	3865514	3500404396	41		3864010	3865514	8421504	2	21,20	0,1484	c,g	350040439600000009,350040439600000009,350040439600000008,350040439600000008	0-21,0-21,19-39,19-39						Systematic Analysis in Caenorhabditis elegans Reveals that the Spindle Checkpoint Is Composed of Two Largely Independent Branches	w.molbiolcell.org	0	0		
614	chrI	3865490	3865514	3500414022	24		3865490	3865514	8421504	1	24	0	g	350041402200000005	0-24		15616189	10.1091/mbc.E04-08-0712	1059-1524	Molecular Biology of the Cell	A Spindle Checkpoint Functions during Mitosis in the Early Caenorhabditis elegans Embryo	Encalada	2005	5		
614	chrI	3885650	3885851	3500200576	73		3885650	3885851	8421504	3	27,20,26	0,86,175	c,g	350020057600000023,350020057600000023,350020057600000024,350020057600000024,350020057600000022,350020057600000022	0-27,0-27,0-20,0-20,0-26,0-26		18221392	10.1111/j.1462-5822.2008.01124.x	1462-5822	Cellular Microbiology	Resistance to antimicrobial peptides contributes to persistence of Salmonella typhimurium in the C. elegans intestine - Alegado - 2008 - Cellular Microbiology - Wiley Online Library	Alegado	2008	0		
614	chrI	3886982	3887071	3500115152	40		3886982	3887071	8421504	2	20,20	0,69	c,g	350011515200000011,350011515200000011,350011515200000010,350011515200000010	0-20,0-20,0-20,0-20		22363222	10.3390/md10010084		Marine Drugs	Tasco®: A Product of Ascophyllum nodosum Enhances Immune Response of Caenorhabditis elegans Against Pseudomonas aeruginosa Infection	Saveetha	2012	0		
614	chrI	3898177	3901063	3500210462	108		3898177	3901063	8421504	4	25,21,38,24	0,324,1084,2862	c,g	350021046200000026,350021046200000026,350021046200000010,350021046200000019,350021046200000019,350021046200000025,350021046200000018,350021046200000018	0-25,0-25,0-21,9-33,9-33,0-24,9-33,9-33		17339317	10.1074/jbc.M700274200	0021-9258	Journal of Biological Chemistry	Loss of Secretory Pathway FK506-binding Proteins Results in Cold-sensitive Lethality and Associate Extracellular Matrix Defects in the Nematode Caenorhabditis elegans	Winter	2007	5		
614	chrI	3898177	3901063	3500094452	108		3898177	3901063	8421504	4	25,21,38,24	0,324,1084,2862	c,g	350009445200000026,350009445200000026,350009445200000010,350009445200000019,350009445200000019,350009445200000025,350009445200000025,350009445200000018,350009445200000018	0-25,0-25,0-21,9-33,9-33,0-24,0-24,9-33,9-33						Loss of Secretory Pathway FK506-binding Proteins Results in Cold-sensitive Lethality and Associate Extracellular Matrix Defects in the Nematode Caenorhabditis elegans--《生物物理学杂志》--医[	journal.9med.net	0	0		
614	chrI	3898996	3909735	3500292075	39		3898996	3909735	8421504	4	12,7,11,9	0,16,10718,10730	c	350029207500000385,350029207500001378	3-22,22-42						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
614	chrI	3909857	3921503	3500088013	39		3909857	3921503	8421504	4	14,5,12,8	0,15,11625,11638	c	350008801300000909,350008801300000373	24-43,4-24						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
614	chrI	3909939	3909965	3500423818	23		3909939	3909965	8421504	2	5,18	0,8	c	350042381800001210	0-23						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
614	chrI	3915879	3915902	3500197891	23		3915879	3915902	8421504	1	23	0	g	350019789100000180	13-36						Index Seq ID Count Primer type Orientation Start Len tm GC% Any compl 3' compl Seq Prod size Seq len	openwetware.org	0	0		
615	chrI	3949399	3950206	3500245363	87		3949399	3950206	8421504	2	45,42	0,765	p	350024536300015075	54-237						Combinatorial libraries of monomer domains	Kolkman	2008	0		
615	chrI	3966990	3988209	3500235637	42		3966990	3988209	8421504	4	15,6,16,5	0,18,21195,21214	c,g	350023563700000171,350023563700000075,350023563700000055	8-29,14-35,10-31						 <HTML> <HEAD><TITLE>i1/2i1/4i1/4i1/4i1/4!i1/4degi1/4<<a(r)ae'>>aeSSaaa>>aa|a1aa!a1a?ca<<eC/a,aa	www.j-tokkyo.com	0	0		
615	chrI	3989445	3989745	3500250581	40		3989445	3989745	8421504	2	20,20	0,280	g	350025058100000001,350025058100000002	0-20,0-20			10.1186/1471-2164-6-118		BMC Genomics	Rapid single nucleotide polymorphism mapping in C. elegans	M	2005	0		
615	chrI	4049099	4049852	3500336433	46		4049099	4049852	8421504	2	22,24	0,729	c,g	350033643300000097,350033643300000097,350033643300000098	7-29,7-29,6-30						Two genes, dig-1 and mig-10, involved in nervous system development in C.elegans	www.wpi.edu	0	0		
76	chrI	4053900	4094673	3500344389	42		4053900	4094673	8421504	4	16,6,14,6	0,21,40750,40767	g	350034438900001465,350034438900000714	23-45,11-31						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
76	chrI	4053900	4094673	3500190843	42		4053900	4094673	8421504	4	16,6,14,6	0,21,40750,40767	c,g	350019084300001463,350019084300000675	23-45,11-31						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
616	chrI	4079171	4079196	3500154365	24		4079171	4079196	8421504	2	15,9	0,16	g	350015436500000016	6-40						Xenobiotic-metabolizing enzymes elevated in multiple mouse models of slow aging	lue.lib.umich.edu	0	0		
616	chrI	4124673	4129365	3500246077	94		4124673	4129365	8421504	3	23,47,24	0,1555,4668	c,g	350024607700000022,350024607700000022,350024607700000023,350024607700000028,350024607700000028,350024607700000027,350024607700000024,350024607700000024,350024607700000025	0-23,0-23,24-50,0-21,0-21,0-21,24-45,24-45,0-24						130 Supplemental Data Wnt Signaling Positions Neuromuscular Connectivity by Inhibiting Synapse Formation in C. elegans	download.cell.com	0	0		
616	chrI	4147459	4147532	3500150959	23		4147459	4147532	8421504	3	2,9,12	0,47,61	c	350015095900000094	0-23						Supplementary Text and Figures: Simulation (cosi) parameters	es.convdocs.org	0	0		
616	chrI	4154312	4154336	3500407806	23		4154312	4154336	8421504	2	11,12	0,12	c,g	350040780600000325,350040780600000130	3-38,0-35						METHOD RELATING TO SWEETNESS ENHANCEMENT - Patent application	www.faqs.org	0	0		
616	chrI	4154312	4154336	3500326993	23		4154312	4154336	8421504	2	11,12	0,12	c	350032699300000218	0-35						Nucleic Acid, Polypeptide and Its Use - Patent application	www.faqs.org	0	0		
616	chrI	4170508	4170536	3500074991	25		4170508	4170536	8421504	2	15,10	0,18	c	350007499100002824	3-28							www.dartmouth.edu	0	0		
616	chrI	4172206	4172229	3500127614	23		4172206	4172229	8421504	1	23	0	c	350012761400000010	9-32		15123614	10.1074/jbc.M402429200	0021-9258	Journal of Biological Chemistry	Loss of srf-3-encoded Nucleotide Sugar Transporter Activity in Caenorhabditis elegans Alters Surface Antigenicity and Prevents Bacterial Adherence	Hoflich	2004	5		
616	chrI	4172225	4172317	3500201662	41		4172225	4172317	8421504	2	20,21	0,71	c,g	350020166200000003,350020166200000003,350020166200000002	0-20,0-20,0-21		17283210	10.1261/rna.426707	1355-8382	RNA	A novel family of C. elegans snRNPs contains proteins associated with trans-splicing	MacMorris	2007	5		
616	chrI	4172228	4172326	3500427626	46		4172228	4172326	8421504	2	20,26	0,72	g	350042762600000007,350042762600000003,350042762600000004	0-20,0-24,0-26					Molecular and Cellular Biology	trans Splicing of Polycistronic Caenorhabditis elegans Pre-mRNAs: Analysis of the SL2 RNA	Donald	2000	0		
616	chrI	4181283	4181307	3500411553	24		4181283	4181307	8421504	1	24	0	c,g	350041155300000000,350041155300000000	0-24,0-24						R12E2.13: sEx15461 | Flickr - Photo Sharing!	www.flickr.com	0	0		
617	chrI	4208615	4208665	3500249133	50		4208615	4208665	8421504	1	50	0	c,g	350024913300000002,350024913300000002	0-50,0-50							roarrays.ucsd.edu	0	0		
617	chrI	4261699	4261730	3500195912	31		4261699	4261730	8421504	1	31	0	c	350019591200000030,350019591200000029,350019591200000024,350019591200000027,350019591200000035,350019591200000109,350019591200000181,350019591200000156,350019591200000182,350019591200000082,350019591200000142,350019591200000036,350019591200000023,350019591200000112,350019591200000028	0-28,0-28,0-28,0-28,0-28,0-28,0-20,0-30,0-21,0-21,0-21,0-28,0-28,0-28,0-28						METHODS AND COMPOSITIONS FOR TREATING HUNTINGTON'S DISEASE - Patent application	www.faqs.org	0	0		
617	chrI	4261699	4261722	3500237117	23		4261699	4261722	8421504	1	23	0	c	350023711700000067,350023711700000068	0-22,0-22						Rna Interference Suppression of Neurodegenerative Diseases and Methods of Use Thereof - Patent application	www.faqs.org	0	0		
617	chrI	4261700	4261730	3500160607	30		4261700	4261730	8421504	1	30	0	c	350016060700000028,350016060700000040	0-21,0-30						EP 2049664 T3 - Patenty	tech.money.pl	0	0		
617	chrI	4261700	4261730	3500109287	30		4261700	4261730	8421504	1	30	0	c	350010928700000001,350010928700000000	0-30,0-30		22715390	10.1371/journal.pone.0038516	1932-6203	PLOS ONE	PLOS ONE: Ubiquitous Expression of CUG or CAG Trinucleotide Repeat RNA Causes Common Morphological Defects in a Drosophila Model of RNA-Mediated Pathology	Lawlor	2012	4		MED15
617	chrI	4261700	4261727	3500034569	27		4261700	4261727	8421504	1	27	0	c	350003456900000004	0-27					Journal of Bacteriology	Sequence Analysis of Tn10 Insertion Sites in a Collection of Escherichia coli Strains Used for Genetic Mapping and Strain Construction	Brian	1998	0		AR
77	chrI	4319949	4360808	3500197929	41		4319949	4360808	8421504	4	16,6,14,5	0,17,40837,40854	c,g	350019792900004207,350019792900001353	21-43,30-49						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
618	chrI	4337811	4337886	3500139963	23		4337811	4337886	8421504	3	9,7,7	0,56,68	c	350013996300000046	9-32						使用棒状细菌发酵生产d－泛酸的方法	L*Ai Ge Lin 	2000	0		
618	chrI	4344099	4347164	3500448610	41		4344099	4347164	8421504	4	6,14,7,14	0,11,3039,3051	c,g	350044861000000400,350044861000000400,350044861000000401	0-20,0-20,0-21						Method for measuring messenger RNA	Akitaya	1992	0		
618	chrI	4347688	4347720	3500280773	24		4347688	4347720	8421504	3	11,5,8	0,15,24	c	350028077300000474	0-27						Immunostimulatory sequence oligonucleotides and methods of using the same	D*Di Na 	2010	0		
618	chrI	4347688	4347720	3500172906	24		4347688	4347720	8421504	3	11,5,8	0,15,24	c	350017290600000493	0-27					Patent	Immunostimulatory sequence oligonucleotides and methods of using the same (Patent CN:101693890)	D*Di Na 	2012	0		
618	chrI	4347688	4347720	3500147417	24		4347688	4347720	8421504	3	11,5,8	0,15,24	c	350014741700000477	0-27					Patent	Immunostimulatory sequence oligonucleotides and methods of using the same (Patent CN:100546998)	D*Di Na 	2009	0		
618	chrI	4366609	4366635	3500180145	23		4366609	4366635	8421504	2	18,5	0,21	g	350018014500000041	6-29						 Method For Cloning And Producing The Msel Restriction Endonuclease 	www.docstoc.com	0	0		
618	chrI	4373748	4373790	3500011181	34		4373748	4373790	8421504	2	7,27	0,15	c	350001118100000585	34-71							www.plosone.org	0	0		
618	chrI	4379107	4382598	3500452315	103		4379107	4382598	8421504	4	25,30,23,25	0,2435,2641,3466	c,g	350045231500000000,350045231500000000,350045231500000004,350045231500000003,350045231500000003,350045231500000001,350045231500000001	0-25,0-25,0-30,6-29,6-29,0-25,0-25						ACETYLYCHOLINE GATED ION CHANNEL CHAPERONS AND METHODS OF USING THE SAME	Williams	2006	0		
618	chrI	4417090	4417117	3500053890	25		4417090	4417117	8421504	2	13,12	0,15	g	350005389000000022	9-38						Page 8 Real data set (Pete, Jochen)	www.nature.com	0	0		
618	chrI	4430087	4430357	3500273330	249		4430087	4430357	8421504	2	108,141	0,129	p	350027333000015179,350027333000015177	6-114,0-141						43 human secreted proteins	Komatsoulis	2001	0		
618	chrI	4440624	4440658	3500109336	29		4440624	4440658	8421504	4	5,14,6,4	0,8,23,30	g	350010933600000049	11-43						Gene therapy for effector cell regulation	Dow	1996	0		
618	chrI	4453654	4454653	3500395114	43		4453654	4454653	8421504	2	23,20	0,979	c,g	350039511400000007,350039511400000007,350039511400000006,350039511400000006	0-23,0-23,0-20,0-20		23103171	10.1016/j.celrep.2012.09.019	2211-1247	Cell Reports	Cell Reports - Antagonism between MES-4 and Polycomb Repressive Complex 2 Promotes Appropriate Gene Expression in C. elegans Germ Cells	Gaydos	2012	0		
618	chrI	4453654	4454653	3500150118	43		4453654	4454653	8421504	2	23,20	0,979	c,g	350015011800000007,350015011800000007,350015011800000006,350015011800000006	0-23,0-23,0-20,0-20		23103171	10.1016/j.celrep.2012.09.019	2211-1247	Cell Reports	Cell Reports - Antagonism between MES-4 and Polycomb Repressive Complex 2 Promotes Appropriate Gene Expression in C. elegans Germ Cells	Gaydos	2012	0		
619	chrI	4518433	4518458	3500128195	23		4518433	4518458	8421504	2	17,6	0,19	g	350012819500000530	11-34						degree Philosophiae Doctor in the Department of Plant Sciences (Plant Breeding) November 2010 Promotor: Prof. Liezel Herselman (PhD)	etd.uovs.ac.za	0	0		
619	chrI	4557312	4557339	3500241278	23		4557312	4557339	8421504	2	16,7	0,20	g	350024127800000293	16-40							scientificbio.com	0	0		
619	chrI	4561628	4561652	3500246420	23		4561628	4561652	8421504	2	14,9	0,15	c	350024642000000020,350024642000000080	0-23,0-23						Companion diagnostic assays for cancer therapy - Patent application	www.faqs.org	0	0		
619	chrI	4561628	4561652	3500146799	23		4561628	4561652	8421504	2	14,9	0,15	c	350014679900000020	0-23						Companion diagnostic assays for cancer therapy	Murray	2008	0		
619	chrI	4561628	4561652	3500091210	23		4561628	4561652	8421504	2	14,9	0,15	c	350009121000000020	0-23						Companion Diagnostic Assays For Cancer Therapy 	.freshpatents.com	0	0		
619	chrI	4563485	4563511	3500088013	26		4563485	4563511	8421504	1	26	0	c	350008801300001710	4-31						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
619	chrI	4565234	4565260	3500251427	26		4565234	4565260	8421504	1	26	0	c	350025142700000063	97-123						QTL controlling Sclerotinia stem ROT resistance in soybean - Patent application	www.faqs.org	0	0		
619	chrI	4565234	4565260	3500080728	26		4565234	4565260	8421504	1	26	0	c	350008072800000050	97-123						QTL Controlling Sclerotinia Stem Rot Resistance in Soybean - Patent application	www.faqs.org	0	0		
619	chrI	4585039	4586297	3500292793	1197		4585039	4586297	8421504	3	838,240,119	0,898,1139	c,g	350029279300000001,350029279300000002,350029279300000002,350029279300000003,350029279300000004,350029279300000004,350029279300000006,350029279300000005,350029279300000005,350029279300000008,350029279300000007,350029279300000007,350029279300000009,350029279300000009,350029279300000012,350029279300000011,350029279300000013,350029279300000014,350029279300000015,350029279300000016	0-119,0-64,0-64,0-119,0-120,0-120,0-120,0-74,0-74,0-120,0-75,0-75,0-120,0-120,0-120,0-42,0-120,0-114,0-120,0-119						Protein sequence databases	cation.expasy.org	0	0		
619	chrI	4585831	4585990	3500288532	159		4585831	4585990	8421504	1	159	0	g	350028853200000024	3-162						ScienceDirect.com - Genomics - A combined computational and experimental analysis of two families of snoRNA genes from Caenorhabditis elegans, revealing the expression and evolution pattern of snoRNAs in nematodes	sciencedirect.com	0	0		
619	chrI	4586350	4586377	3500260606	23		4586350	4586377	8421504	2	14,9	0,18	g	350026060600001683	10-33						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
620	chrI	4591542	4591565	3500212728	23		4591542	4591565	8421504	1	23	0	c	350021272800001564	0-23						PPhhyyllooggeenneettiicc rreellaattiioonnsshhiippss ooff tthhee ggeennuuss LLaccheenalliiaa	etd.uovs.ac.za	0	0		
620	chrI	4611284	4611308	3500319091	24		4611284	4611308	8421504	1	24	0	g	350031909100000005,350031909100000004	1-25,1-24						PROGRAMMAZIONE	felix.unife.it	0	0		
620	chrI	4628784	4628808	3500040919	23		4628784	4628808	8421504	2	7,16	0,8	g	350004091900002029	13-36						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
620	chrI	4646339	4646836	3500354245	200		4646339	4646836	8421504	4	50,50,50,50	0,102,315,447	c,g	350035424500000006,350035424500000006,350035424500000000,350035424500000000,350035424500000008,350035424500000008,350035424500000002,350035424500000002	0-100,0-100,0-25,0-25,0-25,0-25,0-100,0-100						perl程序提取数字和相应内容_百度知道	zhidao.baidu.com	0	0		
620	chrI	4656089	4688082	3500144391	46		4656089	4688082	8421504	2	20,26	0,31967	c	350014439100000137,350014439100000575,350014439100000153,350014439100000145,350014439100000487,350014439100000356	9-29,9-29,18-38,18-38,16-39,11-34						SPIDER SILK DRAGLINE POLYNUCLEOTIDES, POLYPEPTIDES AND METHODS OF USE THEREOF - Patent application	www.faqs.org	0	0		
620	chrI	4669793	4670782	3500223400	989		4669793	4670782	8421504	1	989	0	c,g	350022340000000001,350022340000000001	0-989,0-989						pmk-1 | P38 Map Kinase family | genotype ID: 23190906 @ PhenomicDB	www.phenomicdb.de	0	0		
620	chrI	4670461	4678849	3500278994	70		4670461	4678849	8421504	3	24,23,23	0,5295,8365	c,g	350027899400000000,350027899400000000,350027899400000003,350027899400000003,350027899400000005	0-24,0-24,0-23,0-23,18-41						ScienceDirect.com - Neuron - Endophilin Is Required for Synaptic Vesicle Endocytosis by Localizing Synaptojanin	sciencedirect.com	0	0		
620	chrI	4684376	4684400	3500421940	24		4684376	4684400	8421504	1	24	0	c,g	350042194000000019,350042194000000019	0-24,0-24						ThemicroRNAs of Caenorhabditis elegans	cseweb.ucsd.edu	0	0		
620	chrI	4684377	4684400	3500389139	23		4684377	4684400	8421504	1	23	0	c,g	350038913900000223,350038913900000223	21-44,0-23						Anti-microrna oligonucleotide molecules	Tuschl	2006	0		
620	chrI	4684377	4684400	3500306561	23		4684377	4684400	8421504	1	23	0	c,g	350030656100000222,350030656100000222	21-44,0-23						Anti-microRNA oligonucleotide molecules	Landthaler	2011	0		
620	chrI	4684377	4684400	3500257436	23		4684377	4684400	8421504	1	23	0	c,g	350025743600000222,350025743600000222	21-44,0-23						Anti-MicroRna Oligonucleotide Molecules	Tuschl	2007	0		
620	chrI	4684377	4684400	3500232262	23		4684377	4684400	8421504	1	23	0	c,g	350023226200000222,350023226200000222	21-44,0-23					Patent	Anti-microRNA oligonucleotide molecules (Patent US:7772389)	Tuschl	2010	0		
620	chrI	4686822	4686851	3500416808	24		4686822	4686851	8421504	2	9,15	0,14	c,g	350041680800000233,350041680800000233	1-26,1-26					Patent	Recombinant herpesvirus of turkeys and uses thereof (Patent US:5853733)	Cochran	1998	0		
620	chrI	4692189	4694466	3500258078	43		4692189	4694466	8421504	3	21,15,7	0,2250,2270	c,g	350025807800000094,350025807800000094,350025807800000250	2-23,2-23,26-48						Nematode PAN and ZP Receptor-Like Sequences - Patent application	www.faqs.org	0	0		
620	chrI	4697712	4697741	3500391478	25		4697712	4697741	8421504	2	9,16	0,13	c	350039147800000666	3-28						dsRNA COMPOSITIONS AND METHODS FOR TREATING HPV INFECTION - Patent application	www.faqs.org	0	0		
620	chrI	4709362	4710371	3500036764	681		4709362	4710371	8421504	15	45,15,78,45,48,45,45,45,45,45,45,45,45,45,45	0,48,110,191,284,335,383,431,628,676,724,772,868,916,964	p	350003676400015118,350003676400015112,350003676400015078,350003676400015186,350003676400015110,350003676400015108,350003676400015183,350003676400015104,350003676400015102,350003676400015100,350003676400015098,350003676400015094,350003676400015092,350003676400015117,350003676400015116,350003676400015086,350003676400015084,350003676400015082	0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45						COMPOUNDS, COMPOSITIONS AND METHODS FOR CONTROLLING INVERTEBRATE PESTS - Patent application	www.faqs.org	0	0		
620	chrI	4715277	4715302	3500028050	23		4715277	4715302	8421504	3	5,4,14	0,6,11	g	350002805000000567	23-46						Stress response and virulence in Salmonella Typhimurium: a genomics approach	edepot.wur.nl	0	0		
621	chrI	4722549	4722573	3500312211	23		4722549	4722573	8421504	2	19,4	0,20	c	350031221100000134	2-25					Patent	Adenovirus vector specific for cells expressing alpha fetoprotein and methods of use thereof (Patent CN:100390292)	A*S*Li Te Er 	2008	0		
621	chrI	4790876	4790903	3500092028	24		4790876	4790903	8421504	2	10,14	0,13	c	350009202800000187,350009202800000034	0-24,0-24						Methods and Systems for Generating Cell Lineage Tree of Multiple Cell Samples - Patent application	www.faqs.org	0	0		
621	chrI	4826579	4826603	3500364807	24		4826579	4826603	8421504	1	24	0	c,g	350036480700000006,350036480700000006	0-24,0-24			10.1371/journal.pgen.0030056		PLoS Genetics	Lifespan Regulation by Evolutionarily Conserved Genes Essential for Viability	Sean	2007	0		
621	chrI	4827253	4828541	3500332858	83		4827253	4828541	8421504	2	20,63	0,1225	p,c	350033285800000003,350033285800015000	23-43,0-63		23990794	10.1371/journal.pgen.1003679	1553-7404	PLOS Genetics	PLOS Genetics: Identification of DSB-1, a Protein Required for Initiation of Meiotic Recombination in Caenorhabditis elegans, Illuminates a Crossover Assurance Checkpoint	Stamper	2013	0		
621	chrI	4827253	4828541	3500255985	83		4827253	4828541	8421504	2	20,63	0,1225	p,c	350025598500000003,350025598500015000	23-43,0-63		23990794	10.1371/journal.pgen.1003679		PLoS Genetics	Identification of DSB-1, a Protein Required for Initiation of Meiotic Recombination in Caenorhabditis elegans, Illuminates a Crossover Assurance Checkpoint	Ericca	2013	0		
77	chrI	4849629	4849704	3500362698	24		4849629	4849704	8421504	3	10,11,3	0,12,72	c	350036269800000284	1-25						Rubber tree genome download sequences	ww4a.biotec.or.th	0	0		
622	chrI	4852211	4852323	3500294113	23		4852211	4852323	8421504	3	15,5,3	0,16,109	c	350029411300000037	13-37						METHOD FOR TREATING NEURODEGENERATIVE DISEASES - Patent application	www.faqs.org	0	0		
622	chrI	4885046	4887955	3500304560	1459		4885046	4887955	8421504	8	330,176,67,185,244,72,144,241	0,694,915,1029,1574,2136,2251,2668	p,g	350030456000000002,350030456000015039,350030456000015038,350030456000015037,350030456000015034,350030456000015033,350030456000015032,350030456000015031,350030456000015028,350030456000015024,350030456000015023	0-1459,0-45,0-48,0-45,0-45,0-45,0-45,0-48,0-45,0-48,0-48						Dna encoding glutamate gated chloride channels	Arena	1997	0		
622	chrI	4902238	4902788	3500098245	240		4902238	4902788	8421504	3	18,174,48	0,84,502	p	350009824500015082,350009824500015083,350009824500015084,350009824500015085,350009824500015087	0-48,0-48,0-48,0-48,0-48						Prenylcysteine carboxyl methyltransferase, dna encoding same, and a method of screening for inhibitors thereof	Philips	1998	0		
622	chrI	4902238	4902788	3500013415	240		4902238	4902788	8421504	3	18,174,48	0,84,502	p	350001341500015082,350001341500015083,350001341500015084,350001341500015085,350001341500015087	0-48,0-48,0-48,0-48,0-48						Prenylcysteine carboxyl methyl-transferase, dna enconding same, and a method of screening for inhibitors thereof	Philips	2000	0		
622	chrI	4902464	4902701	3500259767	40		4902464	4902701	8421504	2	20,20	0,217	c,g	350025976700000018,350025976700000018,350025976700000019,350025976700000019	0-20,0-20,0-20,0-20		18828672	10.1371/journal.pbio.0060233		PLoS Biology	Caenorhabditis elegans HCF-1 Functions in Longevity Maintenance as a DAF-16 Regulator	Ji	2008	0		
622	chrI	4954344	4979032	3500426992	42		4954344	4979032	8421504	4	17,4,13,8	0,18,24664,24680	c,g	350042699200000124,350042699200000124,350042699200002034	6-28,6-28,19-40						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
622	chrI	4955661	4956539	3500404771	40		4955661	4956539	8421504	2	20,20	0,858	c,g	350040477100000004,350040477100000004,350040477100000003,350040477100000003	0-20,0-20,0-20,0-20		15767665	10.1128/MCB.25.7.2583-2592.2005	0270-7306	Molecular and Cellular Biology	HCP-4/CENP-C Promotes the Prophase Timing of Centromere Resolution by Enabling the Centromere Association of HCP-6 in Caenorhabditis elegans	Moore	2005	6		
77	chrI	4980433	4981205	3500139202	60		4980433	4981205	8421504	4	20,20,10,10	0,451,506,762	c,g	350013920200000000,350013920200000000,350013920200000018,350013920200000018,350013920200000001	0-20,0-20,0-20,0-20,0-20						Caenorhabditis elegans stress related gene responses to selected pesticides.	.nottingham.ac.uk	0	0		
623	chrI	4983013	4983047	3500252890	28		4983013	4983047	8421504	3	6,9,13	0,10,21	c	350025289000000260	4-32						Neisseria meningitidis antigens and compositions	Fraser	2012	0		
623	chrI	4983341	4983367	3500173250	25		4983341	4983367	8421504	2	19,6	0,20	g	350017325000000383	15-46						Engineered Listeria and methods of use thereof	Dubensky	2006	0		
623	chrI	4994245	4994272	3500457455	23		4994245	4994272	8421504	3	13,5,5	0,15,22	g	350045745500000050	9-32			10.1046/j.1365-2958.2002.02985.x	1365-2958	Molecular Microbiology	Genomics of the marA/soxS/rob regulon of Escherichia coli: identification of directly activated promoters by application of molecular genetics and informatics to microarray data - Martin - 2002 - Molecular Microbiology - Wiley Online Library	Martin	2002	0		
623	chrI	5019970	5019993	3500127210	23		5019970	5019993	8421504	1	23	0	c,g	350012721000000000,350012721000000000	10-33,10-33		15064356	10.1091/mbc.E04-03-0179	1059-1524	Molecular Biology of the Cell	Tropomyosin and Troponin Are Required for Ovarian Contraction in the Caenorhabditis elegans Reproductive System	Ono	2004	5		
623	chrI	5023892	5036760	3500283340	118		5023892	5036760	8421504	5	27,22,22,25,22	0,3319,3843,4781,12846	c,g	350028334000000003,350028334000000003,350028334000000000,350028334000000000,350028334000000002,350028334000000002,350028334000000001,350028334000000004,350028334000000004	0-27,0-27,0-22,0-22,0-22,0-22,0-25,0-22,0-22					Bioinformation	Computational and molecular characterization of multiple isoforms of lfe-2 gene in nematode C. elegans	Luv	2007	0		
623	chrI	5030212	5030240	3500399634	26		5030212	5030240	8421504	2	19,7	0,21	g	350039963400000034	13-39						Recombinant vesiculoviruses and their uses	Rose	1998	0		
623	chrI	5094418	5094443	3500326022	24		5094418	5094443	8421504	2	19,5	0,20	g	350032602200000004	1-27						trmA	web.wadsworth.org	0	0		
624	chrI	5124440	5124464	3500244455	23		5124440	5124464	8421504	2	17,6	0,18	c	350024445500000000	13-36						Μεθοδολογία Ασκήσεων ΚΕΦ. 2ο	les.wordpress.com	0	0		
624	chrI	5135698	5137941	3500349709	46		5135698	5137941	8421504	2	23,23	0,2220	g	350034970900000005,350034970900000006	0-23,0-23		22272187	10.1371/journal.pbio.1001245		PLoS Biology	Two PI 3-Kinases and One PI 3-Phosphatase Together Establish the Cyclic Waves of Phagosomal PtdIns(3)P Critical for the Degradation of Apoptotic Cells	Nan	2012	0		
624	chrI	5136280	5136757	3500411126	477		5136280	5136757	8421504	1	477	0	c,g	350041112600000001,350041112600000001,350041112600000075,350041112600000075,350041112600000083,350041112600000083,350041112600000003,350041112600000003,350041112600000077,350041112600000077,350041112600000005,350041112600000005,350041112600000079,350041112600000007,350041112600000007,350041112600000009,350041112600000009,350041112600000011,350041112600000011,350041112600000069,350041112600000069,350041112600000013,350041112600000013,350041112600000071,350041112600000071,350041112600000015,350041112600000015,350041112600000073,350041112600000073	0-60,0-60,0-60,0-60,0-27,0-27,0-60,0-60,0-60,0-60,0-59,0-59,0-38,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-59,0-59,0-59,0-59,0-59,0-59,0-21,0-21						Step 2. Does your sequence contain a region that codes for protein?	wssp.rutgers.edu	0	0		
624	chrI	5138697	5138745	3500182685	48		5138697	5138745	8421504	1	48	0	p	350018268500015001	0-48			10.1099/vir.0.80048-0	0022-1317	Journal of General Virology	Identification of the thymidylate synthase within the genome of white spot syndrome virus	Li	2004	3		TYMS
624	chrI	5139459	5149119	3500244933	111		5139459	5149119	8421504	5	20,20,29,21,21	0,6869,8176,9597,9639	c,g	350024493300000006,350024493300000007,350024493300000002,350024493300000005,350024493300000005,350024493300000001,350024493300000001	8-28,0-20,10-39,8-29,8-29,12-33,12-33		16672334	10.1242/dev.02392	0950-1991	Development	Activation of nicotinic receptors uncouples a developmental timer from the molting timer in C. elegans	Ruaud	2006	7		
624	chrI	5139459	5149119	3500016527	82		5139459	5149119	8421504	4	20,20,21,21	0,6869,9597,9639	c,g	350001652700000006,350001652700000007,350001652700000005,350001652700000005,350001652700000001,350001652700000001	8-28,0-20,8-29,8-29,12-33,12-33		16672334	10.1242/dev.02392	0950-1991	Development	Activation of nicotinic receptors uncouples a developmental timer from the molting timer in C. elegans	Ruaud	2006	7		
624	chrI	5140153	5140178	3500310962	23		5140153	5140178	8421504	2	6,17	0,8	g	350031096200000498	19-42						<Html><Title> Complet list of 1qxk hssp file Complet list of	cnptia.embrapa.br	0	0		
624	chrI	5146196	5146224	3500234306	24		5146196	5146224	8421504	2	15,9	0,19	c	350023430600000086	0-24						Isolation and Characterization of 46 Novel Polymorphic EST-Simple Sequence Repeats (SSR) Markers in Two Sinipercine Fishes (Siniperca) and Cross-Species Amplification	www.mdpi.com	0	0		
624	chrI	5148341	5148364	3500039132	23		5148341	5148364	8421504	1	23	0	c,g	350003913200000054,350003913200000054	23-46,23-46						Funktionelle Charakterisierung zweier Levamisolrezeptor-assoziierter Proteine in C. elegans – NRA-2 und NRA-4	.uni-frankfurt.de	0	0		
624	chrI	5164780	5171535	3500155703	87		5164780	5171535	8421504	4	20,22,23,22	0,2095,2649,6733	c,g	350015570300000000,350015570300000003,350015570300000002,350015570300000004,350015570300000004,350015570300000005,350015570300000005,350015570300000001,350015570300000001	0-20,23-44,0-22,0-23,0-23,23-45,23-45,0-22,0-22		12080088	10.1101/gad.989102	0890-9369	Genes & Development	Characterization of HCP-6, a C. elegans protein required to prevent chromosome twisting and merotelic attachment	Stear	2002	12		
624	chrI	5165406	5166364	3500404771	40		5165406	5166364	8421504	2	20,20	0,938	c,g	350040477100000011,350040477100000011,350040477100000012,350040477100000012	0-20,0-20,0-20,0-20		15767665	10.1128/MCB.25.7.2583-2592.2005	0270-7306	Molecular and Cellular Biology	HCP-4/CENP-C Promotes the Prophase Timing of Centromere Resolution by Enabling the Centromere Association of HCP-6 in Caenorhabditis elegans	Moore	2005	6		
624	chrI	5166840	5166868	3500136829	24		5166840	5166868	8421504	2	17,7	0,21	c	350013682900000365	12-36						<Html><Title> Complet list of 1ds4 hssp file Complet list of	cnptia.embrapa.br	0	0		
624	chrI	5167759	5168327	3500034726	40		5167759	5168327	8421504	2	20,20	0,548	c,g	350003472600000010,350003472600000010,350003472600000011,350003472600000011	19-39,19-39,19-39,19-39						The use of eukaryotic genes affecting chromatin separation for diagnosis and treatment of proliferative diseases	Echeverri	2005	0		
624	chrI	5169300	5169324	3500465267	23		5169300	5169324	8421504	2	14,9	0,15	c	350046526700000002	0-23						ATP-binding cassette transporter controls leaf in Catharanthus roseus	www.pnas.org	0	0		
624	chrI	5169300	5169324	3500450567	23		5169300	5169324	8421504	2	14,9	0,15	c	350045056700000002	0-23		24019465	10.1073/pnas.1307504110	0027-8424	Proceedings of the National Academy of Sciences	ATP-binding cassette transporter controls leaf surface secretion of anticancer drug components in Catharanthus roseus	Yu	2013	10		
624	chrI	5186987	5188618	3500414197	72		5186987	5188618	8421504	3	25,20,27	0,1578,1604	c,g	350041419700000019,350041419700000010,350041419700000011,350041419700000011,350041419700000001,350041419700000001,350041419700000020,350041419700000020	20-45,0-20,0-20,0-20,12-39,12-39,19-44,19-44		17933794	10.1242/dev.008276	0950-1991	Development	The C. elegans CBFβ homologue BRO-1 interacts with the Runx factor, RNT-1, to promote stem cell proliferation and self-renewal	Kagoshima	2007	7		
624	chrI	5187539	5187564	3500157885	25		5187539	5187564	8421504	1	25	0	g	350015788500000004,350015788500000003	0-25,0-25		21829390	10.1371/journal.pgen.1002200	1553-7404	PLOS Genetics	PLOS Genetics: The Caenorhabditis elegans GATA Factor ELT-1 Works through the Cell Proliferation Regulator BRO-1 and the Fusogen EFF-1 to Maintain the Seam Stem-Like Fate	Brabin	2011	0		
624	chrI	5239189	5239215	3500261505	24		5239189	5239215	8421504	2	6,18	0,8	c	350026150500001496	7-31						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
625	chrI	5246907	5247038	3500370054	40		5246907	5247038	8421504	2	20,20	0,111	c,g	350037005400000010,350037005400000010,350037005400000011,350037005400000011	0-20,0-20,0-20,0-20						Methods for prolonging the health benefits triggered by a dietary restriction using a sphingosine kinase inhibitor	Aguilaniu	2010	0		
625	chrI	5262569	5262900	3500092739	40		5262569	5262900	8421504	2	20,20	0,311	c,g	350009273900000042,350009273900000042,350009273900000043,350009273900000043	0-20,0-20,0-20,0-20		22174070	10.1534/genetics.111.137455		Genetics	Cell Excitability Necessary for Male Mating Behavior in Caenorhabditis elegans Is Coordinated by Interactions Between Big Current and Ether-A-Go-Go Family K+ Channels	Brigitte	2012	0		
625	chrI	5265289	5265317	3500231920	23		5265289	5265317	8421504	2	11,12	0,16	c	350023192000001186	22-45						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
625	chrI	5303128	5305399	3500429902	80		5303128	5305399	8421504	4	20,20,20,20	0,294,1896,2251	c,g	350042990200000003,350042990200000003,350042990200000002,350042990200000002,350042990200000001,350042990200000001,350042990200000000,350042990200000000	0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20						A quantitative targeted proteomics approach to validate predicted micrornA targets in C. elegans	quantification.de	0	0		
625	chrI	5303128	5305399	3500203797	80		5303128	5305399	8421504	4	20,20,20,20	0,294,1896,2251	c,g	350020379700000003,350020379700000003,350020379700000002,350020379700000002,350020379700000001,350020379700000001,350020379700000000,350020379700000000	0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20						A quantitative targeted proteomics approach to validate predicted micrornA targets in C. elegans	www.tamu.edu	0	0		
625	chrI	5303128	5305399	3500007964	80		5303128	5305399	8421504	4	20,20,20,20	0,294,1896,2251	c,g	350000796400000003,350000796400000003,350000796400000002,350000796400000002,350000796400000001,350000796400000001,350000796400000000,350000796400000000	0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20						A quantitative targeted proteomics approach to validate predicted micrornA targets in C. elegans	qpcrupdate.net	0	0		
625	chrI	5331824	5332105	3500214872	23		5331824	5332105	8421504	2	12,11	0,270	c	350021487200000531	7-37						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
625	chrI	5342548	5348251	3500324754	65		5342548	5348251	8421504	3	22,23,20	0,1427,5683	c,g	350032475400000005,350032475400000004,350032475400000004,350032475400000002,350032475400000002	0-22,0-23,0-23,0-20,0-20		10930467	10.1091/mbc.11.8.2743	1059-1524	Molecular Biology of the Cell	Distinct and Redundant Functions of μ1 Medium Chains of the AP-1 Clathrin-Associated Protein Complex in the NematodeCaenorhabditis elegans	Shim	2000	5		
625	chrI	5349416	5354716	3500317498	114		5349416	5354716	8421504	5	22,25,21,21,25	0,1565,2164,3393,5275	c,g	350031749800000003,350031749800000003,350031749800000000,350031749800000000,350031749800000005,350031749800000006,350031749800000006,350031749800000004	0-22,0-22,0-25,0-25,0-21,0-21,0-21,0-25		22235190	10.1371/journal.pbio.1001230	1545-7885	PLOS Biology	PLOS Biology: Role of Pleiotropy in the Evolution of a Cryptic Developmental Variation in Caenorhabditis elegans	Duveau	2012	0		
625	chrI	5356552	5365850	3500372678	261		5356552	5365850	8421504	9	20,25,25,54,3,57,24,23,30	0,328,1971,3900,4163,4172,7571,8802,9268	p,c,g	350037267800000015,350037267800000000,350037267800000000,350037267800000016,350037267800000004,350037267800000009,350037267800015000,350037267800000012,350037267800000006,350037267800000006,350037267800000001	0-20,0-25,0-25,10-32,10-31,23-44,9-132,0-24,0-23,0-23,0-30						ScienceDirect.com - Developmental Biology - Overexpression of PPK-1, the Caenorhabditis elegans Type I PIP kinase, inhibits growth cone collapse in the developing nervous system and causes axonal degeneration in adults	sciencedirect.com	0	0		
625	chrI	5356552	5365850	3500045200	266		5356552	5365850	8421504	9	20,25,30,54,3,57,24,23,30	0,328,1966,3900,4163,4172,7571,8802,9268	p,c,g	350004520000000015,350004520000000000,350004520000000000,350004520000000004,350004520000000016,350004520000000009,350004520000000009,350004520000015000,350004520000000012,350004520000000012,350004520000000006,350004520000000006,350004520000000001	0-20,0-25,0-25,4-31,10-32,23-44,23-44,9-132,0-24,0-24,0-23,0-23,0-30			10.1016/j.ydbio.2007.10.029		Developmental biology	Overexpression of PPK-1, the C. elegans Type 1 PIP kinase, inhibits growth cone collapse in the developing nervous system and causes axonal degeneration in adults	David	2008	0		
78	chrI	5360139	5383354	3500190843	39		5360139	5383354	8421504	4	13,6,14,6	0,15,23194,23209	g	350019084300000651,350019084300001011	17-36,1-21						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
78	chrI	5368232	5375172	3500003185	41		5368232	5375172	8421504	3	20,9,12	0,6918,6928	g	350000318500000868,350000318500000581	0-20,4-29						Anti-bacterial methods and materials	Holden	2000	0		
626	chrI	5408342	5411590	3500161555	40		5408342	5411590	8421504	2	20,20	0,3228	g	350016155500000001,350016155500000000	0-20,0-20						C24A11.8 (frm-4): sIs10475 | Flickr - Photo Sharing!	www.flickr.com	0	0		
626	chrI	5432160	5433057	3500348621	897		5432160	5433057	8421504	1	897	0	g	350034862100000000	0-897						None	openwetware.org	0	0		
626	chrI	5432199	5433054	3500464404	40		5432199	5433054	8421504	2	20,20	0,835	c,g	350046440400000003,350046440400000003,350046440400000002,350046440400000002	6-26,6-26,0-20,0-20						Supplementary Materials For: A modified feeding RNAi method for simultaneous knock-down of more than one gene in C. elegans	biotechniques.com	0	0		
626	chrI	5432207	5433027	3500044377	40		5432207	5433027	8421504	2	20,20	0,800	c,g	350004437700000002,350004437700000002,350004437700000003,350004437700000003	0-20,0-20,0-20,0-20			10.1091/mbc.E02-08-0479		Molecular Biology of the Cell	Two Sets of Interacting Collagens Form Functionally Distinct Substructures within a Caenorhabditis elegans Extracellular Matrix	Laura	2003	0		
626	chrI	5471339	5483969	3500336276	41		5471339	5483969	8421504	4	15,5,14,7	0,18,12608,12623	c,g	350033627600002601,350033627600002991,350033627600002991	10-30,0-23,0-23						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
626	chrI	5471339	5483969	3500209433	41		5471339	5483969	8421504	4	15,5,14,7	0,18,12608,12623	c,g	350020943300002528,350020943300002912,350020943300002912	10-30,0-23,0-23						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
626	chrI	5485153	5485176	3500318788	23		5485153	5485176	8421504	1	23	0	c	350031878800000066,350031878800000064,350031878800000071,350031878800000072,350031878800000074	0-22,0-23,0-21,0-22,1-22						Nematode Control 	.freshpatents.com	0	0		
626	chrI	5485153	5485176	3500259202	23		5485153	5485176	8421504	1	23	0	c,g	350025920200000073,350025920200000072,350025920200000070,350025920200000077,350025920200000082,350025920200000078,350025920200000080	6-29,0-22,0-23,0-21,5-28,0-22,1-22						Nematode Control	Craen	2010	0		
626	chrI	5501706	5501733	3500248578	24		5501706	5501733	8421504	2	12,12	0,15	c	350024857800000001	6-30			10.1104/pp.103.021808		Plant Physiology	Arabidopsis UVH6, a Homolog of Human XPD and Yeast RAD3 DNA Repair Genes, Functions in DNA Repair and Is Essential for Plant Growth	Zongrang	July	0		
627	chrI	5533696	5533721	3500375490	23		5533696	5533721	8421504	2	7,16	0,9	g	350037549000001577	0-23						PHYLOGENETIC RELATIONSHIPS IN THE FAMILY AMARYLLIDACEAE	etd.uovs.ac.za	0	0		
627	chrI	5541661	5541688	3500384344	24		5541661	5541688	8421504	2	6,18	0,9	g	350038434400000043	9-35						Methods and means to modulate programmed cell death in eukaryotic cells	Babiychuk	2001	0		
627	chrI	5541661	5541688	3500218028	24		5541661	5541688	8421504	2	6,18	0,9	g	350021802800000080	9-35					Patent	Methods and means to modulate programmed cell death in eukaryotic cells (Patent CN:1289680)	E*Ba Bi Chu Ke 	2006	0		
627	chrI	5580133	5581770	3500307359	1173		5580133	5581770	8421504	8	180,6,57,144,109,245,119,313	0,189,239,299,487,659,1155,1324	p	350030735900015090,350030735900015092,350030735900015095,350030735900015099,350030735900015101,350030735900015103,350030735900015105	0-180,6-174,0-180,0-180,0-180,0-165,0-120						48 human secreted proteins	Komatsoulis	2000	0		
627	chrI	5581680	5581705	3500122340	23		5581680	5581705	8421504	2	5,18	0,7	c	350012234000000079	0-23						Polynucleotides Encoding Acetylcholine-Gated Chloride Channel Subunits of Caenorhabditis Elegans - Patent application	www.faqs.org	0	0		
627	chrI	5582200	5583152	3500098245	333		5582200	5583152	8421504	5	48,12,180,48,45	0,144,201,694,907	p	350009824500015065,350009824500015067,350009824500015068,350009824500015069,350009824500015070,350009824500015072,350009824500015075	0-48,0-48,0-48,0-48,0-48,0-48,0-45						Prenylcysteine carboxyl methyltransferase, dna encoding same, and a method of screening for inhibitors thereof	Philips	1998	0		
627	chrI	5582200	5583152	3500013415	333		5582200	5583152	8421504	5	48,12,180,48,45	0,144,201,694,907	p	350001341500015065,350001341500015067,350001341500015068,350001341500015069,350001341500015070,350001341500015072,350001341500015075	0-48,0-48,0-48,0-48,0-48,0-48,0-45						Prenylcysteine carboxyl methyl-transferase, dna enconding same, and a method of screening for inhibitors thereof	Philips	2000	0		
627	chrI	5607910	5609630	3500362267	95		5607910	5609630	8421504	3	47,25,23	0,904,1697	c,g	350036226700000005,350036226700000001,350036226700000004,350036226700000004,350036226700000000	0-25,10-36,10-35,10-35,7-30		16816413	10.1534/genetics.106.061580	0016-6731	Genetics	Ubiquitin-Like Protein 5 Positively Regulates Chaperone Gene Expression in the Mitochondrial Unfolded Protein Response	Benedetti	2006	4		
628	chrI	5676889	5677568	3500269477	228		5676889	5677568	8421504	6	45,27,18,45,28,65	0,48,124,145,241,614	p	350026947700015080,350026947700015081,350026947700015082,350026947700015084,350026947700015057,350026947700015085	0-45,0-45,0-45,0-45,0-45,0-45						Anti-Methylation-Controlled J Protein Antibodies and Uses Thereof - Patent application	www.faqs.org	0	0		
628	chrI	5706272	5707056	3500375557	42		5706272	5707056	8421504	2	22,20	0,764	g	350037555700000000,350037555700000001	0-22,0-20		16236764	10.1242/dev.02102	0950-1991	Development	mab-2 encodes RNT-1, a C. elegans Runx homologue essential for controlling cell proliferation in a stem cell-like developmental lineage	Nimmo	2005	7		
628	chrI	5707047	5707122	3500288532	75		5707047	5707122	8421504	1	75	0	g	350028853200000009	0-75						ScienceDirect.com - Genomics - A combined computational and experimental analysis of two families of snoRNA genes from Caenorhabditis elegans, revealing the expression and evolution pattern of snoRNAs in nematodes	sciencedirect.com	0	0		
628	chrI	5716786	5718548	3500032787	38		5716786	5718548	8421504	2	19,19	0,1743	c,g	350003278700000003,350003278700000003,350003278700000004,350003278700000004	28-47,28-47,28-47,28-47						A “FLP-out” system for controlled gene expression in C. elegans	www.genetics.org	0	0		
628	chrI	5721917	5721965	3500430809	48		5721917	5721965	8421504	1	48	0	p	350043080900015023	0-48						Patent Search: US Patent Number 8299236 - Compositions and methods for enhancing delivery of nucleic acids into cells and for modifying expression of target genes in cells	ww.archpatent.com	0	0		ISL1
628	chrI	5721917	5721965	3500415188	48		5721917	5721965	8421504	1	48	0	p	350041518800015007	0-48						Synthetic Lipid Rafts and Methods of Use	Khan	2007	0		ISL1
628	chrI	5721917	5721965	3500324849	48		5721917	5721965	8421504	1	48	0	p	350032484900015003,350032484900015036	48-96,0-48						Compositions and methods for enhancing delivery of nucleic acids into cells and for modifying expression of target genes in cells	Chen	2005	0		ISL1
628	chrI	5721917	5721965	3500313912	48		5721917	5721965	8421504	1	48	0	p	350031391200015006	0-48						Synthetic lipid rafts and methods of use	Khan	2007	0		ISL1
628	chrI	5721917	5721965	3500292820	48		5721917	5721965	8421504	1	48	0	p	350029282000015079	0-48						Lipopeptides for delivery of nucleic acids	Adami	2010	0		ISL2
628	chrI	5721917	5721965	3500208064	48		5721917	5721965	8421504	1	48	0	p	350020806400015038	0-48						COMPOSITIONS AND METHODS FOR LIPID AND POLYPEPTIDE BASED siRNA INTRACELLULAR DELIVERY	Cui	2007	0		ISL1
628	chrI	5721917	5721965	3500188627	48		5721917	5721965	8421504	1	48	0	p	350018862700015022	0-48						COMPOSITIONS AND METHODS FOR ENHANCING DELIVERY OF NUCLEIC ACIDS INTO CELLS AND FOR MODIFYING EXPRESSION OF TARGET GENES IN CELLS - Patent application	www.faqs.org	0	0		ISL1
628	chrI	5721917	5721965	3500100022	48		5721917	5721965	8421504	1	48	0	p	350010002200015087	0-48						Peptide-dicer substrate rna conjugates as delivery vehicles for sirna	Ahmadian	2007	0		ISL2
628	chrI	5721917	5721965	3500001458	48		5721917	5721965	8421504	1	48	0	p	350000145800015006	0-48						Cell-penetrating peptides and bioactive cargoes. Strategies and mechanisms.	w.diva-portal.org	0	0		ISL1
628	chrI	5727200	5727225	3500336276	23		5727200	5727225	8421504	2	8,15	0,10	c	350033627600002986	0-23						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
628	chrI	5727200	5727225	3500209433	23		5727200	5727225	8421504	2	8,15	0,10	c	350020943300002907	0-23						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
628	chrI	5738206	5738232	3500028307	23		5738206	5738232	8421504	2	17,6	0,20	c	350002830700000132	1-24						114 craig c. mello - 7759463 - rna interference pathway genes as ...	ww.slideshare.net	0	0		
628	chrI	5743045	5746689	3500407013	84		5743045	5746689	8421504	4	20,22,22,20	0,1125,2477,3624	c,g	350040701300000004,350040701300000004,350040701300000008,350040701300000009,350040701300000005	0-20,0-20,0-22,0-22,0-20		21895890	10.1111/j.1365-2443.2011.01547.x	1365-2443	Genes to Cells	A mutation in a mitochondrial dehydrogenase/reductase gene causes an increased sensitivity to oxidative stress and mitochondrial defects in the nematode Caenorhabditis elegans - Fujii - 2011 - Genes to Cells - Wiley Online Library	Fujii	2011	0		
628	chrI	5759745	5759770	3500004484	24		5759745	5759770	8421504	2	18,6	0,19	c	350000448400001362	13-37						#NEXUS [MacClade 3.01 registered to Brent D. Mishler, Duke University] [**The final matrix GP-COMB	jeps.berkeley.edu	0	0		
628	chrI	5760918	5762370	3500178446	43		5760918	5762370	8421504	2	22,21	0,1431	g	350017844600000005,350017844600000004	0-22,0-21		21156009	10.1111/j.1365-2443.2010.01469.x	1365-2443	Genes to Cells	Mutation in a mitochondrial ribosomal protein causes increased sensitivity to oxygen with decreased longevity in the nematode Caenorhabditis elegans - Fujii - 2010 - Genes to Cells - Wiley Online Library	Fujii	2011	0		
629	chrI	5773695	5773723	3500447298	24		5773695	5773723	8421504	2	15,9	0,19	g	350044729800000003	0-24						 OVB | Online references | cyclopaedia.net	n.cyclopaedia.net	0	0		
629	chrI	5783810	5788473	3500375557	86		5783810	5788473	8421504	6	21,3,17,17,4,24	0,2365,3344,4544,4562,4639	c,g	350037555700000004,350037555700000006,350037555700000007,350037555700000007,350037555700000005	0-21,14-34,13-34,13-34,6-30		16236764	10.1242/dev.02102	0950-1991	Development	mab-2 encodes RNT-1, a C. elegans Runx homologue essential for controlling cell proliferation in a stem cell-like developmental lineage	Nimmo	2005	7		
629	chrI	5783843	5788196	3500414197	121		5783843	5788196	8421504	4	27,23,49,22	0,1056,2263,4331	c,g	350041419700000015,350041419700000015,350041419700000008,350041419700000008,350041419700000017,350041419700000018,350041419700000009	54-81,54-81,0-23,0-23,0-36,0-35,0-22		17933794	10.1242/dev.008276	0950-1991	Development	The C. elegans CBFβ homologue BRO-1 interacts with the Runx factor, RNT-1, to promote stem cell proliferation and self-renewal	Kagoshima	2007	7		
629	chrI	5785183	5788375	3500278787	71		5785183	5788375	8421504	3	24,22,25	0,2845,3167	c,g	350027878700000001,350027878700000001,350027878700000002,350027878700000002,350027878700000000,350027878700000000	1-25,1-25,0-22,0-22,0-25,0-25						ScienceDirect.com - Developmental Biology - RNT-1, the C. elegans homologue of mammalian RUNX transcription factors, regulates body size and male tail development	sciencedirect.com	0	0		
629	chrI	5786046	5788256	3500416626	49		5786046	5788256	8421504	2	25,24	0,2186	c,g	350041662600000000,350041662600000001,350041662600000001	0-25,0-24,0-24			10.1186/1471-213X-6-39	1471-213X	BMC Developmental Biology	C. elegans feeding defective mutants have shorter body lengths and increased autophagy	MAPrck	2006	3		
629	chrI	5789280	5792277	3500049600	80		5789280	5792277	8421504	4	20,20,20,20	0,47,2898,2977	c,g	350004960000000000,350004960000000000,350004960000000002,350004960000000002,350004960000000003,350004960000000001	0-20,0-20,0-20,0-20,0-20,0-20						ScienceDirect.com - Developmental Biology - C. elegans CPB-3 interacts with DAZ-1 and functions in multiple steps of germline development	sciencedirect.com	0	0		
629	chrI	5801584	5801607	3500295643	23		5801584	5801607	8421504	1	23	0	g	350029564300000017	0-26						Promoters used to regulate gene expression	ww.patentlens.net	0	0		
629	chrI	5801584	5801607	3500197809	23		5801584	5801607	8421504	1	23	0	g	350019780900000004	0-26						Appendix 1	www.bios.net	0	0		
629	chrI	5807738	5812941	3500096380	42		5807738	5812941	8421504	2	21,21	0,5182	c,g	350009638000000004,350009638000000004,350009638000000005,350009638000000005	0-21,0-21,0-21,0-21		16322520	10.1534/genetics.105.048751	0016-6731	Genetics	gon-14 Functions With Class B and Class C Synthetic Multivulva Genes to Control Larval Growth in Caenorhabditis elegans	Chesney	2006	4		
629	chrI	5807738	5812941	3500057107	42		5807738	5812941	8421504	2	21,21	0,5182	c,g	350005710700000004,350005710700000004,350005710700000005,350005710700000005	0-21,0-21,0-21,0-21						gon-14 Functions With Class B and Class C Synthetic Multivulva Genes to Control Larval Growth in Caenorhabditis elegans--《遗传学杂志》--医学期刊频道--首席医&#	journal.9med.net	0	0		
629	chrI	5857795	5857822	3500197891	25		5857795	5857822	8421504	2	15,10	0,17	c	350019789100000242	0-32						Index Seq ID Count Primer type Orientation Start Len tm GC% Any compl 3' compl Seq Prod size Seq len	openwetware.org	0	0		
629	chrI	5867084	5868108	3500310552	38		5867084	5868108	8421504	2	19,19	0,1005	c,g	350031055200000003,350031055200000003,350031055200000002,350031055200000002	0-19,0-19,0-19,0-19		17437990	10.1101/gad.417707	0890-9369	Genes & Development	Mechanistic insights and identification of two novel factors in the C. elegans NMD pathway	Longman	2007	12		
629	chrI	5867084	5868108	3500200723	38		5867084	5868108	8421504	2	19,19	0,1005	c,g	350020072300000003,350020072300000003,350020072300000002,350020072300000002	0-19,0-19,0-19,0-19						Mechanistic insights and identification of two novel factors in the C. elegans NMD pathway--《基因进展》医学期刊--医学期刊频道--首席医学	journal.9med.net	0	0		
629	chrI	5870300	5870323	3500415388	23		5870300	5870323	8421504	1	23	0	g	350041538800000508	17-46						Dna molecules that code for enzymes involved in starch synthesis, vectors, bacteria, transgenic plant cells and plants containing said molecules	Abel	1996	0		
629	chrI	5877597	5878645	3500420337	40		5877597	5878645	8421504	2	20,20	0,1028	c,g	350042033700000026,350042033700000026,350042033700000009,350042033700000009,350042033700000025,350042033700000025,350042033700000008,350042033700000008	0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20						Nematode PAN and ZP receptor-like sequences	Hresko	2005	0		
629	chrI	5877597	5878645	3500258078	109		5877597	5878645	8421504	6	20,27,1,21,20,20	0,211,377,531,599,1028	c,g	350025807800000009,350025807800000009,350025807800000026,350025807800000026,350025807800000225,350025807800000245,350025807800000244,350025807800000008,350025807800000008,350025807800000025,350025807800000025	0-20,0-20,0-20,0-20,21-48,19-41,0-20,0-20,0-20,0-20,0-20						Nematode PAN and ZP Receptor-Like Sequences - Patent application	www.faqs.org	0	0		
629	chrI	5884996	5885988	3500375557	42		5884996	5885988	8421504	2	20,22	0,970	g	350037555700000002,350037555700000003	0-20,0-22		16236764	10.1242/dev.02102	0950-1991	Development	mab-2 encodes RNT-1, a C. elegans Runx homologue essential for controlling cell proliferation in a stem cell-like developmental lineage	Nimmo	2005	7		
629	chrI	5892008	5895061	3500348282	93		5892008	5895061	8421504	3	37,11,45	0,167,3008	p	350034828200015042,350034828200015075	0-48,0-45						Methods for detecting and reversing resistance to macrocyclic lactone compounds - Patent # 7358053 - PatentGenius	.patentgenius.com	0	0		
629	chrI	5894031	5894059	3500190843	25		5894031	5894059	8421504	2	5,20	0,8	g	350019084300001414	12-37						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
629	chrI	5895152	5895330	3500350443	97		5895152	5895330	8421504	3	20,30,47	0,66,131	c,g	350035044300000140,350035044300000140,350035044300000139	0-50,0-50,2-49						OLIGONUCLEOTIDE ANALOGUES FOR DETECTING AND ANALYZING NUCLEIC ACIDS - Exiqon, A/s	www.sumobrain.com	0	0		
630	chrI	5936979	5938848	3500087662	97		5936979	5938848	8421504	4	28,23,20,26	0,1237,1661,1843	c,g	350008766200000000,350008766200000002,350008766200000003,350008766200000003,350008766200000001	0-28,15-38,17-37,17-37,0-26						ScienceDirect.com - Mechanisms of Development - Stu-71air-2 is a C. elegans aurora homologue essential for chromosome segregation during embryonic and post-embryonic development	sciencedirect.com	0	0		
630	chrI	5938637	5938688	3500333336	51		5938637	5938688	8421504	1	51	0	p	350033333600015000	0-51		19889842	10.1091/mbc.E09-01-0089	1059-1524	Molecular Biology of the Cell	Analyzing the Effects of Delaying Aster Separation on Furrow Formation during Cytokinesis in the Caenorhabditis elegans Embryo	Lewellyn	2010	5		
630	chrI	6001794	6001825	3500318788	26		6001794	6001825	8421504	3	12,5,9	0,15,22	g	350031878800000232	0-30						Nematode Control 	.freshpatents.com	0	0		
630	chrI	6001794	6001825	3500259202	26		6001794	6001825	8421504	3	12,5,9	0,15,22	g	350025920200000274	0-30						Nematode Control	Craen	2010	0		
78	chrI	6012852	6042549	3500323108	43		6012852	6042549	8421504	3	20,8,15	0,29256,29682	c	350032310800000963,350032310800000859	3-23,0-23						Plant genes and uses thereof	J*M*Sa Er Mi Long 	2002	0		
631	chrI	6029330	6032430	3500349709	60		6029330	6032430	8421504	3	20,20,20	0,679,3080	c,g	350034970900000000,350034970900000000,350034970900000001,350034970900000001,350034970900000002,350034970900000002	0-20,0-20,0-20,0-20,0-20,0-20		22272187	10.1371/journal.pbio.1001245		PLoS Biology	Two PI 3-Kinases and One PI 3-Phosphatase Together Establish the Cyclic Waves of Phagosomal PtdIns(3)P Critical for the Degradation of Apoptotic Cells	Nan	2012	0		
631	chrI	6030025	6030053	3500251828	25		6030025	6030053	8421504	3	11,8,6	0,12,22	c	350025182800000509	0-28						Multiple Gene Expression Including sORF Constructs and Methods with Polyproteins, Pro-Proteins and Proteolysis - Patent application	www.faqs.org	0	0		
631	chrI	6046870	6054901	3500453621	216		6046870	6054901	8421504	8	27,38,13,25,27,28,30,28	0,105,226,514,2835,2905,3473,8003	p,c,g	350045362100000001,350045362100015000,350045362100000004,350045362100000002,350045362100000002,350045362100000000,350045362100000006,350045362100000006,350045362100000005	0-27,0-51,0-25,0-27,0-27,0-28,9-39,9-39,0-28		12810585	10.1242/dev.00551	0950-1991	Development	The Caenorhabditis elegans ems class homeobox gene ceh-2 is required for M3 pharynx motoneuron function	Aspock	2003	7		
631	chrI	6051156	6051238	3500374501	82		6051156	6051238	8421504	1	82	0	c	350037450100000051	0-82						BORON-CONTAINING SMALL MOLECULES - Patent application	www.faqs.org	0	0		
631	chrI	6061913	6061938	3500399960	25		6061913	6061938	8421504	1	25	0	g	350039996000000014	8-33						ScienceDirect.com - Developmental Biology - ARI-1, an RBR family ubiquitin-ligase, functions with UBC-18 to regulate pharyngeal development in C. elegans	sciencedirect.com	0	0		
631	chrI	6064093	6065167	3500379180	82		6064093	6065167	8421504	4	21,20,20,21	0,75,649,1053	c,g	350037918000000018,350037918000000018,350037918000000019,350037918000000019,350037918000000017,350037918000000017,350037918000000016,350037918000000016	0-21,0-21,0-20,0-20,0-20,0-20,0-21,0-21			10.1093/nar/gkh982		Nucleic Acids Research	Evolution of dnmt-2 and mbd-2-like genes in the free-living nematodes Pristionchus pacificus, Caenorhabditis elegans and Caenorhabditis briggsae	Arturo	2004	0		
631	chrI	6069633	6097773	3500144391	45		6069633	6097773	8421504	3	24,14,7	0,28118,28133	c,g	350014439100000226,350014439100001057	9-33,0-21						SPIDER SILK DRAGLINE POLYNUCLEOTIDES, POLYPEPTIDES AND METHODS OF USE THEREOF - Patent application	www.faqs.org	0	0		
631	chrI	6096326	6096349	3500088374	23		6096326	6096349	8421504	1	23	0	c	350008837400000095	12-35						Method For Producing Multiple Unsaturated Fatty Acids In Plants 	.freshpatents.com	0	0		
631	chrI	6102152	6102179	3500409181	23		6102152	6102179	8421504	2	10,13	0,14	c	350040918100000014	0-23						Caax prenyl protease nucleic acids and polypeptides and methods of use thereof	Campbell	2003	0		
631	chrI	6102152	6102179	3500231685	23		6102152	6102179	8421504	2	10,13	0,14	c	350023168500000122	0-23						Stress tolerance and delayed senescence in plants	Mccourt	2004	0		
631	chrI	6102152	6102179	3500010305	23		6102152	6102179	8421504	2	10,13	0,14	c	350001030500000023	0-23						Polynucleotides encoding plant prenyl proteases	Sarria-millan	2007	0		
631	chrI	6135838	6135907	3500450833	58		6135838	6135907	8421504	2	31,27	0,42	c	350045083300000007	7-65						 Secuencias NO relacionadas 	bioinfo2.ugr.es	0	0		
631	chrI	6137539	6137563	3500148414	23		6137539	6137563	8421504	2	8,15	0,9	g	350014841400000603	0-23						Development of novel anti-microbial agents based on bacteriophage genomics	Pelletier	1999	0		
631	chrI	6151072	6151104	3500290538	26		6151072	6151104	8421504	3	8,4,14	0,9,18	g	350029053800001150	3-39						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
632	chrI	6161824	6161849	3500217683	24		6161824	6161849	8421504	2	20,4	0,21	g	350021768300000205,350021768300000181	20-44,20-44						Method Of Preparing Transgenic Organism With Use Of Methylation And System Therefor 	.freshpatents.com	0	0		
632	chrI	6162305	6172699	3500389139	46		6162305	6172699	8421504	2	24,22	0,10372	c,g	350038913900000213,350038913900000147	0-24,22-44						Anti-microrna oligonucleotide molecules	Tuschl	2006	0		
632	chrI	6162305	6172699	3500306561	46		6162305	6172699	8421504	2	24,22	0,10372	c,g	350030656100000212,350030656100000212,350030656100000146	20-44,0-24,0-22						Anti-microRNA oligonucleotide molecules	Landthaler	2011	0		
632	chrI	6162305	6172699	3500257436	46		6162305	6172699	8421504	2	24,22	0,10372	c,g	350025743600000212,350025743600000212,350025743600000146,350025743600000146	20-44,0-24,22-44,0-22						Anti-MicroRna Oligonucleotide Molecules	Tuschl	2007	0		
632	chrI	6162305	6172699	3500232262	46		6162305	6172699	8421504	2	24,22	0,10372	c,g	350023226200000212,350023226200000212,350023226200000146,350023226200000146	20-44,0-24,0-22,0-22					Patent	Anti-microRNA oligonucleotide molecules (Patent US:7772389)	Tuschl	2010	0		
632	chrI	6169580	6169607	3500162197	27		6169580	6169607	8421504	1	27	0	g	350016219700000010	1-37						Phylogenetic analysis of Lymnaeid snails based on 18S rDNA sequences. - ResearchGate	.researchgate.net	0	0		
632	chrI	6172676	6172699	3500417317	23		6172676	6172699	8421504	1	23	0	c	350041731700000000	3-26						RESEARCH ARTICLE Open Access Deep sequencing and genome-wide analysis reveals the expansion of MicroRNA genes in the gall midge Mayetiola destructor	alcommons.unl.edu	0	0		
632	chrI	6181317	6183858	3500234893	1131		6181317	6183858	8421504	7	383,213,207,99,69,91,69	0,1378,1812,2066,2213,2335,2472	p,g	350023489300000014,350023489300000021,350023489300015002	0-1131,0-1131,0-798						Chn-1/Chip-Antagonists For The Treatment Of Muscular Diseases - Patent application	www.faqs.org	0	0		
632	chrI	6181317	6183858	3500119628	1131		6181317	6183858	8421504	7	383,213,207,99,69,91,69	0,1378,1812,2066,2213,2335,2472	p,g	350011962800000014,350011962800015003	0-1131,0-798						Chn-1/Chip-Antagonists For The Treatment Of Muscular Diseases	Baumeister	2005	0		
632	chrI	6181637	6183848	3500433273	40		6181637	6183848	8421504	2	21,19	0,2192	c,g	350043327300000003,350043327300000003,350043327300000002,350043327300000002	0-21,0-21,0-19,0-19			10.1038/ncb1586	1465-7392	Nature Cell Biology	Addenda		2007	19		
632	chrI	6181640	6183849	3500044986	41		6181640	6183849	8421504	2	20,21	0,2188	c,g	350004498600000012,350004498600000012,350004498600000013	2-22,2-22,7-28						Tandem affinity purification of miRNA target mRNAs (TAP-Tar)	cancer.ucsf.edu	0	0		
632	chrI	6183283	6183320	3500334881	28		6183283	6183320	8421504	4	6,5,5,12	0,11,18,25	c	350033488100001501	5-33						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
632	chrI	6183283	6183320	3500231029	28		6183283	6183320	8421504	4	6,5,5,12	0,11,18,25	c	350023102900002170	5-33						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
632	chrI	6183329	6183559	3500461889	40		6183329	6183559	8421504	3	7,13,20	0,54,210	c,g	350046188900000007,350046188900000006,350046188900000006	0-20,0-20,0-20						NeurobiologyofDisease DeletionoftheUbiquitinLigaseCHIPLeadstothe Accumulation,ButNottheAggregation,ofBothEndogenous Phospho-andCaspase-3-CleavedTauSpecies	www.jneurosci.org	0	0		
632	chrI	6183329	6183559	3500265731	40		6183329	6183559	8421504	3	7,13,20	0,54,210	c	350026573100000004,350026573100000003	0-20,0-20		16807328	10.1523/JNEUROSCI.0746-06.2006	0270-6474	The Journal of Neuroscience	Deletion of the Ubiquitin Ligase CHIP Leads to the Accumulation, But Not the Aggregation, of Both Endogenous Phospho- and Caspase-3-Cleaved Tau Species	Dickey	2006	7		
632	chrI	6207186	6207456	3500461285	40		6207186	6207456	8421504	2	20,20	0,250	c,g	350046128500000082,350046128500000083,350046128500000083	0-20,0-20,0-20						KRUPPEL-LIKE FACTORS AND FAT REGULATION - Patent application	www.faqs.org	0	0		
632	chrI	6213155	6213745	3500389346	441		6213155	6213745	8421504	5	8,18,245,93,77	0,9,79,370,513	c	350038934600000000	0-441						Timetable For Acedb 1 Day Introduction And 3 Day Workshop	www.acedb.org	0	0		
632	chrI	6225956	6225982	3500254418	24		6225956	6225982	8421504	2	10,14	0,12	g	350025441800000341	1-25						Lipid Formulated Compositions and Methods for Inhibiting Expression of a Gene from the Ebola Virus	Fougerolles	2010	0		
632	chrI	6225956	6225982	3500122387	24		6225956	6225982	8421504	2	10,14	0,12	g	350012238700000341	1-25						COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF A GENE FROM THE EBOLA - Patent application	www.faqs.org	0	0		
632	chrI	6225956	6225982	3500084894	24		6225956	6225982	8421504	2	10,14	0,12	g	350008489400000341	1-25						Compositions And Methods For Inhibiting Expression Of A Gene From The Ebola Virus - Patent application	www.faqs.org	0	0		
632	chrI	6228402	6228425	3500263427	23		6228402	6228425	8421504	1	23	0	c	350026342700000209,350026342700000333,350026342700000197	14-35,0-20,0-21						<Html><Title> Complet list of 1gtk hssp file Complet list of	cnptia.embrapa.br	0	0		
632	chrI	6242600	6242626	3500073154	23		6242600	6242626	8421504	2	15,8	0,18	c	350007315400000009	1-24						Characterization of ten polymorphic microsatellite markers in Macrolophus pygmaeus	omath.trinity.edu	0	0		
632	chrI	6247531	6247556	3500026001	24		6247531	6247556	8421504	2	8,16	0,9	c	350002600100000077	2-26						US Patent # 6,887,988. Plant reproduction polynucleotides and methods of use - Patents.com	www.patents.com	0	0		
632	chrI	6249487	6252802	3500005288	104		6249487	6252802	8421504	3	21,58,25	0,1059,3290	c,g	350000528800000012,350000528800000013,350000528800000014,350000528800000014,350000528800000015,350000528800000015	0-21,0-26,0-32,0-32,0-25,0-25		14999070	10.1523/JNEUROSCI.5462-03.2004	0270-6474	The Journal of Neuroscience	A Conserved Postsynaptic Transmembrane Protein Affecting Neuromuscular Signaling in Caenorhabditis elegans	Loria	2004	7		
632	chrI	6253447	6253471	3500327760	23		6253447	6253471	8421504	2	11,12	0,12	c	350032776000000017	8-39					Patent	Therapeutic agents comprising pro-apoptotic proteins (Patent CN:1555268)	M*G*Luo Sen Bu Le Mu 	2013	0		
632	chrI	6254271	6254618	3500237513	300		6254271	6254618	8421504	3	37,125,138	0,81,209	p	350023751300015108,350023751300015110	0-162,0-138						50 human secreted proteins	Komatsoulis	2000	0		
633	chrI	6294143	6297408	3500276765	810		6294143	6297408	8421504	13	24,24,32,16,31,113,6,42,96,144,138,96,48	0,1116,1143,1765,1925,2005,2166,2226,2316,2539,2824,3017,3217	c,g	350027676500000006,350027676500000007,350027676500000007,350027676500000221,350027676500000225,350027676500000226,350027676500000227,350027676500000229,350027676500000231,350027676500000232,350027676500000234,350027676500000235,350027676500000235,350027676500000236,350027676500000236,350027676500000239,350027676500000240,350027676500000241,350027676500000242,350027676500000243,350027676500000245	0-24,0-24,0-24,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-42,0-48,0-48,0-48						Products and Methods Related to Mono-Methyl Branched-Chain Fatty Acids - Patent application	www.faqs.org	0	0		
633	chrI	6294143	6295283	3500122490	48		6294143	6295283	8421504	2	24,24	0,1116	c,g	350012249000000007,350012249000000008,350012249000000008	0-24,0-24,0-24			10.1371/journal.pbio.0020257	1545-7885	PLOS Biology	PLOS Biology: Monomethyl Branched-Chain Fatty Acids Play an Essential Role in Caenorhabditis elegans Development	Kniazeva	2004	0		
633	chrI	6294143	6295283	3500038284	48		6294143	6295283	8421504	2	24,24	0,1116	c,g	350003828400000007,350003828400000008,350003828400000008	0-24,0-24,0-24			10.1371/journal.pbio.0020257		PLoS Biology	Monomethyl Branched-Chain Fatty Acids Play an Essential Role in Caenorhabditis elegans Development	Marina	2004	0		
633	chrI	6301484	6301514	3500109093	25		6301484	6301514	8421504	3	8,11,6	0,12,24	g	350010909300000343	4-29						Entwicklung und Evaluierung eines Resistenz- Microarrays für die Detektion von Resistenzdeterminanten in Bakterien aus Kläranlagen	www.lanuv.nrw.de	0	0		
633	chrI	6309465	6309489	3500297500	23		6309465	6309489	8421504	2	11,12	0,12	c	350029750000000255,350029750000001528	1-24,1-24						Marshfield Set 12 Screening	www.cstl.nist.gov	0	0		
633	chrI	6345807	6345838	3500090764	26		6345807	6345838	8421504	3	7,14,5	0,11,26	c	350009076400000016	0-26						Bio.AlignIO.EmbossIO	biopython.org	0	0		
633	chrI	6351509	6352104	3500276014	44		6351509	6352104	8421504	2	22,22	0,573	g	350027601400000005,350027601400000004	0-22,0-22						Chromosome-Wide Regulation of Meiotic Crossover Formation in Caenorhabditis elegans Requires Properly Assembled Chromosome Axes	www.genetics.org	0	0		
633	chrI	6354623	6354651	3500376161	23		6354623	6354651	8421504	3	5,7,11	0,7,17	g	350037616100000013	7-31						Unlocking the Genetic diversity of peanuts wild relatives using 	www.docstoc.com	0	0		
633	chrI	6355415	6355444	3500218436	27		6355415	6355444	8421504	2	17,10	0,19	g	350021843600000065	21-48						<Html><Title> Complet list of 2aqi hssp file Complet list of	cnptia.embrapa.br	0	0		
633	chrI	6370030	6385086	3500393902	81		6370030	6385086	8421504	4	19,22,19,21	0,6633,8656,15035	c,g	350039390200000001,350039390200000001,350039390200000003,350039390200000002,350039390200000002,350039390200000000,350039390200000000	7-26,7-26,8-30,14-33,14-33,0-21,0-21			10.1261/rna.7570804		RNA	Tissue-specific modification of gld-2 mRNA in C. elegans: Likely C-to-U editing	LIAOTENG	2004	0		
633	chrI	6370030	6385086	3500214817	81		6370030	6385086	8421504	4	19,22,19,21	0,6633,8656,15035	c,g	350021481700000001,350021481700000001,350021481700000003,350021481700000002,350021481700000000,350021481700000000	7-26,7-26,8-30,14-33,0-21,0-21		15317977	10.1261/rna.7570804	1355-8382	RNA	Tissue-specific modification of gld-2 mRNA in C. elegans: Likely C-to-U editing	WANG	2004	5		
633	chrI	6395860	6395886	3500290538	25		6395860	6395886	8421504	2	10,15	0,11	g	350029053800001354	1-26						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
633	chrI	6401391	6401414	3500278645	23		6401391	6401414	8421504	1	23	0	g	350027864500000232	8-34						Recombinant vesiculoviruses and their uses		1997	0		
633	chrI	6402194	6405610	3500222690	212		6402194	6405610	8421504	8	21,22,21,42,21,21,21,43	0,2402,2481,2750,2940,2985,3326,3373	c,g	350022269000000002,350022269000000009,350022269000000009,350022269000000011,350022269000000012,350022269000000012,350022269000000015,350022269000000015,350022269000000016,350022269000000017,350022269000000017,350022269000000018,350022269000000018,350022269000000019,350022269000000006,350022269000000006,350022269000000010,350022269000000010,350022269000000003,350022269000000003,350022269000000001,350022269000000001	0-21,0-22,0-22,0-22,0-21,0-21,1-22,1-22,0-21,1-22,1-22,0-21,0-21,1-22,19-40,19-40,0-21,0-21,0-20,0-20,0-20,0-20		19357781	10.1371/journal.pone.0005117		PLoS ONE	CUTI-1: A Novel Tetraspan Protein Involved in C. elegans CUTicle Formation and Epithelial Integrity	Julie-Anne	2009	0		
633	chrI	6407586	6408990	3500081248	168		6407586	6408990	8421504	3	72,75,21	0,1266,1383	p	350008124800015022	258-426						NPG.nature.vol.409.Issue.6822.Feb	www.scribd.com	0	0		
633	chrI	6408310	6408342	3500223858	32		6408310	6408342	8421504	1	32	0	c	350022385800000114	30-63							biomedcentral.com	0	0		
633	chrI	6418587	6418618	3500319585	28		6418587	6418618	8421504	2	6,22	0,9	c	350031958500000247	5-33						<Html><Title> Complet list of 3ckx hssp file Complet list of	cnptia.embrapa.br	0	0		
633	chrI	6418589	6418624	3500036314	30		6418589	6418624	8421504	2	6,24	0,11	c	350003631400000061	0-30						<Html><Title> Complet list of 1umk hssp file Complet list of	cnptia.embrapa.br	0	0		
633	chrI	6418594	6418623	3500405107	26		6418594	6418623	8421504	2	14,12	0,17	c	350040510700000263	18-44						<Html><Title> Complet list of 1epx hssp file Complet list of	cnptia.embrapa.br	0	0		
633	chrI	6418594	6418623	3500394783	26		6418594	6418623	8421504	2	14,12	0,17	c	350039478300000119	8-34						<Html><Title> Complet list of 1dj9 hssp file Complet list of	cnptia.embrapa.br	0	0		
633	chrI	6418594	6418623	3500228395	26		6418594	6418623	8421504	2	14,12	0,17	c	350022839500000251	10-36						<Html><Title> Complet list of 1hxt hssp file Complet list of	cnptia.embrapa.br	0	0		
633	chrI	6418594	6418623	3500114626	26		6418594	6418623	8421504	3	14,7,5	0,16,24	c	350011462600000114	5-31						<Html><Title> Complet list of 1qfj hssp file Complet list of	cnptia.embrapa.br	0	0		
633	chrI	6418594	6418623	3500082768	28		6418594	6418623	8421504	2	14,14	0,15	c	350008276800000116	10-38						<Html><Title> Complet list of 3c5e hssp file Complet list of	cnptia.embrapa.br	0	0		
633	chrI	6418596	6418623	3500304073	27		6418596	6418623	8421504	1	27	0	c	350030407300000293	2-29						<Html><Title> Complet list of 2abm hssp file Complet list of	cnptia.embrapa.br	0	0		
633	chrI	6418596	6418623	3500193112	27		6418596	6418623	8421504	1	27	0	c	350019311200000231	0-27						<Html><Title> Complet list of 1z16 hssp file Complet list of	cnptia.embrapa.br	0	0		
633	chrI	6418597	6418623	3500136829	26		6418597	6418623	8421504	1	26	0	c	350013682900000095	0-26						<Html><Title> Complet list of 1ds4 hssp file Complet list of	cnptia.embrapa.br	0	0		
634	chrI	6456906	6459631	3500034950	69		6456906	6459631	8421504	3	23,22,24	0,1547,2701	c,g	350003495000000003,350003495000000002,350003495000000002,350003495000000001,350003495000000000	4-27,6-27,6-27,8-30,4-28			10.1091/mbc.E05-08-0787		Molecular Biology of the Cell	RAB-10 Is Required for Endocytic Recycling in the Caenorhabditis elegans Intestine	Carlos	2006	0		
634	chrI	6457387	6457829	3500027547	67		6457387	6457829	8421504	4	20,24,17,6	0,21,49,436	c,g	350002754700000005,350002754700000005,350002754700000012,350002754700000012,350002754700000004	0-20,0-20,0-24,0-24,0-23			10.1371/journal.pgen.0010017	1553-7404	PLOS Genetics	PLOS Genetics: New Genes Tied to Endocrine, Metabolic, and Dietary Regulation of Lifespan from a Caenorhabditis elegans Genomic RNAi Screen	Hansen	2005	0		
634	chrI	6457387	6457829	3500010528	67		6457387	6457829	8421504	4	20,24,17,6	0,21,49,436	c,g	350001052800000005,350001052800000005,350001052800000012,350001052800000012,350001052800000004	0-20,0-20,0-24,0-24,0-23			10.1371/journal.pgen.0010017		PLoS Genetics	New Genes Tied to Endocrine, Metabolic, and Dietary Regulation of Lifespan from a Caenorhabditis elegans Genomic RNAi Screen	Malene	July	0		
634	chrI	6457429	6458440	3500207768	40		6457429	6458440	8421504	2	20,20	0,991	c,g	350020776800000003,350020776800000003,350020776800000002,350020776800000002	19-39,19-39,20-40,20-40		20573983	10.1091/mbc.E10-02-0149	1059-1524	Molecular Biology of the Cell	EHBP-1 Functions with RAB-10 during Endocytic Recycling in Caenorhabditis elegans	Shi	2010	5		
634	chrI	6457999	6461758	3500055614	3759		6457999	6461758	8421504	1	3759	0	g	350005561400000000	196-3955						Genomics lecture 3	ww.slideshare.net	0	0		
634	chrI	6461139	6461169	3500316296	25		6461139	6461169	8421504	3	12,7,6	0,14,24	c	350031629600000007	10-35						BMC Plant Biology BioMed Central	biomedcentral.com	0	0		
634	chrI	6463445	6463469	3500241928	23		6463445	6463469	8421504	2	12,11	0,13	c	350024192800000127	10-34						THERAPEUTIC AND DIAGNOSTIC AGENTS CAPABLE OF MODULATING CELLULAR RESPONSIVENESS TO CYTOKINES - THE WALTER AND ELIZA HALL INSTITUTE OF MEDICAL RESEARCH	www.sumobrain.com	0	0		
634	chrI	6470197	6471644	3500004218	40		6470197	6471644	8421504	2	20,20	0,1427	c,g	350000421800000029,350000421800000029,350000421800000028,350000421800000028	0-20,0-20,0-20,0-20		21691303	10.1038/cr.2011.102	1001-0602	Cell Research	mir-35 is involved in intestine cell G1/S transition and germ cell proliferation in C. elegans	Liu	2011	8		
634	chrI	6477339	6508970	3500214872	42		6477339	6508970	8421504	3	22,14,6	0,31610,31625	g	350021487200000639,350021487200000536	4-26,0-20						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
634	chrI	6493298	6493326	3500004484	25		6493298	6493326	8421504	3	7,12,6	0,9,22	c	350000448400000493	18-44						#NEXUS [MacClade 3.01 registered to Brent D. Mishler, Duke University] [**The final matrix GP-COMB	jeps.berkeley.edu	0	0		
634	chrI	6494330	6495896	3500101254	41		6494330	6495896	8421504	2	20,21	0,1545	c,g	350010125400000000,350010125400000000,350010125400000001	12-32,12-32,12-33		16436622	10.1242/dev.02235	0950-1991	Development	URI-1 is required for DNA stability in C. elegans	Parusel	2006	7		
79	chrI	6548944	6577366	3500284394	38		6548944	6577366	8421504	3	19,8,11	0,28401,28411	c	350028439400000407,350028439400000216	2-21,11-30						RNAi INHIBITION OF INFLUENZA VIRUS REPLICATION	Fougerolles	2011	0		
79	chrI	6548944	6577366	3500253796	38		6548944	6577366	8421504	3	19,8,11	0,28401,28411	c	350025379600000407,350025379600000216	2-21,11-30					Patent	Enhancement of influenza gene expression (Patent US:8227188)	Fougerolles	2012	0		
635	chrI	6565704	6565730	3500352612	23		6565704	6565730	8421504	2	13,10	0,16	g	350035261200002172	10-39						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
635	chrI	6572620	6572649	3500295844	24		6572620	6572649	8421504	2	13,11	0,18	g	350029584400000542	8-32						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
635	chrI	6581116	6582098	3500421440	47		6581116	6582098	8421504	2	25,22	0,960	c,g	350042144000000008,350042144000000008,350042144000000009,350042144000000009	0-25,0-25,0-22,0-22			10.1371/journal.pgen.0010037		PLoS Genetics	Genetic Interactions Due to Constitutive and Inducible Gene Regulation Mediated by the Unfolded Protein Response in C. elegans	Xiaohua	2005	0		
635	chrI	6595808	6595838	3500138022	23		6595808	6595838	8421504	3	5,13,5	0,7,25	c,g	350013802200000054,350013802200000054	0-24,0-24						在肥胖型动物下丘脑或肌肉组织中表达的核酸	G*Ke Li Er 	2004	0		
635	chrI	6598551	6598579	3500442304	23		6598551	6598579	8421504	3	5,12,6	0,6,22	c	350044230400000048	6-30						Genes for the synthesis of antipathogenic substances	Ligon	1994	0		
635	chrI	6598551	6598579	3500199929	23		6598551	6598579	8421504	3	5,12,6	0,6,22	c	350019992900000048	6-30						Genes for the synthesis of pyrrolnitrin	Ligon	1996	0		
635	chrI	6640725	6642510	3500420363	993		6640725	6642510	8421504	10	127,53,81,5,70,140,60,230,220,7	0,245,301,388,461,591,776,940,1492,1778	p	350042036300015070,350042036300015067,350042036300015066,350042036300015060,350042036300015054,350042036300015047,350042036300015041	0-180,0-81,0-78,0-147,0-168,0-177,0-162						Jennifer Bohls thesis Final edits July 8	hsl.umaryland.edu	0	0		
635	chrI	6641235	6653191	3500179812	39		6641235	6653191	8421504	5	14,4,1,5,15	0,17,81,11935,11941	c	350017981200000537,350017981200000407	24-43,6-26						水稻常用SSR分子标记_稻田统计爱好者_新浪博客	blog.sina.com.cn	0	0		
635	chrI	6650006	6650041	3500231029	25		6650006	6650041	8421504	3	8,6,11	0,13,24	g	350023102900002071	6-32						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
635	chrI	6651848	6651874	3500344389	23		6651848	6651874	8421504	2	8,15	0,11	g	350034438900000826	20-43						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
635	chrI	6651848	6651874	3500190843	23		6651848	6651874	8421504	2	8,15	0,11	g	350019084300000807	20-43						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
635	chrI	6655270	6655293	3500062653	23		6655270	6655293	8421504	1	23	0	c	350006265300000060	11-34						DELTA 17 DESATURASE AND ITS USE IN MAKING POLYUNSATURATED FATTY ACIDS - Patent application	www.faqs.org	0	0		
635	chrI	6658481	6658507	3500337162	25		6658481	6658507	8421504	2	6,19	0,7	g	350033716200000085	15-43						Mutated 5-enol pyruvylshikimate-3-phosphate synthase, gene coding for said protein and transformed plants containing said gene	Freyssinet	1998	0		
635	chrI	6669210	6669234	3500306261	23		6669210	6669234	8421504	2	8,15	0,9	c	350030626100000595	14-37						<Html><Title> Complet list of 2b6p hssp file Complet list of	cnptia.embrapa.br	0	0		
636	chrI	6709673	6749788	3500344389	69		6709673	6749788	8421504	6	8,12,15,8,8,18	0,13,37342,37361,40084,40097	g	350034438900001105,350034438900000216,350034438900001260	15-35,0-23,21-47						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
636	chrI	6709673	6749788	3500190843	46		6709673	6749788	8421504	4	8,12,8,18	0,13,40084,40097	g	350019084300001105,350019084300001232	15-35,21-47						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
636	chrI	6715472	6715498	3500293879	25		6715472	6715498	8421504	2	6,19	0,7	g	350029387900000071	0-25						Immunostimulatory nucleic acids for inducing IL-10 responses	Krieg	2006	0		
636	chrI	6730060	6733991	3500048166	65		6730060	6733991	8421504	3	21,20,24	0,880,3907	c,g	350004816600000005,350004816600000012,350004816600000012,350004816600000011,350004816600000011,350004816600000004	23-44,0-20,0-20,0-20,0-20,0-24		18498090	10.1002/dvdy.21578	1097-0177	Developmental Dynamics	Differential expression pattern of the four mitochondrial adenine nucleotide transporter ant genes and their roles during the development of Caenorhabditis elegans - Farina - 2008 - Developmental Dynamics - Wiley Online Library	Farina	2008	0		
636	chrI	6774518	6779904	3500154339	151		6774518	6779904	8421504	3	51,50,50	0,2721,5336	c,g	350015433900000051,350015433900000051,350015433900000084,350015433900000055,350015433900000055	0-51,0-51,50-100,50-100,50-100							biomedcentral.com	0	0		
636	chrI	6780298	6783205	3500262760	89		6780298	6783205	8421504	5	20,22,11,13,23	0,2574,2600,2870,2884	c,g	350026276000000012,350026276000000006,350026276000000006,350026276000000008,350026276000000007,350026276000000007	0-20,0-22,0-22,0-24,0-23,0-23			10.1073/pnas.0508989102		Proceedings of the National Academy of Sciences of the United States of America	Negative regulation of nuclear divisions in Caenorhabditis elegans by retinoblastoma and RNA interference-related genes	Alla	2005	0		
636	chrI	6781803	6781875	3500415441	72		6781803	6781875	8421504	1	72	0	c	350041544100000219,350041544100000218,350041544100000237,350041544100000235	0-72,0-70,0-72,0-72						Genomic tRNA Database: Caenorhabditis brenneri (WUGSC 4.0 Jan 2007)	gtrnadb.ucsc.edu	0	0		
636	chrI	6782015	6814331	3500241007	40		6782015	6814331	8421504	4	11,8,15,6	0,16,32290,32310	g	350024100700001676,350024100700001684	30-49,9-31						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
636	chrI	6805099	6805126	3500224134	24		6805099	6805126	8421504	2	12,12	0,15	g	350022413400000017	0-24						<HTML><HEAD><meta http-equiv="Content-Type" content="text/html; charset=ISO-8859-1"><LINK REL="SHORT	.economie.fgov.be	0	0		
636	chrI	6813522	6813550	3500449315	23		6813522	6813550	8421504	2	17,6	0,22	c	350044931500000140	2-28						US Patent # 7,491,698. Mixing and matching TC proteins for pest control - Patents.com	www.patents.com	0	0		
636	chrI	6813522	6813550	3500080694	23		6813522	6813550	8421504	2	17,6	0,22	c	350008069400000117	2-28						MIXING AND MATCHING TC PROTEINS FOR PEST CONTROL - Patent application	www.faqs.org	0	0		
637	chrI	6836648	6837702	3500082346	120		6836648	6837702	8421504	3	57,3,60	0,125,994	p	350008234600015030,350008234600015022	0-60,0-60						INVESTIGATION OF A POSSIBLE MULTI-ENZYME COMPLEX INVOLVED IN NICOTINE BIOSYNTHESIS IN ROOTS OF TOBACCO (Nicotiana tabacum)	cholar.lib.vt.edu	0	0		
637	chrI	6837202	6837280	3500326081	78		6837202	6837280	8421504	1	78	0	p	350032608100015056	0-78						Overview of the Bernoulli Sampler	web.ccv.brown.edu	0	0		
637	chrI	6837202	6837280	3500036433	78		6837202	6837280	8421504	1	78	0	p	350003643300015056	0-78						Overview of the Gibbs Motif Sampler	web.ccv.brown.edu	0	0		
637	chrI	6837630	6837696	3500330850	66		6837630	6837696	8421504	1	66	0	p	350033085000015048	60-126						Massachusetts Institute of Technology Woods Hole Oceanographic Institution	www.dtic.mil	0	0		
637	chrI	6847136	6847302	3500224092	59		6847136	6847302	8421504	3	19,20,20	0,106,146	c,g	350022409200000001,350022409200000001,350022409200000010,350022409200000010,350022409200000000	0-19,0-19,0-20,0-20,0-20			10.1186/1471-2199-6-20	1471-2199	BMC Molecular Biology	Pseudouridine modification in Caenorhabditis elegans spliceosomal snRNAs: unique modifications are found in regions involved in snRNA-snRNA interactions	Patton	2005	3		
637	chrI	6855294	6855426	3500174884	43		6855294	6855426	8421504	2	20,23	0,109	c,g	350017488400000004,350017488400000004,350017488400000005	0-20,0-20,0-23						A Genomewide RNAi Screen for Genes That Affect the Stability, Distribution and Function of P Granules in Caenorhabditis elegans	www.genetics.org	0	0		
637	chrI	6866600	6866627	3500028050	24		6866600	6866627	8421504	3	4,5,15	0,5,12	c	350002805000000509	1-25						Stress response and virulence in Salmonella Typhimurium: a genomics approach	edepot.wur.nl	0	0		
637	chrI	6870690	6870713	3500089489	23		6870690	6870713	8421504	1	23	0	c	350008948900000021	11-34						<HTML><HEAD><meta http-equiv="Content-Type" content="text/html; charset=ISO-8859-1"><LINK REL="SHORT	.economie.fgov.be	0	0		
79	chrI	6920623	6992290	3500330877	66		6920623	6992290	8421504	3	22,22,22	0,33420,71645	g	350033087700000012,350033087700000013,350033087700000001	0-22,0-22,0-22						Genomic sequence of a mutant strain of Caenorhabditis elegans with an altered recombination pattern	biomedcentral.com	0	0		
637	chrI	6926369	6927852	3500261737	80		6926369	6927852	8421504	4	20,20,20,20	0,78,1385,1463	g	350026173700000000,350026173700000002,350026173700000003,350026173700000001	0-20,0-20,0-20,0-20						ナショナルバイオリソースプロジェクト (NBRP) C.elegans Mutants	.shigen.nig.ac.jp	0	0		
637	chrI	6926676	6926700	3500139982	24		6926676	6926700	8421504	1	24	0	c	350013998200000371,350013998200000065	8-32,0-23						ISOPRENOID SYNTHASES - Patent application	www.faqs.org	0	0		
79	chrI	6945287	6954425	3500038735	40		6945287	6954425	8421504	4	5,16,14,5	0,7,9116,9133	g	350003873500000780,350003873500000760	19-41,30-49						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
638	chrI	6974826	6975716	3500139202	61		6974826	6975716	8421504	4	12,8,20,21	0,104,168,869	c,g	350013920200000004,350013920200000020,350013920200000020,350013920200000005,350013920200000005	0-20,0-20,0-20,0-21,0-21						Caenorhabditis elegans stress related gene responses to selected pesticides.	.nottingham.ac.uk	0	0		
638	chrI	6979712	6979739	3500452016	25		6979712	6979739	8421504	3	12,5,8	0,13,19	c	350045201600000001,350045201600000018	9-35,9-35						Rice actin 2 promoter and intron and methods for use thereof	Mcelroy	1999	0		
638	chrI	6979712	6979739	3500448801	25		6979712	6979739	8421504	3	12,5,8	0,13,19	c	350044880100000036,350044880100000001,350044880100000000	9-35,9-35,7-33						US Patent # 6,426,446. Maize RS324 promoter and methods for use thereof - Patents.com	www.patents.com	0	0		
638	chrI	6979712	6979739	3500440708	25		6979712	6979739	8421504	3	12,5,8	0,13,19	c	350044070800000001	9-35						<script type="text/javascript"> if (typeof($) == 'undefined') window.location.pathname = "/p	ww.patentlens.net	0	0		
638	chrI	6979712	6979739	3500439460	25		6979712	6979739	8421504	3	12,5,8	0,13,19	c	350043946000000023,350043946000000001	9-35,9-35						US Patent # 6,747,189. Maize glycine rich protein promoter compositions and methods for use thereof - Patents.com	www.patents.com	0	0		
638	chrI	6979712	6979739	3500424816	25		6979712	6979739	8421504	3	12,5,8	0,13,19	c	350042481600000001,350042481600000037	9-35,9-35						US Patent # 6,437,217. Maize RS81 promoter and methods for use thereof - Patents.com	www.patents.com	0	0		
638	chrI	6979712	6979739	3500417649	25		6979712	6979739	8421504	3	12,5,8	0,13,19	c	350041764900000001	9-35					Patent	Rice actin 2 promoter and intron and methods for use thereof (Patent US:6429357)	McElroy	2002	0		
638	chrI	6979712	6979739	3500322724	25		6979712	6979739	8421504	3	12,5,8	0,13,19	c	350032272400000001	9-35						Maize glycine rich protein promoter and use thereof	Laccetti	2001	0		
638	chrI	6979712	6979739	3500095085	25		6979712	6979739	8421504	3	12,5,8	0,13,19	c	350009508500000001,350009508500000033	9-35,9-35					Patent	Maize A3 promoter and methods for use thereof (Patent US:6583338)	McElroy	2003	0		
638	chrI	6979712	6979739	3500092948	25		6979712	6979739	8421504	3	12,5,8	0,13,19	c	350009294800000001	9-35						US Patent # 6,232,526. Maize A3 promoter and methods for use thereof - Patents.com	www.patents.com	0	0		
638	chrI	6979712	6979739	3500073239	25		6979712	6979739	8421504	3	12,5,8	0,13,19	c	350007323900000035,350007323900000034,350007323900000000,350007323900000001	9-35,9-35,9-35,9-35						US Patent # 6,437,217. Maíz RS81 promotor y métodos para el uso de la misma - Patents.com	es.patents.com	0	0		
638	chrI	6979712	6979739	3500036379	25		6979712	6979739	8421504	3	12,5,8	0,13,19	c	350003637900000001	9-35					Patent	Maize RS81 promoter and methods for use thereof (Patent US:6207879)	McElroy	2001	0		
638	chrI	6979712	6979739	3500035494	25		6979712	6979739	8421504	3	12,5,8	0,13,19	c	350003549400000001	9-35					Patent	Rice actin 2 promoter and intron and methods for use thereof (Patent US:6429357)	McElroy	2002	0		
638	chrI	6979712	6979739	3500031518	25		6979712	6979739	8421504	3	12,5,8	0,13,19	c	350003151800000000,350003151800000001	7-33,9-35					Patent	Maize RS324 promoter and methods for use thereof (Patent US:6426446)	McElroy	2002	0		
638	chrI	6979712	6979739	3500031474	25		6979712	6979739	8421504	3	12,5,8	0,13,19	c	350003147400000001	9-35					Patent	Maize RS81 promoter and methods for use thereof (Patent US:6437217)	McElroy	2002	0		
638	chrI	6992717	6992740	3500380586	23		6992717	6992740	8421504	1	23	0	g	350038058600000307	10-33						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
638	chrI	7009750	7009776	3500322845	24		7009750	7009776	8421504	2	5,19	0,7	c	350032284500000003	4-28						Protein Allergen Derivatives	Westritschnig	2005	0		
638	chrI	7009750	7009775	3500092557	23		7009750	7009775	8421504	2	5,18	0,7	c	350009255700000041	6-29						RECOMBINANT EXPRESSION OF CARBOXYLESTERASES - Patent application	www.faqs.org	0	0		
638	chrI	7009760	7009783	3500186376	23		7009760	7009783	8421504	1	23	0	c	350018637600000005	12-35		11046131	10.1128/MCB.20.22.8343-8351.2000	0270-7306	Molecular and Cellular Biology	Functional Interaction between Ssu72 and the Rpb2 Subunit of RNA Polymerase II in Saccharomyces cerevisiae	Jr.	2000	6		
638	chrI	7009760	7009783	3500039288	23		7009760	7009783	8421504	1	23	0	c	350003928800000005	12-35					Molecular and Cellular Biology	Functional Interaction between Ssu72 and the Rpb2 Subunit of RNA Polymerase II in Saccharomyces cerevisiae	Donald	2000	0		
638	chrI	7010597	7010762	3500342848	165		7010597	7010762	8421504	1	165	0	p	350034284800015006	477-642						The DNA-binding domain of the Chd1 chromatin-remodelling enzyme contains SANT and SLIDE domains. - ResearchGate	.researchgate.net	0	0		
638	chrI	7021980	7028774	3500364041	60		7021980	7028774	8421504	2	30,30	0,6764	c,g	350036404100000000,350036404100000000,350036404100000001,350036404100000001	0-30,0-30,0-30,0-30		19822669	10.1083/jcb.200903024	0021-9525	The Journal of Cell Biology	Ubiquilin and p97/VCP bind erasin, forming a complex involved in ERAD	Lim	2009	10		
638	chrI	7021980	7028774	3500238090	60		7021980	7028774	8421504	2	30,30	0,6764	c,g	350023809000000000,350023809000000000,350023809000000001,350023809000000001	0-30,0-30,0-30,0-30		19822669	10.1083/jcb.200903024		The Journal of Cell Biology	Ubiquilin and p97/VCP bind erasin, forming a complex involved in ERAD	Precious	2009	0		
638	chrI	7062298	7065063	3500427561	2402		7062298	7065063	8421504	4	1101,70,391,840	0,1311,1464,1925	g	350042756100000093,350042756100000094,350042756100000095,350042756100000096,350042756100000097,350042756100000098,350042756100000099,350042756100000100,350042756100000101,350042756100000102,350042756100000103,350042756100000104,350042756100000105,350042756100000106,350042756100000107,350042756100000108,350042756100000112,350042756100000033,350042756100000034,350042756100000035,350042756100000036,350042756100000037,350042756100000038,350042756100000040,350042756100000041,350042756100000042,350042756100000043,350042756100000044,350042756100000045,350042756100000046,350042756100000047,350042756100000048,350042756100000049,350042756100000050,350042756100000051	19-70,0-70,0-70,0-70,0-70,0-70,0-70,0-70,0-70,0-70,0-70,0-70,0-70,0-70,0-70,0-70,0-70,29-70,0-70,0-70,0-70,0-70,0-70,0-70,0-70,0-70,0-70,0-70,0-70,0-70,0-70,0-70,0-70,0-70,0-70						<!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.0 Transitional//EN"> <HTML><HEAD><TITLE>aao!a$?(c)ae(c)ae31/2</	www.tiandz.com	0	0		
639	chrI	7078069	7078096	3500263151	24		7078069	7078096	8421504	2	19,5	0,22	c	350026315100000041	4-28						Method For Detecting Polypeptide Toxic To Diabrotica Insects 	.freshpatents.com	0	0		
639	chrI	7078069	7078096	3500211206	24		7078069	7078096	8421504	2	19,5	0,22	c	350021120600000045	4-28						Coleopteran-toxic Polypeptide Compositions And Insect-resistant Transgenic Plants 	.freshpatents.com	0	0		
639	chrI	7089026	7094414	3500295681	38		7089026	7094414	8421504	4	5,14,5,14	0,8,5367,5374	c,g	350029568100001066,350029568100000060	22-41,20-39						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
639	chrI	7114983	7117806	3500278495	62		7114983	7117806	8421504	3	20,20,22	0,1656,2801	g	350027849500000002,350027849500000006,350027849500000003	0-20,0-20,0-22						Compartmentalized calcium dynamics in a C. elegans interneuron encode head movement	nars.stanford.edu	0	0		
639	chrI	7154192	7155914	3500411134	1365		7154192	7155914	8421504	9	237,69,120,141,297,76,115,98,212	0,249,366,495,642,1034,1161,1319,1510	p	350041113400015037,350041113400015035,350041113400015033,350041113400015031,350041113400015029,350041113400015027,350041113400015025,350041113400015023,350041113400015021,350041113400015019,350041113400015017,350041113400015015,350041113400015013,350041113400015011,350041113400015009,350041113400015007	0-69,0-84,0-84,0-69,0-120,0-72,0-69,0-93,0-90,0-78,0-81,0-108,0-87,0-90,0-84,0-87						Themyosin-I-bindingproteinAcan125bindstheSH3domainand belongstothesuperfamilyofleucine-richrepeatproteins	www.pnas.org	0	0		
639	chrI	7160780	7160804	3500441772	24		7160780	7160804	8421504	1	24	0	g	350044177200000000	0-24		21422230	10.1083/jcb.201012116	0021-9525	The Journal of Cell Biology	MKS and NPHP modules cooperate to establish basal body/transition zone membrane associations and ciliary gate function during ciliogenesis	Williams	2011	10		
639	chrI	7167333	7167359	3500298237	24		7167333	7167359	8421504	3	13,5,6	0,14,20	g	350029823700000165	0-26						Western Alaska Salmon Stock Identification Program	w.adfg.alaska.gov	0	0		
639	chrI	7189914	7189940	3500034124	23		7189914	7189940	8421504	2	8,15	0,11	g	350003412400000004	9-32			10.1046/j.1365-2958.2001.02460.x	1365-2958	Molecular Microbiology	Accumulation of manganese in Neisseria gonorrhoeae correlates with resistance to oxidative killing by superoxide anion and is independent of superoxide dismutase activity - Tseng - 2001 - Molecular Microbiology - Wiley Online Library	Tseng	2001	0		
639	chrI	7190067	7190093	3500164678	24		7190067	7190093	8421504	2	18,6	0,20	c,g	350016467800000025,350016467800000025	16-40,16-40						U.S Animal Genome Mapping Site	.animalgenome.org	0	0		
639	chrI	7191237	7192056	3500422846	51		7191237	7192056	8421504	2	25,26	0,793	c,g	350042284600000017,350042284600000017,350042284600000016,350042284600000016	0-25,0-25,0-26,0-26		14627726	10.1242/dev.00894	0950-1991	Development	HLH-14 is a C. elegans Achaete-Scute protein that promotes neurogenesis through asymmetric cell division	Frank	2003	7		
639	chrI	7191966	7194034	3500326507	113		7191966	7194034	8421504	5	20,24,19,27,23	0,90,1211,1912,2045	c,g	350032650700000000,350032650700000004,350032650700000004,350032650700000002,350032650700000003,350032650700000001	0-20,0-24,0-24,16-35,0-27,17-40						C. elegans HLH-2/E/Daughterless controls key regulatory cells during gonadogenesis	.biochem.wisc.edu	0	0		
639	chrI	7191966	7194034	3500256548	65		7191966	7194034	8421504	3	20,22,23	0,1075,2045	c,g	350025654800000000,350025654800000003,350025654800000001	0-20,27-49,17-40						ScienceDirect.com - Developmental Biology - C. elegans HLH-2/E/Daughterless controls key regulatory cells during gonadogenesis	sciencedirect.com	0	0		
639	chrI	7194021	7194051	3500382736	30		7194021	7194051	8421504	1	30	0	g	350038273600000000	0-30						The basic helix-loop-helix transcription factors LIN-32 and HLH-2 function together in multiple steps of a C. elegansneuronal sublineage	ev.biologists.org	0	0		
639	chrI	7194021	7194051	3500373173	30		7194021	7194051	8421504	1	30	0	g	350037317300000000	0-30						The basic helix-loop-helix transcription factors LIN-32 and HLH-2 function together in multiple steps of a C. elegansneuronal sublineage	orms.aecom.yu.edu	0	0		
640	chrI	7214967	7220948	3500154339	203		7214967	7220948	8421504	4	50,51,51,51	0,1995,3856,5930	c,g	350015433900000079,350015433900000052,350015433900000052,350015433900000056,350015433900000056,350015433900000028	50-100,49-100,49-100,49-100,49-100,0-51							biomedcentral.com	0	0		
640	chrI	7219377	7219504	3500120494	81		7219377	7219504	8421504	2	30,51	0,76	p	350012049400015015	0-81						UNIVERSIDAD DE BARCELONA DEPARTAMENTO DE FISIOLOGAA Programa de FisiologAa. Bienio 2000/01 RECEPT	www.tdx.cat	0	0		
640	chrI	7220449	7220867	3500321879	42		7220449	7220867	8421504	4	9,12,14,7	0,55,323,411	c	350032187900000002,350032187900000003	0-21,0-21		18094048	10.1091/mbc.E07-07-0719	1059-1524	Molecular Biology of the Cell	Polyunsaturated Fatty Acids Influence Synaptojanin Localization to Regulate Synaptic Vesicle Recycling	Marza	2008	5		
640	chrI	7252890	7252915	3500447382	25		7252890	7252915	8421504	1	25	0	c	350044738200000006	9-34					The Journal of Cell Biology	Functional Analysis of Kinetochore Assembly in Caenorhabditis elegans	Karen	June	0		
640	chrI	7253418	7253514	3500081248	96		7253418	7253514	8421504	1	96	0	p	350008124800015023	0-96						NPG.nature.vol.409.Issue.6822.Feb	www.scribd.com	0	0		
640	chrI	7254660	7254685	3500414022	25		7254660	7254685	8421504	1	25	0	c	350041402200000000	25-50		15616189	10.1091/mbc.E04-08-0712	1059-1524	Molecular Biology of the Cell	A Spindle Checkpoint Functions during Mitosis in the Early Caenorhabditis elegans Embryo	Encalada	2005	5		
640	chrI	7281232	7281658	3500141880	94		7281232	7281658	8421504	4	21,25,20,28	0,227,254,398	c,g	350014188000000002,350014188000000002,350014188000000000,350014188000000001,350014188000000003,350014188000000003	0-21,0-21,0-25,0-20,0-28,0-28						Caenorhabditis elegans: Molecular Genetics and Development	www.scribd.com	0	0		
640	chrI	7297686	7297713	3500452501	27		7297686	7297713	8421504	1	27	0	c	350045250100000021	8-35						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
640	chrI	7301911	7302011	3500249133	100		7301911	7302011	8421504	1	100	0	c,g	350024913300000010,350024913300000010,350024913300000032,350024913300000032	0-50,0-50,0-50,0-50							roarrays.ucsd.edu	0	0		
640	chrI	7304925	7327220	3500054618	40		7304925	7327220	8421504	3	7,12,21	0,9,22274	g	350005461800000542,350005461800001071	1-20,1-28						SOYBEAN PLANTS HAVING SUPERIOR AGRONOMIC PERFORMANCE AND METHODS FOR THEIR PRODUCTION - Patent application	www.faqs.org	0	0		
640	chrI	7309014	7309039	3500138755	23		7309014	7309039	8421504	2	14,9	0,16	g	350013875500000007	0-26						Modern and ancient red fox (Vulpes vulpes) in Europe show an unusual lack of geographical and temporal structuring, and differing responses within the carnivores to historical climatic change	biomedcentral.com	0	0		
640	chrI	7310121	7310158	3500165012	27		7310121	7310158	8421504	3	7,13,7	0,12,30	g	350016501200000423,350016501200000427	2-39,3-22						Binding agents which inhibit myostatin	Han	2003	0		
641	chrI	7344579	7344654	3500288106	75		7344579	7344654	8421504	1	75	0	p	350028810600015135	0-75						Duke : SCIENCE 111 : complete notes on Bioinformatics	ww.coursehero.com	0	0		
641	chrI	7344579	7344654	3500204284	75		7344579	7344654	8421504	1	75	0	p	350020428400015135	0-75						17727 Complete Notes on tics	www.scribd.com	0	0		
641	chrI	7344579	7344654	3500185699	75		7344579	7344654	8421504	1	75	0	p	350018569900015153	0-75						Introduction to Bioinformatics	www.koshika.co.in	0	0		
641	chrI	7377294	7383080	3500057008	73		7377294	7383080	8421504	4	24,1,24,24	0,298,790,5762	c,g	350005700800000003,350005700800000004,350005700800000004,350005700800000002,350005700800000002	10-35,10-34,10-34,10-34,10-34		18256289	10.1091/mbc.E07-07-0723	1059-1524	Molecular Biology of the Cell	UNC-98 and UNC-96 Interact with Paramyosin to Promote Its Incorporation into Thick Filaments of Caenorhabditis elegans	Miller	2008	5		
641	chrI	7400556	7400582	3500352435	23		7400556	7400582	8421504	2	10,13	0,13	c	350035243500000013	0-23						NGS Surfer's Wiki | BSMAP 	ovation.nig.ac.jp	0	0		
641	chrI	7402473	7402500	3500225896	25		7402473	7402500	8421504	2	6,19	0,8	c	350022589600000098,350022589600000099	21-45,21-40						Construction Files - OpenWetWare	openwetware.org	0	0		
641	chrI	7403956	7403983	3500105986	25		7403956	7403983	8421504	3	4,17,4	0,5,23	g	350010598600000062	18-43						Cyclin-dependent kinase inhibitors and uses thereof	Inze	2000	0		
641	chrI	7403956	7403983	3500100132	25		7403956	7403983	8421504	3	4,17,4	0,5,23	c,g	350010013200000065,350010013200000065	18-43,18-43						Cyclin-dependent kinase inhibitors and uses thereof - Patent application	www.faqs.org	0	0		
641	chrI	7454405	7456945	3500183228	2539		7454405	7456945	8421504	2	1187,1352	0,1188	p,c,g	350018322800000031,350018322800000000,350018322800015022,350018322800015071,350018322800000001,350018322800000001,350018322800015023,350018322800000002,350018322800000002,350018322800015024,350018322800000003,350018322800000004,350018322800000036,350018322800000037,350018322800000037,350018322800015026,350018322800000005,350018322800000005,350018322800015056,350018322800000038,350018322800000038,350018322800015027,350018322800000006,350018322800000006,350018322800000039,350018322800000039,350018322800015028,350018322800000007,350018322800000007,350018322800015002,350018322800015000,350018322800015029,350018322800000008,350018322800000008,350018322800000041,350018322800000041,350018322800000042,350018322800000009,350018322800015060,350018322800015081,350018322800015030,350018322800000010,350018322800000010,350018322800000044,350018322800015031,350018322800000011,350018322800000011,350018322800000012,350018322800000046,350018322800000013,350018322800000013,350018322800015032,350018322800000047,350018322800000014,350018322800000049,350018322800015033,350018322800000015,350018322800000015,350018322800000050,350018322800015034,350018322800000016,350018322800000016,350018322800000051,350018322800015035,350018322800000017,350018322800000052,350018322800000053,350018322800000053,350018322800000018,350018322800000054,350018322800000019,350018322800015037,350018322800000020,350018322800000020,350018322800015038,350018322800000021,350018322800000021,350018322800000056,350018322800015039,350018322800000022,350018322800000022,350018322800000057,350018322800015003,350018322800015005,350018322800000058,350018322800000058,350018322800015040,350018322800000023,350018322800000023,350018322800015008,350018322800015006,350018322800000059,350018322800000024,350018322800000025,350018322800015041,350018322800000060,350018322800015009,350018322800015012,350018322800015067,350018322800000061,350018322800000061,350018322800000026,350018322800000026,350018322800015042,350018322800015013,350018322800015014,350018322800000027,350018322800000063,350018322800000063,350018322800015070,350018322800000064,350018322800000028,350018322800015018,350018322800015017,350018322800000065,350018322800000065,350018322800000029,350018322800000029,350018322800015045,350018322800000066,350018322800000030,350018322800000067	0-349,0-360,0-57,0-45,0-60,0-60,0-60,0-60,0-60,0-60,0-61,0-360,0-355,0-48,0-48,0-60,0-60,0-60,0-126,0-48,0-48,0-60,0-60,0-60,0-48,0-48,0-60,0-60,0-60,0-48,3-51,0-60,0-60,0-60,0-48,0-48,0-51,0-60,0-210,0-45,0-60,0-60,0-60,0-48,0-60,0-60,0-60,0-60,0-55,0-60,0-60,0-60,0-48,0-60,0-50,0-60,0-60,0-60,0-48,0-60,0-60,0-60,0-48,0-60,0-60,0-48,0-49,0-49,0-60,0-109,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-48,0-60,0-61,0-61,0-48,0-63,0-60,0-48,0-48,0-60,0-60,0-60,0-57,3-60,0-28,0-60,11-60,0-48,0-55,3-57,0-54,0-120,0-48,0-48,0-60,0-60,0-60,3-60,0-57,0-60,0-40,0-40,0-87,0-54,0-60,0-48,3-51,0-48,0-48,0-60,0-60,0-60,0-42,0-138,0-128						SPE-4 peptides	L'hernault	1997	0		
641	chrI	7455662	7456563	3500108603	240		7455662	7456563	8421504	6	48,34,14,48,52,44	0,430,535,597,741,857	p	350010860300015089,350010860300015095,350010860300015097,350010860300015100,350010860300015101	0-48,0-48,0-48,0-48,0-48						IDENTIFICATION OF sel-12 AND USES THEREOF	Greenwald	1997	0		
642	chrI	7486860	7486886	3500292898	23		7486860	7486886	8421504	3	4,13,6	0,5,20	g	350029289800000093	16-39					Patent	Use of multiple recombination sites with unique specificity in recombinational cloning (Patent US:7393632)	Cheo	2008	0		
642	chrI	7486860	7486886	3500199487	23		7486860	7486886	8421504	3	4,13,6	0,5,20	g	350019948700000130	16-39						Use of multiple recombination sites with unique specificity in recombinational cloning	Cheo	2003	0		
642	chrI	7486860	7486886	3500014789	23		7486860	7486886	8421504	3	4,13,6	0,5,20	g	350001478900000124	16-39						Use of multiple recombination sites with unique specificity in recombinational cloning	Cheo	2000	0		
642	chrI	7511817	7511949	3500288106	132		7511817	7511949	8421504	1	132	0	p	350028810600015144	0-132						Duke : SCIENCE 111 : complete notes on Bioinformatics	ww.coursehero.com	0	0		
642	chrI	7511817	7511949	3500204284	132		7511817	7511949	8421504	1	132	0	p	350020428400015144	0-132						17727 Complete Notes on tics	www.scribd.com	0	0		
642	chrI	7511817	7511949	3500185699	132		7511817	7511949	8421504	1	132	0	p	350018569900015162	0-132						Introduction to Bioinformatics	www.koshika.co.in	0	0		
642	chrI	7516298	7522206	3500239130	45		7516298	7522206	8421504	2	22,23	0,5885	g	350023913000000000,350023913000000001	12-34,11-34						National BioResource Project (NBRP)::C.elegans Promoter/Marker	.shigen.nig.ac.jp	0	0		
642	chrI	7522117	7522492	3500390138	47		7522117	7522492	8421504	2	23,24	0,351	g	350039013800000000,350039013800000001	0-23,0-24		22090313	10.1096/fj.11-197798	0892-6638	The FASEB Journal	Light-sensitive coupling of rhodopsin and melanopsin to Gi/o and Gq signal transduction in Caenorhabditis elegans	Cao	2012	6		
642	chrI	7524601	7524628	3500205088	27		7524601	7524628	8421504	1	27	0	c	350020508800000015	10-37						Human G-protein alpha i1 Q204L >KpnI GCTAGCGTTTAAACTTAAGCTTGGTACCACC ATG GGC TGC ACG CTG AGC GCC GAG GAC AAG GCG GCG GTG GAG CGG AGT AAG ATG ATC GAC CGC AAC CTC CGT GAG GAC GGC GAG AAG GCG GCG CGC GAG GTC AAG CTG CTG CTG CTC GGT GCT GGT GAA TCT GGT AAA AG	www.cdna.org	0	0		
642	chrI	7525073	7525096	3500197825	23		7525073	7525096	8421504	1	23	0	c	350019782500000018	18-41						Human G-protein alpha i3 Q204L EE tagged GCTAGCGTTTAAACTTAAGCTTGGTACCACC ATG GGC TGC ACG TTG AGC GCC GAA GAC AAG GCG GCA GTG GAG CGA AGC AAG ATG ATC GAC CGC AAC TTA CGG GAG GAC GGG GAA AAA GCG GCC AAA GAA GTG AAG CTG CTG CTA CTC GGT GCT GGA GAA TCT GGT AA	www.cdna.org	0	0		
642	chrI	7525073	7525096	3500197751	23		7525073	7525096	8421504	1	23	0	c	350019775100000018	18-41						Human G-protein alpha i3 C351I GCTAGCGTTTAAACTTAAGCTTGGTACCACC ATG GGC TGC ACG TTG AGC GCC GAA GAC AAG GCG GCA GTG GAG CGA AGC AAG ATG ATC GAC CGC AAC TTA CGG GAG GAC GGG GAA AAA GCG GCC AAA GAA GTG AAG CTG CTG CTA CTC GGT GCT GGA GAA TCT GGT AAA AGC ACC 	www.cdna.org	0	0		
642	chrI	7528001	7528075	3500447970	26		7528001	7528075	8421504	3	1,14,11	0,45,63	c,g	350044797000000025,350044797000000135,350044797000000135	0-26,0-20,0-20						R-SPONDIN COMPOSITIONS AND METHODS OF USE THEREOF - Patent application	www.faqs.org	0	0		
642	chrI	7528001	7528075	3500402127	26		7528001	7528075	8421504	3	1,14,11	0,45,63	c	350040212700000027	0-26						R-SPONDIN COMPOSITIONS AND METHODS OF USE THEREOF	Christiano	2009	0		
642	chrI	7568101	7570315	3500107072	1610		7568101	7570315	8421504	6	176,194,342,394,349,155	0,527,769,1164,1666,2059	c,g	350010707200000001,350010707200000001	9-1619,9-1619						Levures génétiquement modifiées pour la production de glycoprotéines homogènes	Carre	2009	0		
642	chrI	7583679	7597521	3500344389	50		7583679	7597521	8421504	5	16,6,4,10,14	0,17,13808,13813,13828	g	350034438900000937,350034438900000546	10-32,0-36						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
642	chrI	7588201	7588345	3500213444	117		7588201	7588345	8421504	2	51,66	0,78	p	350021344400015002,350021344400015001	0-51,0-66		22829772	10.1371/journal.pgen.1002702	1553-7404	PLOS Genetics	PLOS Genetics: Differential Impact of the HEN1 Homolog HENN-1 on 21U and 26G RNAs in the Germline of Caenorhabditis elegans	Kamminga	2012	0		
642	chrI	7588303	7588357	3500458391	54		7588303	7588357	8421504	1	54	0	p	350045839100015004	0-54						A Conserved Upstream Motif Orchestrates Autonomous, Germline-Enriched Expression of Caenorhabditis elegans piRNAs. - ResearchGate	.researchgate.net	0	0		
643	chrI	7611879	7616968	3500318056	65		7611879	7616968	8421504	3	21,22,22	0,2352,5067	c,g	350031805600000012,350031805600000013,350031805600000009,350031805600000009	10-31,10-32,0-22,0-22						Proteomic Changes during Disturbance of Cholesterol Metabolism by Azacoprostane Treatment in Caenorhabditis elegans	www.ars.usda.gov	0	0		
643	chrI	7611879	7616968	3500221587	65		7611879	7616968	8421504	3	21,22,22	0,2352,5067	c,g	350022158700000012,350022158700000013,350022158700000009,350022158700000009	10-31,10-32,0-22,0-22		12904448	10.1074/mcp.M300036-MCP200	1535-9476	Molecular & Cellular Proteomics	Proteomic Changes during Disturbance of Cholesterol Metabolism by Azacoprostane Treatment in Caenorhabditis elegans	Choi	2003	7		
643	chrI	7613099	7621035	3500352303	44		7613099	7621035	8421504	4	15,6,4,19	0,16,7912,7917	c,g	350035230300000898,350035230300000818	16-37,13-36						Anti-bacterial methods and materials	Holden	2000	0		
643	chrI	7621011	7621035	3500003185	23		7621011	7621035	8421504	2	4,19	0,5	c	350000318500000836	13-36						Anti-bacterial methods and materials	Holden	2000	0		
643	chrI	7655237	7655994	3500073297	44		7655237	7655994	8421504	2	22,22	0,735	c,g	350007329700000000,350007329700000000,350007329700000001,350007329700000001	0-22,0-22,0-22,0-22						EGO-1 is related to RNA-directed RNA polymerase and functions in germ-line development and RNA interference in C. elegans Anne Smardon*, Jill M. Spoerke* , Steven C. Stacey , Marcia E. Klein Nancy Mackin and Eleanor M. Maine	biology.syr.edu	0	0		
643	chrI	7655237	7655994	3500054321	44		7655237	7655994	8421504	2	22,22	0,735	c,g	350005432100000000,350005432100000000,350005432100000001,350005432100000001	0-22,0-22,0-22,0-22						EGO-1 is related to RNA-directed RNA polymerase and functions in germ-line development and RNA interference in C. elegans Anne Smardon*, Jill M. Spoerke* , Steven C. Stacey , Marcia E. Klein Nancy Mackin and Eleanor M. Maine	sciencedirect.com	0	0		
643	chrI	7660829	7708036	3500105817	43		7660829	7708036	8421504	4	7,13,17,6	0,10,47181,47201	g	350010581700000385,350010581700000633	23-43,14-37							www.ars.usda.gov	0	0		
643	chrI	7675513	7675536	3500046125	23		7675513	7675536	8421504	1	23	0	c	350004612500000023	0-23						MUTANT ENZYMES - ISIS INNOVATION LIMITED	www.sumobrain.com	0	0		
643	chrI	7685455	7685488	3500258078	30		7685455	7685488	8421504	2	8,22	0,11	g	350025807800000079	14-44						Nematode PAN and ZP Receptor-Like Sequences - Patent application	www.faqs.org	0	0		
643	chrI	7695747	7697934	3500004218	132		7695747	7697934	8421504	8	20,1,19,19,20,20,16,17	0,901,950,1050,1280,1628,2148,2170	c,g	350000421800000034,350000421800000040,350000421800000041,350000421800000041,350000421800000049,350000421800000049,350000421800000035,350000421800000050	0-20,0-20,0-19,0-19,9-29,9-29,0-20,0-39		21691303	10.1038/cr.2011.102	1001-0602	Cell Research	mir-35 is involved in intestine cell G1/S transition and germ cell proliferation in C. elegans	Liu	2011	8		
643	chrI	7697463	7697491	3500121022	28		7697463	7697491	8421504	1	28	0	g	350012102200000000	0-28						A family of poly(U) polymerases	.biochem.wisc.edu	0	0		
643	chrI	7698107	7698139	3500172525	25		7698107	7698139	8421504	3	14,5,6	0,17,26	g	350017252500000014	9-34							ultry.mph.msu.edu	0	0		
643	chrI	7705435	7705964	3500231920	23		7705435	7705964	8421504	2	21,2	0,527	c	350023192000000772	2-47						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
643	chrI	7708813	7708843	3500414846	25		7708813	7708843	8421504	3	5,6,14	0,7,16	g	350041484600002756	8-34						Rank Transcription unit Names NtcA site Downstream of ntcA site Position of ntcA site Score -10 like	coitweb.uncc.edu	0	0		
643	chrI	7718893	7718922	3500344270	29		7718893	7718922	8421504	1	29	0	g	350034427000000935	0-29						@IL23_3198:2:1:0:199/1 NCGGAACCGGGCGGAAACACCATCGTATGCCGTCTTC + &0;;;;:9:;:7;;;;;;;;;;;;;;;;;;;;;;;:8	rse.iop.kcl.ac.uk	0	0		
643	chrI	7724125	7724149	3500291711	23		7724125	7724149	8421504	2	4,19	0,5	c	350029171100000172,350029171100000234	0-23,0-23						Cellular Immunostimulation by CpG-Sequence- Coated DNA Origami Structures	doc.rero.ch	0	0		
644	chrI	7766883	7767849	3500255853	354		7766883	7767849	8421504	3	76,209,69	0,643,897	p	350025585300015031,350025585300015029	0-177,0-177						Planaria EST Database	an.bio.keio.ac.jp	0	0		
644	chrI	7768472	7768497	3500300591	23		7768472	7768497	8421504	2	8,15	0,10	c	350030059100000319	20-43						Novel Plant Acyltransferases Specific For Long-Chained, Multiply Unsaturated Fatty Acids - Patent application	www.faqs.org	0	0		
644	chrI	7769501	7769530	3500443211	25		7769501	7769530	8421504	3	8,13,4	0,11,25	c	350044321100000312	7-32						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
644	chrI	7770211	7777572	3500100641	100		7770211	7777572	8421504	4	26,25,24,25	0,3217,3928,7336	g	350010064100000003,350010064100000000,350010064100000004,350010064100000001	8-34,0-25,8-32,0-25						RNA editing by ADARs is important for normal behavior in Caenorhabditis elegans - Keeping the Faith	pthefaith1296.com	0	0		
644	chrI	7773432	7777572	3500329758	46		7773432	7777572	8421504	2	21,25	0,4115	c,g	350032975800000000,350032975800000001	4-25,0-25			10.1093/emboj/cdf607		The EMBO Journal	RNA editing by ADARs is important for normal behavior in Caenorhabditis elegans	Leath	2002	0		
644	chrI	7781446	7781474	3500062615	28		7781446	7781474	8421504	1	28	0	c	350006261500000034,350006261500000017	0-22,0-20						杂交方法	Bo Mu Jing Qian Ya Zi 	2007	0		
644	chrI	7781447	7781474	3500197241	27		7781447	7781474	8421504	1	27	0	c	350019724100000002	0-27						Pyrrolnitrin biosynthesis genes and uses thereof	Ligon	1998	0		SOX11
644	chrI	7781448	7781475	3500275493	27		7781448	7781475	8421504	1	27	0	c	350027549300000027	0-27						SOMMAIRE DU COURS	bio-fsa.uiz.ac.ma	0	0		SOX11
644	chrI	7788570	7788596	3500004951	23		7788570	7788596	8421504	3	7,4,12	0,9,14	g	350000495100000463	10-34						Transcriptional Regulator 	.freshpatents.com	0	0		
644	chrI	7794725	7821986	3500413391	41		7794725	7821986	8421504	4	12,9,10,10	0,14,27238,27251	g	350041339100000383,350041339100000476	23-44,0-20							.cottonmarker.org	0	0		
644	chrI	7801166	7801615	3500197656	102		7801166	7801615	8421504	3	45,19,38	0,51,411	p	350019765600015080,350019765600015083	0-45,0-57						Karakterisatie van neuromedine U-, tachykinine- en GnRH-verwante receptoren	w.scriptiebank.be	0	0		
644	chrI	7804370	7804393	3500251056	23		7804370	7804393	8421504	1	23	0	g	350025105600000008	18-41						C. elegans Inositol 5- Phosphatase Homologue Negatively Regulates Inositol 1,4,5- triphosphate Signaling in Ovulation Yen Kim Bui and Paul W. Sternberg	brary.caltech.edu	0	0		
644	chrI	7819758	7819833	3500291156	24		7819758	7819833	8421504	3	5,15,4	0,55,71	c	350029115600000545	6-30						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
644	chrI	7855217	7856916	3500198138	44		7855217	7856916	8421504	2	21,23	0,1676	c,g	350019813800000000,350019813800000001,350019813800000001	0-21,0-23,0-23		22323726	10.1523/JNEUROSCI.2606-11.2012	0270-6474	The Journal of Neuroscience	Functional Analysis of VPS41-Mediated Neuroprotection in Caenorhabditis elegans and Mammalian Models of Parkinson's Disease	Harrington	2012	7		
645	chrI	7871095	7871559	3500221587	44		7871095	7871559	8421504	2	23,21	0,443	c,g	350022158700000000,350022158700000001,350022158700000001	0-23,0-21,0-21		12904448	10.1074/mcp.M300036-MCP200	1535-9476	Molecular & Cellular Proteomics	Proteomic Changes during Disturbance of Cholesterol Metabolism by Azacoprostane Treatment in Caenorhabditis elegans	Choi	2003	7		
645	chrI	7871221	7871361	3500249133	100		7871221	7871361	8421504	2	50,50	0,90	c,g	350024913300000021,350024913300000021,350024913300000022,350024913300000022	0-50,0-50,0-50,0-50							roarrays.ucsd.edu	0	0		
645	chrI	7871923	7871949	3500251711	23		7871923	7871949	8421504	2	8,15	0,11	c	350025171100000176	2-25						<Html><Title> Complet list of 1ea9 hssp file Complet list of	cnptia.embrapa.br	0	0		
645	chrI	7871924	7871948	3500322237	23		7871924	7871948	8421504	2	9,14	0,10	c	350032223700000125	19-42						<Html><Title> Complet list of 1rz1 hssp file Complet list of	cnptia.embrapa.br	0	0		
645	chrI	7882345	7882370	3500003185	24		7882345	7882370	8421504	2	19,5	0,20	g	350000318500000509	18-42						Anti-bacterial methods and materials	Holden	2000	0		
645	chrI	7893507	7893532	3500165012	23		7893507	7893532	8421504	2	18,5	0,20	c,g	350016501200000222,350016501200000222	0-23,0-23						Binding agents which inhibit myostatin	Han	2003	0		
645	chrI	7894374	7894579	3500271198	23		7894374	7894579	8421504	3	3,8,12	0,184,193	c	350027119800000423	14-37						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
645	chrI	7899037	7903232	3500375571	45		7899037	7903232	8421504	2	21,24	0,4171	c,g	350037557100000002,350037557100000002,350037557100000000	0-21,0-21,0-24		9852581		0270-6474	The Journal of Neuroscience	UNC-55, an Orphan Nuclear Hormone Receptor, Orchestrates Synaptic Specificity among Two Classes of Motor Neurons in Caenorhabditis elegans	Zhou	1998	7		
645	chrI	7922056	7922095	3500121931	39		7922056	7922095	8421504	1	39	0	g	350012193100000042	0-39						Supporting Online Material for	mcb.berkeley.edu	0	0		
645	chrI	7923009	7923939	3500310552	38		7923009	7923939	8421504	2	19,19	0,911	c,g	350031055200000007,350031055200000007,350031055200000006,350031055200000006	0-19,0-19,0-19,0-19		17437990	10.1101/gad.417707	0890-9369	Genes & Development	Mechanistic insights and identification of two novel factors in the C. elegans NMD pathway	Longman	2007	12		
645	chrI	7923009	7923939	3500200723	38		7923009	7923939	8421504	2	19,19	0,911	c,g	350020072300000007,350020072300000007,350020072300000006,350020072300000006	0-19,0-19,0-19,0-19						Mechanistic insights and identification of two novel factors in the C. elegans NMD pathway--《基因进展》医学期刊--医学期刊频道--首席医学	journal.9med.net	0	0		
645	chrI	7929119	7930318	3500349653	41		7929119	7930318	8421504	2	20,21	0,1178	c,g	350034965300000001,350034965300000001,350034965300000000	19-39,19-39,18-39		21730185	10.1073/pnas.1101853108	0027-8424	Proceedings of the National Academy of Sciences	Hydrodynamic property of the cytoplasm is sufficient to mediate cytoplasmic streaming in the Caenorhabiditis elegans embryo	Niwayama	2011	10		
645	chrI	7933298	7934535	3500274310	40		7933298	7934535	8421504	4	15,5,13,7	0,18,1212,1230	c	350027431000000506,350027431000000659	13-33,14-34						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
645	chrI	7936740	7941146	3500194867	194		7936740	7941146	8421504	9	20,20,20,25,23,26,20,20,20	0,77,886,928,1253,1711,1973,3790,4386	c,g	350019486700000011,350019486700000011,350019486700000012,350019486700000012,350019486700000017,350019486700000017,350019486700000009,350019486700000009,350019486700000001,350019486700000001,350019486700000004,350019486700000003,350019486700000000,350019486700000000,350019486700000018,350019486700000018,350019486700000008,350019486700000007,350019486700000007	0-20,0-20,0-20,0-20,0-20,0-20,19-40,19-40,9-33,9-33,0-23,0-23,10-36,10-36,0-20,0-20,0-20,0-20,0-20						An N-Myristoylated Globin with a Redox-Sensing Function That Regulates the Defecation Cycle in Caenorhabditis elegans. - ResearchGate	.researchgate.net	0	0		
645	chrI	7952592	7952618	3500326993	23		7952592	7952618	8421504	2	15,8	0,18	g	350032699300000267	24-48						Nucleic Acid, Polypeptide and Its Use - Patent application	www.faqs.org	0	0		
645	chrI	7954799	7954827	3500149393	23		7954799	7954827	8421504	3	7,12,4	0,11,24	g	350014939300000126	14-37					Patent	Bacillus thuringiensis bacteria (Patent US:5854053)	Donovan	1998	0		
645	chrI	7962373	7971833	3500366806	67		7962373	7971833	8421504	5	11,15,19,10,12	0,14,4469,9437,9448	c	350036680600002594,350036680600002033,350036680600001273,350036680600001915,350036680600000549,350036680600001066	0-26,12-36,11-35,10-34,4-23,8-30						<HTML> <TITLE>BLAST Search Results  BLAST Search Results  BLAST Search Results  BLAST Search Results  BLAST Search Results  Complet list of 1c7j hssp file Complet list of	cnptia.embrapa.br	0	0		
646	chrI	8059712	8059739	3500409013	25		8059712	8059739	8421504	2	7,18	0,9	c	350040901300000426	1-26						<Html><Title> Complet list of 1q6y hssp file Complet list of	cnptia.embrapa.br	0	0		
646	chrI	8076398	8076422	3500311219	23		8076398	8076422	8421504	2	19,4	0,20	c,g	350031121900000033,350031121900000033	6-29,6-29						Complementary DNA's encoding proteins with signal peptides	Edwards	2000	0		
646	chrI	8081601	8081625	3500008284	24		8081601	8081625	8421504	1	24	0	c,g	350000828400000003,350000828400000003	0-24,0-24		19158391	10.1091/mbc.E08-08-0837	1059-1524	Molecular Biology of the Cell	Caveolin-2 Is Required for Apical Lipid Trafficking and Suppresses Basolateral Recycling Defects in the Intestine of Caenorhabditis elegans	Parker	2009	5		
646	chrI	8103600	8108934	3500428898	3693		8103600	8108934	8421504	8	321,159,582,132,257,1367,662,213	0,364,763,1402,2170,2529,3991,5121	p	350042889800015024,350042889800015026,350042889800015028,350042889800015029,350042889800015030,350042889800015031,350042889800015032,350042889800015048,350042889800015050,350042889800015034,350042889800015052,350042889800015035,350042889800015036,350042889800015037,350042889800015039,350042889800015041,350042889800015044,350042889800015046	0-240,0-240,0-240,0-240,0-240,0-240,0-240,0-243,0-246,0-240,0-234,0-240,0-240,0-240,0-240,0-240,0-240,0-93						Two suppressors of sel-12encode C H zinc-finger proteins that regulate presenilin transcription in Caenorhabditis elegans	ev.biologists.org	0	0		
646	chrI	8103600	8105120	3500400572	48		8103600	8105120	8421504	2	22,26	0,1494	c,g	350040057200000002,350040057200000002,350040057200000003,350040057200000003	0-22,0-22,0-26,0-26						ScienceDirect.com - Developmental Biology - lin-35/Rb and the CoREST ortholog spr-1 coordinately regulate vulval morphogenesis and gonad development in C. elegans	sciencedirect.com	0	0		
646	chrI	8119176	8119202	3500359768	25		8119176	8119202	8421504	2	7,18	0,8	c	350035976800000004	19-44						Clues of Sexual Reproduction in the 'Ancient Asexual' Fungal Lineage: the Arbuscular Mycorrhizal Fungi	w.ruor.uottawa.ca	0	0		
647	chrI	8147421	8149646	3500226123	432		8147421	8149646	8421504	3	157,105,170	0,1491,2055	p,c,g	350022612300000009,350022612300015013,350022612300000010,350022612300015001,350022612300015014,350022612300000011,350022612300015002,350022612300000025,350022612300000025,350022612300000000,350022612300000000,350022612300000012,350022612300000026,350022612300000026,350022612300000001,350022612300000001,350022612300015003,350022612300015016,350022612300000013,350022612300015004,350022612300015017,350022612300000014,350022612300015005,350022612300000028,350022612300000028,350022612300000027,350022612300000027,350022612300000015,350022612300000016	0-111,0-45,0-48,0-45,0-45,0-48,0-45,0-20,0-20,0-20,0-20,0-48,0-20,0-20,0-20,0-20,0-45,0-45,0-48,0-45,0-45,0-48,0-45,0-20,0-20,0-20,0-20,0-56,0-25						インスリン様ペプチド - サントリー株式会社	www.patentjp.com	0	0		
647	chrI	8147500	8149578	3500427656	42		8147500	8149578	8421504	2	19,23	0,2055	c,g	350042765600000002,350042765600000002,350042765600000003,350042765600000003	0-19,0-19,0-23,0-23		23700438	10.1371/journal.pone.0063851	1932-6203	PLOS ONE	PLOS ONE: Insulin/IGF-1 Signaling, including Class II/III PI3Ks, β-Arrestin and SGK-1, Is Required in C. elegans to Maintain Pharyngeal Muscle Performance during Starvation	Dwyer	2013	4		
647	chrI	8148912	8149517	3500412964	41		8148912	8149517	8421504	2	20,21	0,584	c,g	350041296400000004,350041296400000004,350041296400000005	0-20,0-20,0-21						APotentialBiochemicalMechanismUnderlyingtheInfluence ofSterolDeprivationStresson Caenorhabditiselegans Longevity S	www.ars.usda.gov	0	0		
647	chrI	8166279	8166305	3500279900	23		8166279	8166305	8421504	2	12,11	0,15	g	350027990000000039	0-33						-Dioxygenase aus Erbsen	.uni-wuerzburg.de	0	0		
647	chrI	8173945	8173971	3500028990	26		8173945	8173971	8421504	1	26	0	g	350002899000000050	88-114						<!DOCTYPE HTML PUBLIC i3/4-//IETF//DTD HTML 3.0//ENi3/4> <!-- dem 31may04, changed Penner to Somers a	wheat.pw.usda.gov	0	0		
647	chrI	8243788	8243976	3500223858	63		8243788	8243976	8421504	6	5,11,10,13,9,15	0,7,36,109,143,173	g	350022385800000130	83-173							biomedcentral.com	0	0		
647	chrI	8245889	8245916	3500199170	24		8245889	8245916	8421504	2	11,13	0,14	c	350019917000000182	9-33							biomedcentral.com	0	0		
648	chrI	8270546	8270571	3500247786	24		8270546	8270571	8421504	2	16,8	0,17	g	350024778600000010	6-30						Systems and methods for production of mixed fatty esters	Hu	2010	0		
648	chrI	8270546	8270571	3500080197	24		8270546	8270571	8421504	2	16,8	0,17	g	350008019700000016	6-30						Production of fatty acid derivatives	Gaertner	2010	0		
648	chrI	8287686	8287715	3500234853	24		8287686	8287715	8421504	3	11,8,5	0,14,24	c	350023485300000007	9-33						dsRNA For Treating Viral Infection - Patent application	www.faqs.org	0	0		
648	chrI	8287686	8287715	3500225311	24		8287686	8287715	8421504	3	11,8,5	0,14,24	c	350022531100000007	9-33						dsRNA For Treating Viral Infection - Patent application	www.faqs.org	0	0		
648	chrI	8290302	8290330	3500450214	24		8290302	8290330	8421504	3	4,6,14	0,5,14	c	350045021400000012	10-38						CARACTERIZAÇÃO DE ACESSOS DE BANANEIRA	v.web697.uni5.net	0	0		
648	chrI	8290302	8290330	3500195598	24		8290302	8290330	8421504	3	4,6,14	0,5,14	c	350019559800000014	10-38						154 CARACTERIZAÇÃO AGRONÔMICA E MOLECULAR DE GENÓTIPOS DIPLÓIDES MELHORADOS DE BANANEIRA 1	www.scielo.br	0	0		
648	chrI	8291418	8328549	3500136159	82		8291418	8328549	8421504	4	20,22,20,20	0,152,36980,37111	c,g	350013615900000003,350013615900000003,350013615900000002,350013615900000002,350013615900000024,350013615900000024,350013615900000025,350013615900000025	0-20,0-20,0-22,0-22,0-20,0-20,0-20,0-20						Supporting Information	www.pnas.org	0	0		
648	chrI	8326812	8328694	3500301578	50		8326812	8328694	8421504	2	24,26	0,1856	g	350030157800000000	0-50						ScienceDirect.com - Cancer Cell - Chemical genetics identifies Rab geranylgeranyl transferase as an apoptotic target of farnesyl transferase inhibitors	sciencedirect.com	0	0		
648	chrI	8327565	8327589	3500105743	23		8327565	8327589	8421504	2	10,13	0,11	c	350010574300000027,350010574300000028	10-33,10-33						Interaction of the Dosage Compensation Complex with DNA	b.uni-muenchen.de	0	0		
648	chrI	8379125	8387806	3500297314	140		8379125	8387806	8421504	7	25,19,27,2,18,27,22	0,217,5848,7498,7675,8605,8659	c,g	350029731400000002,350029731400000000,350029731400000006,350029731400000006,350029731400000007,350029731400000005,350029731400000001	0-25,0-19,0-27,0-27,0-20,0-27,0-22						Dual excitatory and inhibitory serotonergic inputs modulate egg-laying in	www.genetics.org	0	0		
648	chrI	8384234	8384261	3500009992	25		8384234	8384261	8421504	2	5,20	0,7	g	350000999200000055	22-47						Assays and reagents for identifying anti-fungal agents, and uses related thereto	Berlin	1998	0		
649	chrI	8407648	8410792	3500237136	57		8407648	8410792	8421504	2	28,29	0,3115	c,g	350023713600000006,350023713600000005,350023713600000005	0-28,0-29,0-29		19155321	10.1261/rna.1258309		RNA	Uncoupling of lin-14 mRNA and protein repression by nutrient deprivation in Caenorhabditis elegans	Janette	2009	0		
649	chrI	8407648	8410792	3500162138	57		8407648	8410792	8421504	2	28,29	0,3115	c,g	350016213800000006,350016213800000005,350016213800000005	0-28,0-29,0-29		19155321	10.1261/rna.1258309	1355-8382	RNA	Uncoupling of lin-14 mRNA and protein repression by nutrient deprivation in Caenorhabditis elegans	Holtz	2009	5		
649	chrI	8407788	8409793	3500063107	110		8407788	8409793	8421504	2	55,55	0,1950	g	350006310700000006,350006310700000007,350006310700000005	0-55,0-55,0-55		19336450	10.1101/gr.089367.108	1088-9051	Genome Research	New class of microRNA targets containing simultaneous 5′-UTR and 3′-UTR interaction sites	Lee	2009	14		
649	chrI	8407788	8409793	3500052900	110		8407788	8409793	8421504	2	55,55	0,1950	g	350005290000000006,350005290000000005,350005290000000007	0-55,0-55,0-55		19336450	10.1101/gr.089367.108	1088-9051	Genome Research	New class of microRNA targets containing simultaneous 5′-UTR and 3′-UTR interaction sites	Lee	2009	14		
649	chrI	8407801	8407841	3500289693	40		8407801	8407841	8421504	1	40	0	g	350028969300000041,350028969300000043,350028969300000042	0-40,1-35,1-32						5’ binding in Red color (shadow in green)	www.nature.com	0	0		
649	chrI	8407827	8407854	3500196545	27		8407827	8407854	8421504	1	27	0	g	350019654500000001	0-27		20700435	10.1371/journal.pgen.1001054		PLoS Genetics	A Developmental Timing Switch Promotes Axon Outgrowth Independent of Known Guidance Receptors	Katherine	2010	0		
649	chrI	8408416	8409206	3500369112	40		8408416	8409206	8421504	2	20,20	0,770	c,g	350036911200000001,350036911200000001,350036911200000000,350036911200000000	0-20,0-20,0-20,0-20		21471153	10.1242/dev.057109	0950-1991	Development	The zinc-finger protein SEA-2 regulates larval developmental timing and adult lifespan in C. elegans	Huang	2011	7		
649	chrI	8409150	8409314	3500355728	42		8409150	8409314	8421504	2	22,20	0,144	c,g	350035572800000002,350035572800000002,350035572800000001,350035572800000001	0-22,0-22,0-20,0-20						Les courts ARN chez C. elegans : spécificité et fonction des protéines Argonautes	de.bibl.ulaval.ca	0	0		
649	chrI	8413434	8413462	3500403377	23		8413434	8413462	8421504	2	7,16	0,12	g	350040337700000032	5-28						Biochimica et Biophysica Acta (BBA)- Gene Structure and Expression	005.pasteur.ac.ir	0	0		
649	chrI	8421999	8422024	3500149404	23		8421999	8422024	8421504	2	7,16	0,9	c	350014940400000095	12-35						Use Of Stomatin (STM1) Polynucleotides For Achieving A Pathogen Resistance In Plants - Patent application	www.faqs.org	0	0		
649	chrI	8432611	8435848	3500297005	42		8432611	8435848	8421504	2	20,22	0,3215	c,g	350029700500000000,350029700500000000,350029700500000001	0-20,0-20,0-22		21839827	10.1016/j.freeradbiomed.2011.07.020		Free Radical Biology & Medicine	Increased life span from overexpression of superoxide dismutase in Caenorhabditis elegans is not caused by decreased oxidative damage	Filipe	2011	0		
649	chrI	8434552	8434748	3500121723	57		8434552	8434748	8421504	3	30,14,13	0,36,183	p	350012172300015006	54-111						Characterization of the manganese superoxide dismutase cDNA and gene from the human parasite Onchocerca volvulus. - ResearchGate	.researchgate.net	0	0		
649	chrI	8434757	8435447	3500398350	40		8434757	8435447	8421504	2	20,20	0,670	c,g	350039835000000000,350039835000000000,350039835000000001,350039835000000001	0-20,0-20,0-20,0-20						ScienceDirect.com - Experimental Gerontology - Modulation of longevity and diapause by redox regulation mechanisms under the insulin-like signaling control in Caenorhabditis elegans	sciencedirect.com	0	0		
649	chrI	8467855	8467882	3500128414	23		8467855	8467882	8421504	2	10,13	0,14	g	350012841400000055	1-24						Recombinant restriction enzyme Sau3AI	Gotz	1991	0		
649	chrI	8491443	8491537	3500196738	45		8491443	8491537	8421504	2	42,3	0,91	p	350019673800015006	0-45						Methods and compositions for regulating cell cycle progression	Bernstein	2001	0		
650	chrI	8523330	8523357	3500168119	23		8523330	8523357	8421504	2	7,16	0,11	g	350016811900000495	1-24						<Html><Title> Complet list of 2yvg hssp file Complet list of	cnptia.embrapa.br	0	0		
650	chrI	8529473	8531848	3500270851	243		8529473	8531848	8421504	9	56,21,23,22,28,21,24,21,27	0,338,508,552,1083,1782,1814,2094,2348	c,g	350027085100000023,350027085100000023,350027085100000015,350027085100000015,350027085100000017,350027085100000017,350027085100000009,350027085100000016,350027085100000016,350027085100000014,350027085100000014,350027085100000001,350027085100000007,350027085100000007,350027085100000022,350027085100000011,350027085100000000,350027085100000000	8-32,8-32,0-22,0-22,0-22,0-22,9-30,0-23,0-23,0-22,0-22,0-28,16-37,16-37,8-32,0-21,0-27,0-27		15340062	10.1128/MCB.24.18.7998-8006.2004	0270-7306	Molecular and Cellular Biology	Targeted Gene Knockout Reveals a Role in Meiotic Recombination for ZHP-3, a Zip3-Related Protein in Caenorhabditis elegans	Jantsch	2004	6		
650	chrI	8530121	8530193	3500415441	72		8530121	8530193	8421504	1	72	0	c	350041544100000294,350041544100000292,350041544100000293	0-73,0-72,0-72						Genomic tRNA Database: Caenorhabditis brenneri (WUGSC 4.0 Jan 2007)	gtrnadb.ucsc.edu	0	0		
650	chrI	8574476	8578897	3500331596	2142		8574476	8578897	8421504	12	93,102,213,244,233,421,71,181,187,163,117,117	0,330,477,739,1034,1314,1781,1896,2125,2362,2575,4304	p	350033159600015008	117-2304						bioinfo-btg10-grupo06 - Practica 2.2	06.wikispaces.com	0	0		
650	chrI	8575895	8576468	3500399057	54		8575895	8576468	8421504	2	18,36	0,537	p	350039905700015021	0-54						Method for designing pdk1 modulators	ALESSI	2005	0		RPS6KA1,MIR1976
650	chrI	8579616	8579641	3500227264	24		8579616	8579641	8421504	2	8,16	0,9	g	350022726400000171	0-24						ORFeome-based arrays in eukaryotic expression vectors - a new approach to screen for the function of viral proteins (LANA-1 meets the mediator)	b.uni-muenchen.de	0	0		
650	chrI	8584484	8585446	3500390816	40		8584484	8585446	8421504	4	6,14,15,5	0,9,941,957	c,g	350039081600000174,350039081600000158	5-25,14-34						Polynucleotides and methods for making plants resistant to fungal pathogens - Patent application	www.faqs.org	0	0		
650	chrI	8591229	8591732	3500358534	38		8591229	8591732	8421504	2	19,19	0,484	c,g	350035853400000008,350035853400000009,350035853400000009	0-19,0-19,0-19			10.1261/rna.5420503		RNA	The Ref/Aly proteins are dispensable for mRNA export and development in Caenorhabditis elegans	DASA	July	0		
650	chrI	8592091	8592720	3500121800	420		8592091	8592720	8421504	5	87,93,16,113,111	0,137,239,309,518	p	350012180000015149,350012180000015151,350012180000015153	0-180,0-165,0-75						49 human secreted proteins	Komatsoulis	2000	0		
650	chrI	8610047	8610228	3500359921	132		8610047	8610228	8421504	2	57,75	0,106	p	350035992100015208,350035992100015209	0-81,0-51						Immunization with bacterial ghost-based vaccines	Leenhouts	2005	0		
650	chrI	8610047	8610228	3500016933	132		8610047	8610228	8421504	2	57,75	0,106	p	350001693300015206,350001693300015207	0-81,0-51						Bacterial ghosts provided with antigens	Leenhouts	2002	0		
650	chrI	8611419	8611445	3500081673	24		8611419	8611445	8421504	2	5,19	0,7	c	350008167300000316	12-36						Polynucleotides and membrane-bound polypeptide encoded thereby	Fernandes	2000	0		
650	chrI	8629290	8629318	3500109093	23		8629290	8629318	8421504	2	8,15	0,13	g	350010909300000338	11-36						Entwicklung und Evaluierung eines Resistenz- Microarrays für die Detektion von Resistenzdeterminanten in Bakterien aus Kläranlagen	www.lanuv.nrw.de	0	0		
650	chrI	8634506	8634635	3500367863	90		8634506	8634635	8421504	2	45,45	0,84	p	350036786300015000,350036786300015002	0-45,0-45						Regulation von Programmiertem Zelltod in den NSM-Schwesterzellen im Nervensystem von Caenorhabditis elegans	b.uni-muenchen.de	0	0		
651	chrI	8663257	8663667	3500168863	80		8663257	8663667	8421504	2	60,20	0,390	p,c,g	350016886300015007,350016886300000000,350016886300000000	0-60,0-20,0-20						SYP-3 Restricts Synaptonemal Complex Assembly to Bridge Paired Chromosome Axes During Meiosis in Caenorhabditis elegans--《遗传学杂志》--医学期刊频道--首席医&#	journal.9med.net	0	0		
651	chrI	8663257	8663667	3500083722	80		8663257	8663667	8421504	2	60,20	0,390	p,c,g	350008372200015001,350008372200000000,350008372200000000	0-60,0-20,0-20		17565948	10.1534/genetics.107.072413	0016-6731	Genetics	SYP-3 Restricts Synaptonemal Complex Assembly to Bridge Paired Chromosome Axes During Meiosis in Caenorhabditis elegans	Smolikov	2007	4		
651	chrI	8664765	8666433	3500051657	72		8664765	8666433	8421504	3	32,20,20	0,1435,1648	c,g	350005165700000002,350005165700000000,350005165700000003,350005165700000003,350005165700000001	0-20,0-20,0-20,0-20,0-20						ナショナルバイオリソースプロジェクト (NBRP) C.elegans Mutants	.shigen.nig.ac.jp	0	0		
651	chrI	8666792	8666821	3500400512	24		8666792	8666821	8421504	2	7,17	0,12	c	350040051200000008	6-30						菌种生产制造工艺,液体菌种,生产食用菌,蘑菇菌种,混合菌种,香菇菌种,	www.51zlwx.com	0	0		
651	chrI	8678053	8678081	3500178220	23		8678053	8678081	8421504	2	7,16	0,12	c	350017822000001338	7-30						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
651	chrI	8685105	8685133	3500168119	23		8685105	8685133	8421504	2	8,15	0,13	g	350016811900000363	7-36						<Html><Title> Complet list of 2yvg hssp file Complet list of	cnptia.embrapa.br	0	0		
651	chrI	8688807	8689036	3500318754	41		8688807	8689036	8421504	2	21,20	0,209	c,g	350031875400000029,350031875400000028,350031875400000028	0-21,0-20,0-20						Protist-Type Lysozymes of the Nematode Caenorhabditis elegansContribute to Resistance against Pathogenic Bacillus thuringiensis	s-labs.bham.ac.uk	0	0		
651	chrI	8689064	8689109	3500347723	45		8689064	8689109	8421504	1	45	0	p	350034772300015017	0-45						文字列探索(2)	www.hgc.jp/~tshib	0	0		
651	chrI	8689064	8689109	3500004201	45		8689064	8689109	8421504	1	45	0	p	350000420100015027	0-45						Suffix Trees and Arrays	phys.chuo-u.ac.jp	0	0		
651	chrI	8700310	8700367	3500387949	57		8700310	8700367	8421504	1	57	0	p	350038794900015000	0-57						ScienceDirect.com - Molecular Cell - TBP-like Factor Is Required for Embryonic RNA Polymerase II Transcription in C. elegans	sciencedirect.com	0	0		
651	chrI	8700751	8700774	3500318059	23		8700751	8700774	8421504	1	23	0	g	350031805900000091	5-28						Devices from Prion-Like Proteins - Patent application	www.faqs.org	0	0		
651	chrI	8700751	8700774	3500135243	23		8700751	8700774	8421504	1	23	0	g	350013524300000070	5-28						Electrical Conductors and Devices from Prion-Like Proteins - Patent application	www.faqs.org	0	0		
651	chrI	8706039	8707448	3500377583	528		8706039	8707448	8421504	5	9,104,83,305,27	0,120,273,1028,1382	p	350037758300015039,350037758300015026,350037758300015013	0-177,0-171,0-180						Knobloch syndrome: Novel mutations in COL18A1, evidence for genetic heterogeneity, and a functionally impaired polymorphism in endostatin	mrgreenworld.com	0	0		
651	chrI	8724147	8724172	3500084510	24		8724147	8724172	8421504	2	20,4	0,21	g	350008451000000144	2-26						EPSP synthase domains conferring glyphosate resistance - Patent application	www.faqs.org	0	0		
651	chrI	8727349	8727377	3500141894	23		8727349	8727377	8421504	2	7,16	0,12	c	350014189400000009	0-23						US Patent # 6,204,025. Efficient linking of nucleic acid segments - Patents.com	www.patents.com	0	0		
651	chrI	8737078	8737103	3500067999	23		8737078	8737103	8421504	3	4,6,13	0,5,12	c	350006799900000020	11-34						Lecture 3 motifs	.cs.colostate.edu	0	0		
651	chrI	8752719	8754654	3500275380	144		8752719	8754654	8421504	4	3,45,48,48	0,174,694,1887	p	350027538000015153,350027538000015159,350027538000015170	0-48,0-48,0-48						<HTML><HEAD><meta http-equiv="Content-Type" content="text/html; charset=ISO-8859-1"><LINK REL="SHORT	.economie.fgov.be	0	0		
651	chrI	8763256	8763294	3500154376	35		8763256	8763294	8421504	2	17,18	0,20	c	350015437600000000,350015437600000001	0-35,0-35		21653823	10.1091/mbc.E11-01-0064	1059-1524	Molecular Biology of the Cell	A laminopathic mutation disrupting lamin filament assembly causes disease-like phenotypes in Caenorhabditis elegans	Bank	2011	5		
651	chrI	8764922	8765083	3500040837	42		8764922	8765083	8421504	2	19,23	0,138	c,g	350004083700000000,350004083700000000,350004083700000001,350004083700000001	0-19,0-19,0-23,0-23		19875417	10.1093/nar/gkp868		Nucleic Acids Research	Single-cell transcriptional analysis of taste sensory neuron pair in Caenorhabditis elegans	Jun	2010	0		
651	chrI	8765060	8765083	3500181690	23		8765060	8765083	8421504	1	23	0	c,g	350018169000000005,350018169000000005	0-23,0-23						TaiLieu.VN: Báo cáo y học: "Identification of ciliated sensory neuron-expressed genes in Caenorhabditis elegans using targeted pull-down of poly(A) tails" 	tailieu.vn/doc/ba	0	0		
651	chrI	8768517	8781712	3500027006	44		8768517	8781712	8421504	2	22,22	0,13173	c,g	350002700600000003,350002700600000003,350002700600000005	0-22,0-22,0-22			10.1371/journal.pgen.0020018	1553-7404	PLOS Genetics	PLOS Genetics: trt-1 Is the Caenorhabditis elegans Catalytic Subunit of Telomerase	Meier	2006	0		
81	chrI	8780492	8790107	3500087834	146		8780492	8790107	8421504	6	21,20,27,27,26,25	0,1489,4153,4267,4862,9590	c,g	350008783400000008,350008783400000009,350008783400000009,350008783400000003,350008783400000005,350008783400000007,350008783400000007,350008783400000006	9-30,9-29,9-29,0-27,0-27,8-34,8-34,8-33			10.1111/j.1365-2443.2004.00792.x	1365-2443	Genes to Cells	MFB-1, an F-box-type ubiquitin ligase, regulates TGF-β signalling - Aoyama - 2004 - Genes to Cells - Wiley Online Library	Aoyama	2004	0		
651	chrI	8781690	8781714	3500162726	23		8781690	8781714	8421504	2	9,14	0,10	g	350016272600000000	0-23						2241paul的个人主页 | 果壳网 科技有意思	www.guokr.com	0	0		
652	chrI	8814766	8814791	3500200687	25		8814766	8814791	8421504	1	25	0	c	350020068700000014	17-42						Grapevine fanleaf virus resistance in grapevine expressing grapevine fanleaf virus coat protein	Gonsalves	1998	0		
652	chrI	8815916	8815939	3500080565	23		8815916	8815939	8421504	1	23	0	c	350008056500000074	0-38						Aplicación de la hibridación somática a la mejora de la citricultura española	riunet.upv.es	0	0		
652	chrI	8817234	8817616	3500251512	23		8817234	8817616	8421504	3	9,9,5	0,367,377	c	350025151200000022	11-34						miRNA396 AND GROWTH REGULATING FACTORS FOR CYST NEMATODE TOLERANCE IN PLANTS - Patent application	www.faqs.org	0	0		
652	chrI	8817234	8817616	3500057886	23		8817234	8817616	8421504	3	9,9,5	0,367,377	c	350005788600000022	11-34						miRNA396 AND GROWTH REGULATING FACTORS FOR CYST NEMATODE TOLERANCE IN PLANTS	Baum	2012	0		
652	chrI	8818194	8818219	3500302946	24		8818194	8818219	8421504	2	16,8	0,17	c	350030294600000010	0-24						articles Initial sequencing and analysis of the human genome	www.ndsu.edu	0	0		
652	chrI	8818194	8818219	3500274251	24		8818194	8818219	8421504	2	16,8	0,17	c	350027425100000010	0-24						articles Initial sequencing and analysis of the human genome	ttk.pte.hu/biolog	0	0		
652	chrI	8818194	8818219	3500213927	24		8818194	8818219	8421504	2	16,8	0,17	c	350021392700000010	0-24						articles Initial sequencing and analysis of the human genome	www.biosino.org	0	0		
652	chrI	8818194	8818219	3500133003	24		8818194	8818219	8421504	2	16,8	0,17	c	350013300300000010	0-24						articles Initial sequencing and analysis of the human genome	lue.lib.umich.edu	0	0		
652	chrI	8820651	8820683	3500431462	23		8820651	8820683	8421504	3	6,12,5	0,11,27	c	350043146200000190	25-48						US Patent # 7,205,146. Nucleotide and amino acid sequences relating to respiratory diseases and obesity - Patents.com	www.patents.com	0	0		
652	chrI	8820651	8820683	3500031022	23		8820651	8820683	8421504	3	6,12,5	0,11,27	c	350003102200000190	25-48						NUCLEOTIDE AND AMINO ACID SEQUENCES RELATING TO RESPIRATORY DISEASES AND OBESITY - Patent application	www.faqs.org	0	0		
652	chrI	8853827	8861262	3500154339	153		8853827	8861262	8421504	3	51,52,50	0,1556,7385	c,g	350015433900000144,350015433900000144,350015433900000149,350015433900000143	0-51,0-51,48-100,50-100							biomedcentral.com	0	0		
652	chrI	8870199	8870332	3500096011	24		8870199	8870332	8421504	3	18,4,2	0,22,131	c	350009601100000245	1-25						<Html><Title> Complet list of 2vex hssp file Complet list of	cnptia.embrapa.br	0	0		
652	chrI	8897751	8897796	3500039132	45		8897751	8897796	8421504	1	45	0	p	350003913200015002,350003913200015003	0-45,3-48						Funktionelle Charakterisierung zweier Levamisolrezeptor-assoziierter Proteine in C. elegans – NRA-2 und NRA-4	.uni-frankfurt.de	0	0		
652	chrI	8897872	8898486	3500092739	40		8897872	8898486	8421504	2	20,20	0,594	c,g	350009273900000037,350009273900000037,350009273900000036,350009273900000036	0-20,0-20,0-20,0-20		22174070	10.1534/genetics.111.137455		Genetics	Cell Excitability Necessary for Male Mating Behavior in Caenorhabditis elegans Is Coordinated by Interactions Between Big Current and Ether-A-Go-Go Family K+ Channels	Brigitte	2012	0		
652	chrI	8897954	8897981	3500196959	23		8897954	8897981	8421504	2	11,12	0,15	c	350019695900001231	0-26						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
652	chrI	8912089	8912113	3500305547	24		8912089	8912113	8421504	1	24	0	c	350030554700000027,350030554700000020	18-42,20-44						Fungal variants and uses thereof	Milne	2006	0		
653	chrI	8936388	8936544	3500267337	29		8936388	8936544	8421504	2	23,6	0,150	g	350026733700000020	0-29						@DGFC08P1:101:C0836ACXX:1:1101:5132:139620:6/2 GACACCCGTAAAGGGTCTGTGCTGAGGAGGATTAGTATAAGAGGAAGGCATG	markovitzlab.com	0	0		
653	chrI	8945772	8970901	3500344270	38		8945772	8970901	8421504	3	19,6,13	0,25106,25116	c,g	350034427000000787,350034427000000870,350034427000000870	8-27,7-26,7-26						@IL23_3198:2:1:0:199/1 NCGGAACCGGGCGGAAACACCATCGTATGCCGTCTTC + &0;;;;:9:;:7;;;;;;;;;;;;;;;;;;;;;;;:8	rse.iop.kcl.ac.uk	0	0		
653	chrI	8961368	8961392	3500133886	23		8961368	8961392	8421504	2	13,10	0,14	g	350013388600000378	0-23						Brain Endothelial Cell Expression Patterns	Madden	2012	0		
653	chrI	8962280	8964258	3500055719	80		8962280	8964258	8421504	4	20,20,20,20	0,46,1843,1958	c,g	350005571900000001,350005571900000003,350005571900000004,350005571900000004,350005571900000002,350005571900000002	0-20,0-20,0-20,0-20,0-20,0-20						National BioResource Project (NBRP)::C.elegans Mutants	.shigen.nig.ac.jp	0	0		
653	chrI	8975950	8984964	3500079395	9014		8975950	8984964	8421504	1	9014	0	g	350007939500000010	0-9014						ANTHELMINTIC AND/OR INSECTICIDE DEVELOPMENT - Patent application	www.faqs.org	0	0		
653	chrI	8978173	9002919	3500266829	40		8978173	9002919	8421504	3	6,14,20	0,9,24726	g	350026682900000889,350026682900003028	24-45,3-23						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
653	chrI	8981097	8981290	3500333817	40		8981097	8981290	8421504	2	19,21	0,172	c,g	350033381700000009,350033381700000008,350033381700000008	0-19,0-21,0-21			10.1534/genetics.107.078071		Genetics	Revisiting the X:A Signal That Specifies Caenorhabditis elegans Sexual Fate	John	2007	0		
653	chrI	8982871	8982895	3500418108	23		8982871	8982895	8421504	2	10,13	0,11	c	350041810800000029	14-37						US Patent # 6,281,413. Insecticidal toxins from Photorhabdus luminescens and nucleic acid sequences coding therefor - Patents.com	www.patents.com	0	0		
653	chrI	8998349	8998375	3500076448	23		8998349	8998375	8421504	2	13,10	0,16	g	350007644800000260,350007644800000595	0-23,0-23						ASSAY FOR THE DETECTION OF FACTORS THAT MODULATE THE EXPRESSION OF INAGP - Patent application	www.faqs.org	0	0		
653	chrI	9005783	9005891	3500465229	40		9005783	9005891	8421504	2	20,20	0,88	c,g	350046522900000001,350046522900000000,350046522900000000	0-20,0-20,0-20			10.1016/j.ydbio.2006.12.039		Developmental biology	Transcription Reactivation Steps Stimulated by Oocyte Maturation in C. elegans	Amy	2007	0		
653	chrI	9005783	9005891	3500321280	40		9005783	9005891	8421504	2	20,20	0,88	c,g	350032128000000001,350032128000000000,350032128000000000	0-20,0-20,0-20						ScienceDirect.com - Developmental Biology - Transcription reactivation steps stimulated by oocyte maturation in C. elegans	sciencedirect.com	0	0		
653	chrI	9005783	9005891	3500252544	40		9005783	9005891	8421504	2	20,20	0,88	c,g	350025254400000001,350025254400000000,350025254400000000	0-20,0-20,0-20						Transcription reactivation steps stimulated by oocyte maturation in C. elegans	oslin.harvard.edu	0	0		
653	chrI	9018726	9020153	3500451620	480		9018726	9020153	8421504	5	25,57,108,134,156	0,757,859,1080,1271	p,c,g	350045162000015110,350045162000015112,350045162000000060,350045162000015114,350045162000000061,350045162000000061,350045162000015116,350045162000000062,350045162000015118,350045162000000063,350045162000000063,350045162000015120,350045162000000064,350045162000000064,350045162000015122,350045162000000065,350045162000015124,350045162000000066,350045162000015126,350045162000000067,350045162000000067,350045162000015128,350045162000000068,350045162000000068	0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48						Stars-a Muscle-specific Actin-binding Protein 	.freshpatents.com	0	0		
653	chrI	9022443	9023565	3500390138	41		9022443	9023565	8421504	2	20,21	0,1101	c,g	350039013800000012,350039013800000012,350039013800000013	0-20,0-20,0-21		22090313	10.1096/fj.11-197798	0892-6638	The FASEB Journal	Light-sensitive coupling of rhodopsin and melanopsin to Gi/o and Gq signal transduction in Caenorhabditis elegans	Cao	2012	6		
653	chrI	9024873	9024997	3500181690	45		9024873	9024997	8421504	2	19,26	0,98	c,g	350018169000000010,350018169000000010,350018169000000011,350018169000000011	0-19,0-19,0-26,0-26						TaiLieu.VN: Báo cáo y học: "Identification of ciliated sensory neuron-expressed genes in Caenorhabditis elegans using targeted pull-down of poly(A) tails" 	tailieu.vn/doc/ba	0	0		
653	chrI	9040546	9040570	3500260141	24		9040546	9040570	8421504	1	24	0	g	350026014100000427	0-24						 <HTML> <HEAD><TITLE>Show BLAST File 
 
  
 Complet list of 1cmj hssp file Complet list of	cnptia.embrapa.br	0	0		
654	chrI	9103286	9104217	3500290590	195		9103286	9104217	8421504	2	19,176	0,755	p	350029059000015041	0-195						The Drosophila trithorax group gene tonalli(tna) interacts genetically with the Brahma remodeling complex and encodes an SP-RING finger protein	ev.biologists.org	0	0		
654	chrI	9104955	9104980	3500243477	23		9104955	9104980	8421504	3	12,4,7	0,13,18	c	350024347700000061	0-23						利用 SSR 分析红菜苔的遗传多样性	www.zwyczy.cn	0	0		
654	chrI	9120168	9121137	3500404771	40		9120168	9121137	8421504	2	20,20	0,949	c,g	350040477100000018,350040477100000018,350040477100000017,350040477100000017	0-20,0-20,0-20,0-20		15767665	10.1128/MCB.25.7.2583-2592.2005	0270-7306	Molecular and Cellular Biology	HCP-4/CENP-C Promotes the Prophase Timing of Centromere Resolution by Enabling the Centromere Association of HCP-6 in Caenorhabditis elegans	Moore	2005	6		
654	chrI	9134275	9135235	3500272589	62		9134275	9135235	8421504	3	21,20,21	0,136,939	c,g	350027258900000000,350027258900000000,350027258900000002,350027258900000001,350027258900000001	9-30,9-30,7-27,9-30,9-30		19361490	10.1016/j.ydbio.2009.04.004		Developmental biology	Levels of the ubiquitin ligase substrate adaptor MEL-26 are inversely correlated with MEI-1/katanin microtubule-severing activity during both meiosis and mitosis	Jacque-Lynne	June	0		
654	chrI	9136295	9136327	3500158435	24		9136295	9136327	8421504	3	6,6,12	0,10,20	c	350015843500000070	14-38						<Html><Title> Complet list of 1ccg hssp file Complet list of	cnptia.embrapa.br	0	0		
654	chrI	9159421	9159450	3500118398	29		9159421	9159450	8421504	1	29	0	c	350011839800002384	5-35						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
654	chrI	9163940	9164148	3500369112	42		9163940	9164148	8421504	2	20,22	0,186	c,g	350036911200000002,350036911200000002,350036911200000003,350036911200000003	2-22,2-22,0-22,0-22		21471153	10.1242/dev.057109	0950-1991	Development	The zinc-finger protein SEA-2 regulates larval developmental timing and adult lifespan in C. elegans	Huang	2011	7		
654	chrI	9164466	9164896	3500153784	40		9164466	9164896	8421504	2	20,20	0,410	c,g	350015378400000008,350015378400000008,350015378400000009,350015378400000009	0-20,0-20,0-20,0-20			10.1186/2046-2395-2-9	2046-2395	Longevity & Healthspan	The SFT-1 and OXA-1 respiratory chain complex assembly factors influence lifespan by distinct mechanisms in C. elegans	Maxwell	2013	0		
654	chrI	9165242	9165268	3500088689	26		9165242	9165268	8421504	1	26	0	c,g	350008868900001679,350008868900001679	20-46,20-46						 Galaxy | Dataset | spawned_eel_pituitary_sample29_2.fastq	ain.g2.bx.psu.edu	0	0		
654	chrI	9165853	9166264	3500038566	43		9165853	9166264	8421504	2	22,21	0,390	c,g	350003856600000019,350003856600000019,350003856600000020,350003856600000020	0-22,0-22,0-21,0-21					BMC Developmental Biology	Regulation of Caenorhabditis elegans body size and male tail development by the novel gene lon-8 - Scolaris	Soete	2007	0		
655	chrI	9175341	9175407	3500199211	66		9175341	9175407	8421504	1	66	0	p	350019921100015226	9-75						Etude des voies metaboliques des sucres chez l'huitre creuse crassostrea gigas. Implication dans les mortalites estivales.	chimer.ifremer.fr	0	0		
655	chrI	9176075	9176518	3500132263	48		9176075	9176518	8421504	2	39,9	0,434	p	350013226300015217,350013226300015183	0-45,0-45						PROTEIN TRANSDUCING DOMAIN/DEAMINASE CHIMERIC PROTEINS, RELATED COMPOUNDS, AND USES THEREOF - Patent application	www.faqs.org	0	0		
655	chrI	9176268	9189118	3500343811	40		9176268	9189118	8421504	4	6,14,7,13	0,9,12826,12837	g	350034381100003617,350034381100002635	5-25,0-20						1531 26.93 2.31 1.16 sequence_4 1 432 (149568) + Gypsy12-ZM_I LTR/Gypsy 	nomics.purdue.edu	0	0		
655	chrI	9176593	9176616	3500231029	23		9176593	9176616	8421504	1	23	0	c,g	350023102900001991,350023102900001991	0-24,0-24						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
655	chrI	9183882	9184253	3500271198	23		9183882	9184253	8421504	3	14,3,6	0,361,365	c	350027119800001505	22-45						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
655	chrI	9183882	9184253	3500241007	23		9183882	9184253	8421504	3	14,3,6	0,361,365	c	350024100700002745	0-23						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
655	chrI	9209387	9209412	3500257369	23		9209387	9209412	8421504	3	7,12,4	0,8,21	g	350025736900000015	5-34						None	biomedcentral.com	0	0		
655	chrI	9227029	9227055	3500257916	23		9227029	9227055	8421504	2	9,14	0,12	c	350025791600000003	14-37						Blackwell Science, Ltd The juvenile hormone binding protein of silkworm haemolymph: gene and functional analysis	ellpublishing.com	0	0		
655	chrI	9238329	9242040	3500197871	357		9238329	9242040	8421504	7	33,24,42,9,42,21,186	0,36,1557,1653,2647,2692,3525	p	350019787100015073,350019787100015036,350019787100015006	0-57,0-51,0-273						Supporting Online Material for	ww.sciencemag.org	0	0		
655	chrI	9238329	9242040	3500114832	381		9238329	9242040	8421504	8	33,24,42,9,42,31,20,180	0,36,1557,1653,2647,2692,3508,3531	p	350011483200015073,350011483200015036,350011483200015006	0-57,0-51,0-273						Role of C. elegans TAT-1 Protein in Maintaining Plasma Membrane Phosphatidylserine Asymmetry Monica Darland-Ransom, www.sciencemag.org (this information is current as of April 24, 2008 )	mcdb.colorado.edu	0	0		
655	chrI	9256230	9256255	3500403017	23		9256230	9256255	8421504	2	12,11	0,14	c	350040301700000114	11-47						US Patent # 6,943,281. Expression of Cry3B insecticidal protein in plants - Patents.com	www.patents.com	0	0		
655	chrI	9256230	9256255	3500077533	23		9256230	9256255	8421504	2	12,11	0,14	c	350007753300000114	11-47						Expression of Cry3B insecticidal protein in plants - Patent # 6943281 - PatentGenius	.patentgenius.com	0	0		
655	chrI	9256721	9256940	3500298520	24		9256721	9256940	8421504	3	1,15,8	0,193,211	c	350029852000000036	0-24						Cis-element Regulating Transcription, Transcriptional Regulatory Factor Binding Specifically Thereto And Use Of The Same 	.freshpatents.com	0	0		
655	chrI	9278787	9278810	3500423592	23		9278787	9278810	8421504	1	23	0	g	350042359200000048	10-33						<!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01 Transitional//EN"> <HTML> <HEAD> <META http-equiv="Cont	e.dna.affrc.go.jp	0	0		
655	chrI	9283703	9283731	3500133100	24		9283703	9283731	8421504	3	6,7,11	0,8,17	c	350013310000000119	0-24						4 TMEM1 GATCACAAGATCCATCTGTAGAAGC TTGTCCTTGATTTTTGGTGCA 6 PRKCBP2 CCCTCCTGTTGTCTCTCCTG TTAACGGTGGCAAAAGGTGT	r21.molgen.mpg.de	0	0		
655	chrI	9286505	9286529	3500337432	24		9286505	9286529	8421504	1	24	0	g	350033743200001683	7-31						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
655	chrI	9286505	9286529	3500260606	24		9286505	9286529	8421504	1	24	0	g	350026060600002484	7-31						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
655	chrI	9299906	9299942	3500383134	26		9299906	9299942	8421504	3	7,7,12	0,12,24	g	350038313400000000	9-35						Abstract 44 Exponential representational fragment amplification (rfa): 30 million fold with retention of fidelity as determined by comparative microarray analysis. H.H., Stanford University School of Medicine, Stanford, Calif.	www.aacc.org	0	0		
656	chrI	9306429	9306453	3500243691	23		9306429	9306453	8421504	2	13,10	0,14	c	350024369100003674	10-33						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
656	chrI	9308436	9310213	3500427459	40		9308436	9310213	8421504	2	19,21	0,1756	c,g	350042745900000002,350042745900000002,350042745900000003	0-19,0-19,0-21						Endocytosis and intracellular trafficking contribute to necrotic neurodegeneration in C. elegans	avernarakislab.gr	0	0		
656	chrI	9316516	9316543	3500434547	25		9316516	9316543	8421504	2	17,8	0,19	g	350043454700000023,350043454700000070	8-33,8-33						 High Throughput Screening Of Gene Function Using Libraries For Functional Genomics Applications 	www.docstoc.com	0	0		
656	chrI	9316516	9316543	3500406819	25		9316516	9316543	8421504	2	17,8	0,19	g	350040681900000073,350040681900000023	8-33,8-33						High throughput screening of gene function using adenoviral libraries for functional genomics applications - Patent # 6340595 - PatentGenius	.patentgenius.com	0	0		
656	chrI	9316516	9316543	3500237410	25		9316516	9316543	8421504	2	17,8	0,19	g	350023741000000023	8-33					Patent	High throughput screening of gene function using libraries for functional genomics applications (Patent US:7029848)	Vogels	2006	0		
656	chrI	9316516	9316543	3500097532	25		9316516	9316543	8421504	2	17,8	0,19	g	350009753200000023,350009753200000073	8-33,8-33						US Patent # 6,340,595. High throughput screening of gene function using adenoviral libraries for functional genomics applications - Patents.com	www.patents.com	0	0		
656	chrI	9320403	9321490	3500228289	63		9320403	9321490	8421504	2	33,30	0,1057	c,g	350022828900000007,350022828900000006,350022828900000006	0-33,3-33,3-33							digital.csic.es	0	0		
656	chrI	9320474	9320937	3500204423	44		9320474	9320937	8421504	2	22,22	0,441	c,g	350020442300000003,350020442300000003,350020442300000002,350020442300000002	0-22,0-22,0-22,0-22						Antiageing, antistress and ROS scavenging activity of crude extract of Ocimum sanctum in Caenorhabditis elegans (Maupas, 1900) - ResearchGate	.researchgate.net	0	0		
656	chrI	9321783	9321980	3500398325	40		9321783	9321980	8421504	2	20,20	0,177	c,g	350039832500000018,350039832500000018,350039832500000017,350039832500000017	0-20,0-20,0-20,0-20						Gelöste Huminstoffe können die Lebensspanne von Caenorhabditis elegans verlängern und seine Genexpression beeinflussen	www2.hu-berlin.de	0	0		
656	chrI	9322562	9322593	3500253468	31		9322562	9322593	8421504	1	31	0	g	350025346800000000,350025346800000001	0-31,0-31						Neuronal Reprograming of Protein Homeostasis by Calcium-Dependent Regulation of the Heat Shock Response	.northwestern.edu	0	0		
656	chrI	9327641	9341205	3500425488	68		9327641	9341205	8421504	3	27,22,19	0,13317,13545	c,g	350042548800000007,350042548800000015,350042548800000015,350042548800000014,350042548800000014	0-27,0-22,0-22,0-19,0-19						Modulating XRN2 - NOVARTIS FORSCHUNGSSTIFTUNG, ZWEIGNIEDERLASSUNG, FRIEDRICH MIESCHER INSITITUTE FOR BIOMEDICAL RESEARCH	www.sumobrain.com	0	0		
656	chrI	9327641	9341205	3500219292	68		9327641	9341205	8421504	3	27,22,19	0,13317,13545	c,g	350021929200000005,350021929200000013,350021929200000013,350021929200000012,350021929200000012	0-27,0-22,0-22,0-19,0-19						Active turnover modulates mature microRNA activity in Caenorhabditis elegans	rnajc.ucsf.edu	0	0		
656	chrI	9332997	9379997	3500306561	64		9332997	9379997	8421504	3	22,23,19	0,39777,46981	c,g	350030656100000193,350030656100000193,350030656100000147,350030656100000147,350030656100000303,350030656100000185	22-44,0-22,21-44,0-23,21-44,0-19						Anti-microRNA oligonucleotide molecules	Landthaler	2011	0		
656	chrI	9332997	9379997	3500257436	64		9332997	9379997	8421504	3	22,23,19	0,39777,46981	c,g	350025743600000193,350025743600000193,350025743600000147,350025743600000147,350025743600000303,350025743600000303,350025743600000185	22-44,22-44,21-44,0-23,24-44,0-20,0-19						Anti-MicroRna Oligonucleotide Molecules	Tuschl	2007	0		
656	chrI	9332997	9379997	3500232262	64		9332997	9379997	8421504	3	22,23,19	0,39777,46981	c,g	350023226200000193,350023226200000193,350023226200000147,350023226200000147,350023226200000303,350023226200000185,350023226200000185	22-44,0-22,21-44,0-23,21-44,0-19,0-19					Patent	Anti-microRNA oligonucleotide molecules (Patent US:7772389)	Tuschl	2010	0		
656	chrI	9332997	9372797	3500389139	45		9332997	9372797	8421504	2	22,23	0,39777	c,g	350038913900000194,350038913900000194,350038913900000148,350038913900000148	22-44,22-44,21-44,0-23						Anti-microrna oligonucleotide molecules	Tuschl	2006	0		
656	chrI	9334276	9345418	3500467559	105		9334276	9345418	8421504	4	20,44,20,21	0,1658,7593,11121	c,g	350046755900000005,350046755900000004,350046755900000011,350046755900000011,350046755900000010,350046755900000010,350046755900000008	8-28,12-35,9-31,9-31,10-30,10-30,12-33						Supplementary Materials for	ww.sciencemag.org	0	0		
656	chrI	9334879	9335581	3500237136	44		9334879	9335581	8421504	2	22,22	0,680	g	350023713600000010,350023713600000009	0-22,0-22		19155321	10.1261/rna.1258309		RNA	Uncoupling of lin-14 mRNA and protein repression by nutrient deprivation in Caenorhabditis elegans	Janette	2009	0		
656	chrI	9334879	9335581	3500162138	44		9334879	9335581	8421504	2	22,22	0,680	g	350016213800000010,350016213800000009	0-22,0-22		19155321	10.1261/rna.1258309	1355-8382	RNA	Uncoupling of lin-14 mRNA and protein repression by nutrient deprivation in Caenorhabditis elegans	Holtz	2009	5		
656	chrI	9334946	9342488	3500289693	374		9334946	9342488	8421504	4	98,155,51,70	0,243,435,7472	g	350028969300000086,350028969300000083,350028969300000070,350028969300000066,350028969300000067,350028969300000068,350028969300000062,350028969300000056,350028969300000050,350028969300000047,350028969300000044	0-50,0-48,0-32,0-48,0-24,0-24,0-42,0-33,0-51,0-31,0-39						5’ binding in Red color (shadow in green)	www.nature.com	0	0		
656	chrI	9335182	9335284	3500384227	102		9335182	9335284	8421504	1	102	0	g	350038422700000075,350038422700000074,350038422700000266,350038422700000267,350038422700000071,350038422700000073,350038422700000072,350038422700000270,350038422700000268,350038422700000269	0-103,0-102,0-102,0-102,0-102,0-102,0-102,0-103,0-102,0-102						Precursor miRNA loop-modulated target regulation - Patent application	www.faqs.org	0	0		
656	chrI	9335182	9335284	3500341482	102		9335182	9335284	8421504	1	102	0	g	350034148200000082,350034148200000083,350034148200000080,350034148200000081,350034148200000084,350034148200000085	0-102,0-102,0-102,0-102,0-103,0-28						Precursor miRNA loop-modulated target regulation	Chen	2010	0		
656	chrI	9335233	9335274	3500294153	41		9335233	9335274	8421504	1	41	0	g	350029415300000004,350029415300000005,350029415300000006,350029415300000007,350029415300000002,350029415300000003	21-61,21-61,21-62,21-62,21-61,21-61						Methods and compositions for enhancing the efficacy and specificity of rna silencing	Hutvagner	2006	0		
656	chrI	9335233	9335273	3500044615	40		9335233	9335273	8421504	1	40	0	g	350004461500000008,350004461500000004,350004461500000010,350004461500000009	21-61,24-55,0-21,0-21						AmicroRNAinaMultiple- TurnoverRNAiEnzymeComplex	www.genesil.com	0	0		
656	chrI	9335350	9335375	3500025389	25		9335350	9335375	8421504	1	25	0	g	350002538900000013	7-32		18824511	10.1261/rna.1139508	1355-8382	RNA	A novel biochemical method to identify target genes of individual microRNAs: Identification of a new Caenorhabditis elegans let-7 target	Andachi	2008	5		
656	chrI	9336942	9337062	3500355728	40		9336942	9337062	8421504	2	20,20	0,100	c,g	350035572800000004,350035572800000004,350035572800000003,350035572800000003	0-20,0-20,0-20,0-20						Les courts ARN chez C. elegans : spécificité et fonction des protéines Argonautes	de.bibl.ulaval.ca	0	0		
656	chrI	9349148	9349176	3500197963	28		9349148	9349176	8421504	1	28	0	g	350019796300000001	0-28						ScienceDirect.com - Molecular Cell - The lin-41 RBCC Gene Acts in the C. elegans Heterochronic Pathway between the let-7 Regulatory RNA and the LIN-29 Transcription Factor	sciencedirect.com	0	0		
656	chrI	9372774	9379997	3500350956	46		9372774	9379997	8421504	2	23,23	0,7200	c,g	350035095600000021,350035095600000021,350035095600000020,350035095600000020,350035095600000040,350035095600000038,350035095600000039	0-23,0-23,0-21,0-21,0-23,0-23,0-21		24037191	10.1590/0074-0276108062013005	0074-0276	Memórias do Instituto Oswaldo Cruz	Memórias do Instituto Oswaldo Cruz - Identification and characterisation of microRNAs in young adults of Angiostrongylus cantonensis via a deep-sequencing approach	Chang	2013	2		
656	chrI	9372774	9379997	3500019132	46		9372774	9379997	8421504	2	23,23	0,7200	c,g	350001913200000021,350001913200000021,350001913200000020,350001913200000020,350001913200000040,350001913200000038,350001913200000039	0-23,0-23,0-21,0-21,0-23,0-23,0-21		24037191	10.1590/0074-0276108062013005	0074-0276	Memórias do Instituto Oswaldo Cruz	Memórias do Instituto Oswaldo Cruz - Identification and characterisation of microRNAs in young adults of Angiostrongylus cantonensis via a deep-sequencing approach	Chang	2013	2		
656	chrI	9372774	9372797	3500400478	23		9372774	9372797	8421504	1	23	0	c	350040047800000063	0-23					Patent	MicroRNA molecules (Patent US:7838663)	Tuschl	2010	0		
656	chrI	9372774	9372797	3500357539	23		9372774	9372797	8421504	1	23	0	c	350035753900000063	0-23					Patent	Identification of novel genes coding for small temporal RNAs (Patent US:8207326)	Tuschl	2012	0		
656	chrI	9372774	9372797	3500271863	23		9372774	9372797	8421504	1	23	0	c,g	350027186300000014,350027186300000014,350027186300000013,350027186300000013	0-23,0-23,0-22,0-22						Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel	biomedcentral.com	0	0		
656	chrI	9372774	9372797	3500262071	23		9372774	9372797	8421504	1	23	0	c,g	350026207100000008,350026207100000008	0-23,0-23		19197349	10.1371/journal.ppat.1000286		PLoS Pathogens	An RIG-I-Like RNA Helicase Mediates Antiviral RNAi Downstream of Viral siRNA Biogenesis in Caenorhabditis elegans	Rui	2009	0		
656	chrI	9372774	9372797	3500241683	23		9372774	9372797	8421504	1	23	0	c	350024168300000003,350024168300000001	0-23,0-23						al Regulation of microRNA Expression in Drosophila melanogaster mediated by Hormonal Signals and Broad-Complex gene activity - 豆丁网	www.docin.com	0	0		
656	chrI	9372774	9372797	3500210973	23		9372774	9372797	8421504	1	23	0	c	350021097300000223	0-23						Microrna molecules	Tuschl	2002	0		
656	chrI	9372774	9372797	3500125321	23		9372774	9372797	8421504	1	23	0	c	350012532100000111	0-23						NOVEL OLIGONUCLEOTIDE COMPOSITIONS AND PROBE SEQUENCES USEFUL FOR DETECTION AND ANALYSIS OF microRNAs AND THEIR TARGET mRNAs	Naguibneva	2008	0		
656	chrI	9372774	9372797	3500119333	23		9372774	9372797	8421504	1	23	0	c	350011933300000042	0-23						MicroRNAs show diverse and dynamic expression patterns in multiple tissues of Bombyx mori	biomedcentral.com	0	0		
656	chrI	9372774	9372797	3500011796	23		9372774	9372797	8421504	1	23	0	c,g	350001179600000015,350001179600000015	0-23,0-23						Wyman Supplemental Methods	genome.cshlp.org	0	0		
656	chrI	9379908	9380022	3500415450	114		9379908	9380022	8421504	1	114	0	c,g	350041545000000031,350041545000000022	0-114,0-21					Patent	Invertebrate microRNAs (Patent US:8410334)	Allen	2013	0		
656	chrI	9379908	9380022	3500129228	114		9379908	9380022	8421504	1	114	0	g	350012922800000008	0-114						Invertebrate micrornas	Allen	2009	0		
656	chrI	9379908	9380022	3500063739	114		9379908	9380022	8421504	1	114	0	c,g	350006373900000031,350006373900000022	0-114,0-21						Invertebrate Micrornas 	.freshpatents.com	0	0		
656	chrI	9379908	9380022	3500043993	114		9379908	9380022	8421504	1	114	0	c,g	350004399300000121,350004399300000031,350004399300000112,350004399300000112,350004399300000022	0-114,0-114,0-21,0-21,0-21						Invertebrate MicroRNAs - Patent application	www.faqs.org	0	0		
656	chrI	9379908	9380022	3500021845	114		9379908	9380022	8421504	1	114	0	g	350002184500000039	0-114						INVERTEBRATE MICRORNAS	Allen	2013	0		
656	chrI	9390963	9390991	3500418581	23		9390963	9390991	8421504	3	12,6,5	0,14,23	c	350041858100000756	10-33						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
656	chrI	9403558	9403582	3500343811	23		9403558	9403582	8421504	2	18,5	0,19	g	350034381100003042	11-37						1531 26.93 2.31 1.16 sequence_4 1 432 (149568) + Gypsy12-ZM_I LTR/Gypsy 	nomics.purdue.edu	0	0		
656	chrI	9405429	9405462	3500111307	28		9405429	9405462	8421504	3	13,7,8	0,16,25	g	350011130700000292	10-42					Patent	Method for producing a plant-optimized nucleic acid coding sequence (Patent US:6121014)	Desai	2000	0		
656	chrI	9436755	9436778	3500414565	23		9436755	9436778	8421504	1	23	0	c	350041456500000919	1-24						Analyzing Comparative Sequence Data to Understand Genome Function and Evolution	gradworks.umi.com	0	0		
657	chrI	9441405	9441432	3500268199	27		9441405	9441432	8421504	1	27	0	g	350026819900000023	14-41						specific expression of a novel cell wall hydroxyproline-rich glycoprotein gene in lateral root initiation	enesdev.cshlp.org	0	0		
657	chrI	9445265	9445288	3500235999	23		9445265	9445288	8421504	1	23	0	g	350023599900000381	17-40						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
657	chrI	9519661	9519688	3500396351	24		9519661	9519688	8421504	2	12,12	0,15	c	350039635100000016	5-29						U.S Animal Genome Mapping Site	.animalgenome.org	0	0		
657	chrI	9521194	9521221	3500035455	23		9521194	9521221	8421504	2	17,6	0,21	g	350003545500000232	14-37						<Html><Title> Complet list of 1o9u hssp file Complet list of	cnptia.embrapa.br	0	0		
657	chrI	9527144	9527172	3500251022	25		9527144	9527172	8421504	2	15,10	0,18	c	350025102200000010	15-40						Supporting Information	www.pnas.org	0	0		
657	chrI	9534216	9534241	3500440255	23		9534216	9534241	8421504	2	5,18	0,7	c	350044025500000000	6-30						gb-2008-9-12-r181-s3	www.docstoc.com	0	0		
82	chrI	9540186	9583993	3500415126	41		9540186	9583993	8421504	3	5,17,19	0,8,43788	c,g	350041512600000062,350041512600000090,350041512600000090	4-26,29-48,29-48						Inbred Corn Line De811asr(bc5) 	.freshpatents.com	0	0		
657	chrI	9558790	9562429	3500415441	119		9558790	9562429	8421504	6	24,24,15,12,10,34	0,44,3554,3575,3593,3605	g	350041544100000565,350041544100000568,350041544100000253,350041544100000252	7-77,7-77,0-85,1-85						Genomic tRNA Database: Caenorhabditis brenneri (WUGSC 4.0 Jan 2007)	gtrnadb.ucsc.edu	0	0		
658	chrI	9573893	9573916	3500365490	23		9573893	9573916	8421504	1	23	0	c	350036549000000061	20-43						Process For The Production Of Delta5-unsaturated Fatty Acids In Transgenic Organisms 	.freshpatents.com	0	0		
658	chrI	9573893	9573916	3500354733	23		9573893	9573916	8421504	1	23	0	c	350035473300000061	20-43						 Process For The Production Of .DELTA.5 	www.docstoc.com	0	0		
658	chrI	9574323	9574352	3500030276	24		9574323	9574352	8421504	2	7,17	0,12	c	350003027600000272	0-24						<Html><Title> Complet list of 7ccp hssp file Complet list of	cnptia.embrapa.br	0	0		
658	chrI	9575403	9575429	3500128195	24		9575403	9575429	8421504	2	18,6	0,20	c	350012819500000586	10-34						degree Philosophiae Doctor in the Department of Plant Sciences (Plant Breeding) November 2010 Promotor: Prof. Liezel Herselman (PhD)	etd.uovs.ac.za	0	0		
658	chrI	9577718	9581259	3500283493	58		9577718	9581259	8421504	2	30,28	0,3513	c,g	350028349300000003,350028349300000002,350028349300000002	10-40,12-40,12-40		22383942	10.1371/journal.pone.0024555		PLoS ONE	LEM-3 – A LEM Domain Containing Nuclease Involved in the DNA Damage Response in C. elegans	Christina	2012	0		
658	chrI	9580936	9580963	3500410430	24		9580936	9580963	8421504	2	15,9	0,18	c	350041043000000015	2-26						Quantitative trait loci (QTLs) for resistance to gray leaf spot and common rust diseases of maize	www.ajol.info	0	0		
658	chrI	9580936	9580963	3500030332	24		9580936	9580963	8421504	2	15,9	0,18	c	350003033200000015	2-26						Quantitative trait loci (QTLs) for resistance to gray leaf spot and common rust diseases of maize	demicjournals.org	0	0		
658	chrI	9585412	9587126	3500266469	164		9585412	9587126	8421504	10	21,20,14,7,20,20,14,7,20,21	0,491,535,595,605,1054,1098,1158,1640,1693	c,g	350026646900000000,350026646900000014,350026646900000014,350026646900000001,350026646900000002,350026646900000002,350026646900000015,350026646900000015,350026646900000003,350026646900000016,350026646900000016,350026646900000005,350026646900000005	5-26,0-20,0-20,14-35,2-22,2-22,0-20,0-20,13-34,0-20,0-20,10-31,10-31						Polymerase recognition of synthetic oligodeoxyribonucleotides incorporating degenerate pyrimidine and purine bases	www.pnas.org	0	0		
658	chrI	9585412	9587126	3500103983	164		9585412	9587126	8421504	10	21,20,14,7,20,20,14,7,20,21	0,491,535,595,605,1054,1098,1158,1640,1693	c,g	350010398300000000,350010398300000008,350010398300000008,350010398300000001,350010398300000002,350010398300000002,350010398300000009,350010398300000009,350010398300000003,350010398300000010,350010398300000010,350010398300000005,350010398300000005	5-26,0-20,0-20,14-35,2-22,2-22,0-20,0-20,13-34,0-20,0-20,10-31,10-31		9539724		0027-8424	Proceedings of the National Academy of Sciences	Polymerase recognition of synthetic oligodeoxyribonucleotides incorporating degenerate pyrimidine and purine bases	Hill	1998	10		
658	chrI	9587015	9587105	3500356950	90		9587015	9587105	8421504	1	90	0	p	350035695000015070	0-90						Nukleokapszid-dUTPáz, egy retrovirális fehérje szerkezete és funkciója	www.enzim.hu	0	0		
658	chrI	9600620	9600646	3500393941	25		9600620	9600646	8421504	2	14,11	0,15	g	350039394100000014	22-47						US Patent # 5,477,001. Recombinant DNA coding for a novel protein having .beta.-1,3-glucanase activity, bacteria containing this DNA, transformed plant cells and plants - Patents.com	www.patents.com	0	0		
658	chrI	9608897	9608925	3500261362	25		9608897	9608925	8421504	2	13,12	0,16	c	350026136200000027	6-31						Supporting Tables 	www.pnas.org	0	0		CP
658	chrI	9618397	9618445	3500314150	48		9618397	9618445	8421504	1	48	0	p	350031415000015000	3-51						Supporting Information 	www.pnas.org	0	0		
658	chrI	9619891	9622474	3500039132	205		9619891	9622474	8421504	8	21,51,22,21,23,24,23,20	0,309,579,1059,1896,2083,2280,2563	c,g	350003913200000000,350003913200000026,350003913200000027,350003913200000045,350003913200000045,350003913200000002,350003913200000002,350003913200000052,350003913200000052,350003913200000003,350003913200000003,350003913200000028,350003913200000028,350003913200000001	0-21,11-35,6-33,11-33,11-33,0-21,0-21,17-40,17-40,0-24,0-24,8-31,8-31,0-20						Funktionelle Charakterisierung zweier Levamisolrezeptor-assoziierter Proteine in C. elegans – NRA-2 und NRA-4	.uni-frankfurt.de	0	0		
658	chrI	9633554	9633579	3500161043	23		9633554	9633579	8421504	3	5,4,14	0,6,11	g	350016104300000368	0-23						PRODUCTION OF SIALYLATED N-GLYCANS IN LOWER EUKARYOTES - Patent application	www.faqs.org	0	0		
658	chrI	9634050	9662398	3500167682	41		9634050	9662398	8421504	2	22,19	0,28329	c	350016768200000303,350016768200000722	7-31,2-21						METHODS AND COMPOSITIONS FOR TARGETED POLYNUCLEOTIDE MODIFICATION - Patent application	www.faqs.org	0	0		
658	chrI	9658420	9659639	3500274631	88		9658420	9659639	8421504	4	23,20,20,25	0,1058,1149,1194	c,g	350027463100000005,350027463100000000,350027463100000001,350027463100000001,350027463100000004,350027463100000004	0-23,0-20,0-20,0-20,0-25,0-25						ScienceDirect.com - Developmental Biology - Functional redundancy of two C. elegans homologs of the histone chaperone Asf1 in germline DNA replication	sciencedirect.com	0	0		
658	chrI	9659569	9659639	3500277233	45		9659569	9659639	8421504	2	20,25	0,45	c,g	350027723300000001,350027723300000001,350027723300000004,350027723300000004	0-20,0-20,0-25,0-25		19233156			Developmental Biology	Functional redundancy of two C. elegans homologs of the histone chaperone Asf1 in germline DNA replication.	Grigsby	2009	0		
658	chrI	9663158	9692017	3500344389	42		9663158	9692017	8421504	3	18,5,19	0,19,28840	g	350034438900000499,350034438900000188	7-30,10-29						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
658	chrI	9664435	9664462	3500466198	23		9664435	9664462	8421504	2	13,10	0,17	g	350046619800000237	16-40						#QUERY: #Match: All #Classification: Transcription factor #PDB_ID ENTRY_ID PUBMED_ID RESOLUTION SPEC	melolab.org	0	0		
658	chrI	9664435	9664462	3500420633	23		9664435	9664462	8421504	2	13,10	0,17	g	350042063300000050	16-40						#QUERY: #Match: All #Type: Zinc Coordinating #PDB_ID ENTRY_ID PUBMED_ID RESOLUTION SPECIES MULTICOMP	melolab.org	0	0		
658	chrI	9666807	9666878	3500437423	23		9666807	9666878	8421504	3	7,15,1	0,11,70	c	350043742300000506	2-25						Multiple Gene Expression Including sORF Constructs and Methods with Polyproteins, Pro-Proteins and Proteolysis - Patent application	www.faqs.org	0	0		
658	chrI	9666807	9666878	3500251828	23		9666807	9666878	8421504	3	7,15,1	0,11,70	c	350025182800000513	2-25						Multiple Gene Expression Including sORF Constructs and Methods with Polyproteins, Pro-Proteins and Proteolysis - Patent application	www.faqs.org	0	0		
658	chrI	9667159	9667467	3500350443	100		9667159	9667467	8421504	2	50,50	0,258	c,g	350035044300000169,350035044300000169,350035044300000168,350035044300000168	0-50,0-50,0-50,0-50						OLIGONUCLEOTIDE ANALOGUES FOR DETECTING AND ANALYZING NUCLEIC ACIDS - Exiqon, A/s	www.sumobrain.com	0	0		
658	chrI	9687859	9688083	3500249133	100		9687859	9688083	8421504	2	50,50	0,174	c,g	350024913300000015,350024913300000015,350024913300000016,350024913300000016	0-50,0-50,0-50,0-50							roarrays.ucsd.edu	0	0		
658	chrI	9690193	9690217	3500113941	23		9690193	9690217	8421504	2	9,14	0,10	g	350011394100000001	2-25		17060451	10.1128/MCB.00811-06	0270-7306	Molecular and Cellular Biology	Gbx2 and Otx2 Interact with the WD40 Domain of Groucho/Tle Corepressors	Heimbucher	2007	6		
82	chrI	9691546	9706398	3500199912	38		9691546	9706398	8421504	3	6,13,19	0,9,14833	g	350019991200000002,350019991200000451	13-32,0-19						cons SSR Table ESM S2 primer seqs	wheat.pw.usda.gov	0	0		
659	chrI	9715623	9728099	3500446855	2307		9715623	9728099	8421504	14	125,107,136,400,45,69,259,362,294,118,129,156,58,49	0,168,324,802,1694,1967,2564,3185,3863,4695,4939,5118,12301,12427	c,g	350044685500000005,350044685500000082,350044685500000082,350044685500000019,350044685500000019,350044685500000081,350044685500000080,350044685500000078,350044685500000078,350044685500000077,350044685500000076,350044685500000076,350044685500000075,350044685500000075,350044685500000074,350044685500000074,350044685500000018,350044685500000018,350044685500000073,350044685500000073,350044685500000072,350044685500000072,350044685500000071	0-2300,0-45,0-45,0-408,0-408,48-120,0-62,0-60,0-60,60-120,60-120,0-60,59-120,59-120,59-120,59-120,126-355,126-355,0-61,0-61,56-117,56-117,0-60						Étude de la fonction des Rho GAP au cours du développement embryonnaire du nématode caenorhabditis elegans	.archipel.uqam.ca	0	0		
659	chrI	9719323	9719351	3500125682	25		9719323	9719351	8421504	2	6,19	0,9	g	350012568200000370	14-39						<Html><Title> Complet list of 1lqa hssp file Complet list of	cnptia.embrapa.br	0	0		
659	chrI	9722916	9723167	3500301109	135		9722916	9723167	8421504	4	45,21,24,45	0,48,179,206	p	350030110900015054,350030110900015055,350030110900015056	0-45,0-45,0-45						CONFORMATION AND ACTIVITY OF GBETA5 COMPLEXES - Patent application	www.faqs.org	0	0		
659	chrI	9743022	9743048	3500244146	23		9743022	9743048	8421504	2	14,9	0,17	c,g	350024414600000066,350024414600000066	20-48,20-48						Recombinant equine herpesviruses	Chiang	1997	0		
659	chrI	9754363	9756418	3500116466	1173		9754363	9756418	8421504	9	61,98,257,136,70,165,125,137,124	0,399,551,857,1240,1361,1574,1748,1931	p	350011646600015123	0-1173						Litopenaeus_vannamei-Contig_3669-v1 | MarineGenomics.org	arinegenomics.org	0	0		
659	chrI	9754810	9754915	3500161519	46		9754810	9754915	8421504	3	20,25,1	0,25,104	c	350016151900000045,350016151900000046	0-20,0-26						Cell, Volume 136	download.cell.com	0	0		
659	chrI	9759888	9759912	3500123171	23		9759888	9759912	8421504	2	6,17	0,7	g	350012317100000094	18-41						Appendix 1. Full-length and proximal promoter fluorescence data, genomic fragment locations, and primer sequences. Fluorescence Data: Gene Fragment Size (bp) Genomic Location (Mus; mm8) eGFP MFI CAR2 (R) 1500 1502 chr3:14861967-14863468 4.04 2.29 NM 00980	www.molvis.org	0	0		
659	chrI	9785926	9785992	3500135994	66		9785926	9785992	8421504	1	66	0	p	350013599400015000	0-66						熊本大学学術リポジトリ Kumamoto University Repository System	.kumamoto-u.ac.jp	0	0		
659	chrI	9786179	9786217	3500338097	38		9786179	9786217	8421504	1	38	0	c,g	350033809700000408,350033809700000408,350033809700004029,350033809700004029,350033809700001985,350033809700001985,350033809700005579,350033809700005579	7-45,7-45,17-51,17-51,0-34,0-34,19-51,19-51						 Galaxy | Dataset | FASTQ Groomer on data 1	popgenie.org:8080	0	0		
659	chrI	9786179	9786217	3500009376	38		9786179	9786217	8421504	1	38	0	c,g	350000937600004180,350000937600004180,350000937600001096,350000937600001096,350000937600004831,350000937600004831	18-51,18-51,0-35,0-35,21-51,21-51						 Galaxy | Dataset | FASTQ Groomer on data 2	popgenie.org:8080	0	0		
659	chrI	9786318	9786344	3500178361	26		9786318	9786344	8421504	1	26	0	c	350017836100000008	28-54						 SpringerImages - Primer sequences for candidate normalization genes. 	pringerimages.com	0	0		
659	chrI	9786318	9786344	3500140879	26		9786318	9786344	8421504	1	26	0	c	350014087900000008	28-54						BMC Molecular Biology BioMed Central	biomedcentral.com	0	0		
659	chrI	9786361	9786521	3500463133	48		9786361	9786521	8421504	2	24,24	0,136	c,g	350046313300000032,350046313300000032,350046313300000031,350046313300000031	0-24,0-24,0-24,0-24						RNA Helicase 1 interacts with an ABC Transporter: Genetic Interactions with haf-6	holarworks.ku.edu	0	0		
659	chrI	9786893	9787215	3500359022	40		9786893	9787215	8421504	2	20,20	0,302	c,g	350035902200000000,350035902200000000,350035902200000001,350035902200000001	0-20,0-20,0-20,0-20					Aging (Albany NY)	Klotho interferes with a novel FGF-signalling pathway and insulin/Igf-like signalling to improve longevity and stress resistance in Caenorhabditis elegans	Marie-Therese	2010	0		
659	chrI	9786978	9787293	3500017433	84		9786978	9787293	8421504	3	5,53,26	0,8,289	c,g	350001743300000033,350001743300000061	19-284,0-26						CONTROL OF PESTS IN PLANTS - Patent application	www.faqs.org	0	0		
659	chrI	9788731	9789236	3500014227	45		9788731	9789236	8421504	2	20,25	0,480	c,g	350001422700000011,350001422700000012	0-20,2-27						Methods for Incorporating Unnatural Amino Acids in Eukaryotic Cells	Chin	2011	0		
659	chrI	9813086	9813112	3500443211	24		9813086	9813112	8421504	3	14,4,6	0,15,20	c	350044321100001568	4-28						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
659	chrI	9813534	9813561	3500254468	23		9813534	9813561	8421504	2	10,13	0,14	g	350025446800000343	0-23						ENGINEERED MICROORGANISMS WITH ENHANCED FERMENTATION ACTIVITY - Patent application	www.faqs.org	0	0		
659	chrI	9813534	9813561	3500233096	23		9813534	9813561	8421504	2	10,13	0,14	g	350023309600000108	0-23						ENGINEERED MICROORGANISMS WITH ENHANCED FERMENTATION ACTIVITY - VERDEZYNE, INC.	www.sumobrain.com	0	0		
659	chrI	9813534	9813561	3500194838	23		9813534	9813561	8421504	2	10,13	0,14	g	350019483800000343	0-23						 Engineered Microorganisms With Enhanced Fermentation Activity 	www.docstoc.com	0	0		
659	chrI	9813534	9813561	3500129335	23		9813534	9813561	8421504	2	10,13	0,14	g	350012933500000100	0-23						COMBINATORIAL METHODS FOR OPTIMIZING ENGINEERED MICROORGANISM FUNCTION - Patent application	www.faqs.org	0	0		
659	chrI	9815682	9815715	3500168119	28		9815682	9815715	8421504	3	5,5,18	0,8,15	c	350016811900000430	0-28						<Html><Title> Complet list of 2yvg hssp file Complet list of	cnptia.embrapa.br	0	0		
660	chrI	9862075	9862113	3500138125	29		9862075	9862113	8421504	3	14,7,8	0,19,30	g	350013812500000238	0-29						<Html><Title> Complet list of 1kxn hssp file Complet list of	cnptia.embrapa.br	0	0		
660	chrI	9871220	9874115	3500276765	906		9871220	9874115	8421504	14	96,69,25,23,48,48,45,51,144,144,33,111,48,21	0,682,799,1464,1535,1679,1775,1869,1968,2208,2400,2481,2730,2874	c,g	350027676500000161,350027676500000162,350027676500000162,350027676500000163,350027676500000164,350027676500000166,350027676500000168,350027676500000171,350027676500000173,350027676500000174,350027676500000174,350027676500000176,350027676500000177,350027676500000177,350027676500000178,350027676500000181,350027676500000182,350027676500000183,350027676500000183,350027676500000185,350027676500000186,350027676500000187,350027676500000188,350027676500000191,350027676500000191	27-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-21,0-21						Products and Methods Related to Mono-Methyl Branched-Chain Fatty Acids - Patent application	www.faqs.org	0	0		
660	chrI	9880372	9880595	3500423818	24		9880372	9880595	8421504	3	18,3,3	0,23,220	c	350042381800000313	2-27						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
660	chrI	9889229	9889258	3500415388	24		9889229	9889258	8421504	2	10,14	0,15	c	350041538800000107	10-34						Dna molecules that code for enzymes involved in starch synthesis, vectors, bacteria, transgenic plant cells and plants containing said molecules	Abel	1996	0		
660	chrI	9889229	9889258	3500402317	24		9889229	9889258	8421504	2	10,14	0,15	c	350040231700000055	10-34						US Patent # 6,130,367. DNA molecules that code for enzymes involved in starch synthesis, vectors, bacteria, transgenic plant cells and plants containing said molecules - Patents.com	www.patents.com	0	0		
660	chrI	9889229	9889258	3500254907	24		9889229	9889258	8421504	2	10,14	0,15	c	350025490700000055	10-34					Patent	DNA molecules that code for enzymes involved in starch synthesis, vectors, bacteria, transgenic plant cells and plants containing said molecules (Patent US:6130367)	Abel	2000	0		
660	chrI	9889229	9889258	3500000031	24		9889229	9889258	8421504	2	10,14	0,15	c	350000003100000107	10-34						Dna molecules that code for enzymes involved in starch synthesis, vectors, bacteria, transgenic plant cells and plants containing said molecules	Abel	1997	0		
660	chrI	9889480	9889506	3500410981	23		9889480	9889506	8421504	2	13,10	0,16	g	350041098100000002	0-23		21896186	10.1186/1471-2229-11-125		BMC Plant Biology	Localization of DIR1 at the tissue, cellular and subcellular levels during Systemic Acquired Resistance in Arabidopsis using DIR1:GUS and DIR1:EGFP reporters	Marc	2011	0		
660	chrI	9906342	9906371	3500297988	25		9906342	9906371	8421504	3	11,3,11	0,12,18	g	350029798800002979	12-37						Plate Row Column ID Name Opt1 Opt2 1 A 1 b0014 dnaK GGGTAAAATAATTGGTATCGACCTGGGTACTACCAACTCTTGTGTAG	ology.ualberta.ca	0	0		
660	chrI	9937171	9955617	3500160947	17653		9937171	9955617	8421504	262	60,55,57,57,55,55,56,55,58,52,56,55,55,54,55,57,55,58,58,58,58,58,58,58,58,60,56,59,60,54,59,58,58,57,58,57,57,55,55,55,56,55,55,55,52,59,56,53,56,55,57,59,55,57,55,56,54,56,55,55,55,57,54,54,57,56,53,58,60,54,56,55,55,55,55,56,55,55,54,56,56,55,56,54,57,57,57,55,55,55,56,55,55,55,55,54,57,55,54,56,56,58,57,57,55,56,55,53,57,55,56,56,54,55,55,54,57,58,55,56,58,55,55,55,56,55,55,53,58,54,57,54,55,54,58,57,55,56,56,55,56,55,55,56,54,56,55,55,55,55,57,57,57,57,55,55,56,55,55,55,56,55,55,55,54,57,56,58,59,59,60,58,61,57,61,58,58,423,55,59,59,60,58,64,54,59,59,60,58,59,60,58,720,60,59,57,60,59,58,63,535,59,59,63,475,61,57,419,120,60,60,58,57,61,59,56,59,59,60,119,59,59,299,119,118,59,59,59,59,59,59,60,58,59,62,57,58,60,59,58,60,58,60,58,59,60,58,59,59,59,60,58,60,59,59,58,61,57,59,60,58,25	0,65,123,183,245,304,364,425,485,548,604,665,725,785,844,903,965,1022,1082,1142,1202,1262,1322,1382,1442,1502,1564,1622,1683,1745,1801,1862,1922,1982,2042,2103,2163,2225,2285,2345,2404,2465,2525,2585,2645,2701,2765,2826,2884,2945,3003,3063,3125,3183,3245,3304,3365,3424,3485,3545,3604,3664,3726,3785,3844,3905,3966,4022,4083,4146,4204,4265,4325,4385,4445,4504,4565,4625,4685,4744,4804,4865,4925,4986,5043,5103,5163,5225,5285,5345,5404,5465,5525,5585,5645,5704,5763,5825,5885,5944,6003,6062,6123,6183,6245,6304,6365,6425,6483,6545,6604,6665,6726,6785,6845,6904,6963,7023,7084,7142,7202,7265,7325,7385,7445,7505,7565,7625,7683,7746,7804,7866,7925,7985,8042,8103,8163,8223,8284,8345,8404,8465,8525,8585,8646,8704,8765,8825,8885,8945,9003,9063,9123,9183,9245,9304,9364,9425,9485,9545,9604,9665,9725,9785,9845,9903,9965,10022,10081,10141,10201,10262,10321,10383,10441,10503,10562,10621,11045,11101,11161,11221,11282,11341,11406,11461,11521,11581,11642,11701,11761,11822,11881,12602,12664,12724,12782,12843,12903,12962,13026,13562,13622,13682,13746,14222,14284,14342,14762,14883,14944,15005,15064,15122,15184,15244,15301,15361,15421,15482,15602,15662,15722,16022,16142,16261,16321,16381,16441,16501,16561,16621,16682,16741,16801,16864,16922,16981,17042,17102,17161,17222,17281,17342,17401,17461,17522,17581,17641,17701,17761,17822,17881,17942,18002,18062,18121,18183,18241,18301,18362,18421	c,g	350016094700000067,350016094700000068,350016094700000100,350016094700000032,350016094700000101,350016094700000101,350016094700000033,350016094700000033,350016094700000103,350016094700000103,350016094700000035,350016094700000035,350016094700000040,350016094700000040,350016094700000111,350016094700000111,350016094700000045,350016094700000045,350016094700000108,350016094700000042,350016094700000109,350016094700000043	0-17608,0-3056,0-19,0-19,0-22,0-22,0-22,0-22,0-22,0-22,0-22,0-22,0-20,0-20,0-19,0-19,0-19,0-19,0-22,0-22,0-19,0-19						US Patent # 7,442,501. SQV nucleic acids and polypeptides - Patents.com	www.patents.com	0	0		
660	chrI	9949083	9952694	3500348818	1614		9949083	9952694	8421504	40	39,45,45,45,45,45,45,45,45,45,45,2,43,45,45,45,45,45,45,45,6,39,45,45,45,45,45,45,2,43,45,45,45,45,45,42,3,45,45,45	0,42,90,138,186,234,387,435,531,579,627,675,1117,1211,1259,1307,1355,1451,1499,1547,1595,1849,1939,1987,2035,2083,2179,2227,2275,2477,2523,2619,2667,2715,2763,2909,3464,3470,3518,3566	p	350034881800015103,350034881800015104,350034881800015105,350034881800015106,350034881800015107,350034881800015108,350034881800015110,350034881800015111,350034881800015113,350034881800015114,350034881800015115,350034881800015116,350034881800015118,350034881800015119,350034881800015120,350034881800015121,350034881800015123,350034881800015124,350034881800015125,350034881800015126,350034881800015128,350034881800015129,350034881800015130,350034881800015131,350034881800015133,350034881800015134,350034881800015135,350034881800015136,350034881800015138,350034881800015139,350034881800015140,350034881800015141,350034881800015143,350034881800015144,350034881800015145,350034881800015146	6-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45						Chondroitin synthase, method for producing the same and method for producing saccharide chain-extended chondroitin - Patent application	www.faqs.org	0	0		
661	chrI	9977006	9977306	3500280352	249		9977006	9977306	8421504	2	79,170	0,130	p	350028035200015013	0-249							y.engin.umich.edu	0	0		
661	chrI	9977006	9977306	3500051404	249		9977006	9977306	8421504	2	79,170	0,130	p	350005140400015012	0-249						README for stand-alone BLAST (last updated 7/30/99) This document provides information on s	io.lundberg.gu.se	0	0		
661	chrI	9978182	9978378	3500463133	48		9978182	9978378	8421504	2	24,24	0,172	c,g	350046313300000030,350046313300000030,350046313300000029,350046313300000029	0-24,0-24,0-24,0-24						RNA Helicase 1 interacts with an ABC Transporter: Genetic Interactions with haf-6	holarworks.ku.edu	0	0		
661	chrI	9988566	9988593	3500453753	24		9988566	9988593	8421504	3	12,8,4	0,14,23	c	350045375300000030	17-41						Recombinant xylanases	Gilbert	1993	0		
661	chrI	9999918	9999950	3500413169	32		9999918	9999950	8421504	1	32	0	g	350041316900000002	46-78						Supporting Information 	www.pnas.org	0	0		
661	chrI	10005272	10005300	3500176312	28		10005272	10005300	8421504	1	28	0	g	350017631200000004	8-36						Combinatorial expression of split caspase molecules	Chelur	2006	0		
661	chrI	10022275	10071043	3500168547	60		10022275	10071043	8421504	6	20,14,6,5,10,5	0,40789,40805,48702,48708,48763	c,g	350016854700000078,350016854700000633,350016854700000048	8-28,0-20,1-21						Periphere CD4-positive T-Zellantworten bei	opus4.kobv.de	0	0		
661	chrI	10033004	10035769	3500014036	2765		10033004	10035769	8421504	1	2765	0	p,c,g	350001403600000078,350001403600000077,350001403600000077,350001403600000076,350001403600000026,350001403600000075,350001403600000074,350001403600000073,350001403600000072,350001403600000023,350001403600000096,350001403600015083,350001403600015043,350001403600000022,350001403600000022,350001403600000071,350001403600000071,350001403600015082,350001403600015042,350001403600000021,350001403600000021,350001403600015041,350001403600000020,350001403600000020,350001403600000070,350001403600000069,350001403600015080,350001403600015040,350001403600000019,350001403600000019,350001403600000068,350001403600000068,350001403600015079,350001403600000018,350001403600000018,350001403600015039,350001403600000017,350001403600000017,350001403600015038,350001403600015078,350001403600000067,350001403600000067,350001403600000016,350001403600000016,350001403600015037,350001403600000066,350001403600000015,350001403600000015,350001403600015036,350001403600000065,350001403600015077,350001403600000014,350001403600000014,350001403600015035,350001403600000095,350001403600000013,350001403600000064,350001403600000063,350001403600000062,350001403600000061	0-65,0-102,0-102,0-100,0-36,0-101,0-300,0-701,0-100,0-61,8-30,0-45,0-60,0-60,0-60,0-108,0-108,0-99,0-60,0-60,0-60,0-60,0-60,0-60,0-100,0-100,0-54,0-60,0-60,0-60,0-106,0-106,0-99,0-62,0-62,0-60,0-60,0-60,0-60,0-102,0-100,0-100,0-60,0-60,0-60,0-100,0-60,0-60,0-60,0-100,0-99,0-60,0-60,0-60,12-34,11-60,0-100,0-901,0-100,0-503						Edouard de Castro's Ph.D. thesis	www.scribd.com	0	0		
82	chrI	10035327	10277383	3500443014	707		10035327	10277383	8421504	14	51,50,50,51,51,49,52,50,50,51,51,48,53,50	0,574,800,1120,61883,62044,149242,149358,200000,200198,229923,230455,241761,242006	g	350044301400000007,350044301400000000	0-707,0-80						R输入输出 ← 糗世界	pgfe.umassmed.edu	0	0		
82	chrI	10035327	10277383	3500152442	707		10035327	10277383	8421504	14	51,50,50,51,51,49,52,50,50,51,51,48,53,50	0,574,800,1120,61883,62044,149242,149358,200000,200198,229923,230455,241761,242006	g	350015244200000007,350015244200000000	0-707,0-80						R输入输出 - xiaofeng1982的日志 - 网易博客	1982.blog.163.com	0	0		
661	chrI	10036127	10036498	3500443014	80		10036127	10036498	8421504	2	40,40	0,331	g	350044301400000001	0-80						R输入输出 ← 糗世界	pgfe.umassmed.edu	0	0		
661	chrI	10036127	10036498	3500152442	80		10036127	10036498	8421504	2	40,40	0,331	g	350015244200000001	0-80						R输入输出 - xiaofeng1982的日志 - 网易博客	1982.blog.163.com	0	0		
661	chrI	10040011	10040038	3500325148	24		10040011	10040038	8421504	2	18,6	0,21	c	350032514800000063	0-24						Development and use of microsatellites markers for genetic variation analysis, in the Namibian germplasm, both within and between populations of marama bean Tylosema esculentum	demicjournals.org	0	0		
661	chrI	10047963	10047990	3500196959	23		10047963	10047990	8421504	2	16,7	0,20	g	350019695900000994	10-43						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
661	chrI	10062789	10062814	3500409181	23		10062789	10062814	8421504	2	6,17	0,8	g	350040918100000295	13-36						Caax prenyl protease nucleic acids and polypeptides and methods of use thereof	Campbell	2003	0		
661	chrI	10062789	10062814	3500117331	23		10062789	10062814	8421504	2	6,17	0,8	g	350011733100000374	13-36						Stress Tolerance and Delayed Senescence in Plants - Patent application	www.faqs.org	0	0		
661	chrI	10077660	10079698	3500430514	64		10077660	10079698	8421504	3	24,20,20	0,1214,2018	g	350043051400000002,350043051400000000,350043051400000001	0-24,0-20,0-20		21245313	10.1073/pnas.1018695108	0027-8424	Proceedings of the National Academy of Sciences	mut-16 and other mutator class genes modulate 22G and 26G siRNA pathways in Caenorhabditis elegans	Zhang	2011	10		
661	chrI	10078874	10079698	3500191777	40		10078874	10079698	8421504	2	20,20	0,804	g	350019177700000000,350019177700000001	0-20,0-20						mut-16 and other mutator class genes modulate 22G and 26G siRNA pathways in Caenorhabditis elegans	www.pnas.org	0	0		
661	chrI	10078874	10079698	3500045199	40		10078874	10079698	8421504	2	20,20	0,804	g	350004519900000000,350004519900000001	0-20,0-20						Lysosomal proteins GLO-1 and GLO-4 are involved in RNA interference in C. elegans	www.ibg.uu.se	0	0		
662	chrI	10097210	10097421	3500443014	80		10097210	10097421	8421504	2	40,40	0,171	g	350044301400000002	0-80						R输入输出 ← 糗世界	pgfe.umassmed.edu	0	0		
662	chrI	10097210	10097421	3500152442	80		10097210	10097421	8421504	2	40,40	0,171	g	350015244200000002	0-80						R输入输出 - xiaofeng1982的日志 - 网易博客	1982.blog.163.com	0	0		
662	chrI	10105612	10105635	3500442415	23		10105612	10105635	8421504	1	23	0	g	350044241500000008	10-33						Evaluation of genetic markers for prediction of preharvest sprouting tolerance in hard white winter wheats	aldc.nal.usda.gov	0	0		
662	chrI	10184570	10184735	3500443014	80		10184570	10184735	8421504	2	40,40	0,125	g	350044301400000003	0-80						R输入输出 ← 糗世界	pgfe.umassmed.edu	0	0		
662	chrI	10184570	10184735	3500152442	80		10184570	10184735	8421504	2	40,40	0,125	g	350015244200000003	0-80						R输入输出 - xiaofeng1982的日志 - 网易博客	1982.blog.163.com	0	0		
662	chrI	10185783	10187474	3500052757	41		10185783	10187474	8421504	2	21,20	0,1671	g	350005275700000004,350005275700000005	18-39,18-38					Patent	Use of eukaryotic genes affecting spindle formation or microtubule function during cell division for diagnosis and treatment of proliferative diseases (Patent US:7479369)	Echeverri	2009	0		
662	chrI	10186335	10186427	3500161519	45		10186335	10186427	8421504	2	10,35	0,57	c,g	350016151900000039,350016151900000040,350016151900000040	0-23,0-22,0-22						Cell, Volume 136	download.cell.com	0	0		
662	chrI	10186860	10186887	3500426115	24		10186860	10186887	8421504	3	7,4,13	0,9,14	g	350042611500000972	3-30						ENGINEERED MICROORGANISMS WITH ENHANCED FERMENTATION ACTIVITY - Patent application	www.faqs.org	0	0		
662	chrI	10186860	10186887	3500291332	24		10186860	10186887	8421504	3	7,4,13	0,9,14	g	350029133200000425	3-30						Engineered microorganisms with enhanced fermentation activity	Picataggio	2011	0		
662	chrI	10186860	10186887	3500254468	24		10186860	10186887	8421504	3	7,4,13	0,9,14	g	350025446800000964	3-30						ENGINEERED MICROORGANISMS WITH ENHANCED FERMENTATION ACTIVITY - Patent application	www.faqs.org	0	0		
662	chrI	10186860	10186887	3500233096	24		10186860	10186887	8421504	3	7,4,13	0,9,14	g	350023309600000425	3-30						ENGINEERED MICROORGANISMS WITH ENHANCED FERMENTATION ACTIVITY - VERDEZYNE, INC.	www.sumobrain.com	0	0		
662	chrI	10186860	10186887	3500194838	24		10186860	10186887	8421504	3	7,4,13	0,9,14	g	350019483800000972	3-30						 Engineered Microorganisms With Enhanced Fermentation Activity 	www.docstoc.com	0	0		
662	chrI	10186860	10186887	3500099901	24		10186860	10186887	8421504	3	7,4,13	0,9,14	g	350009990100000679	3-30						ENGINEERED MICROORGANISMS WITH ENHANCED FERMENTATION ACTIVITY - Patent application	www.faqs.org	0	0		
662	chrI	10187405	10187459	3500102183	54		10187405	10187459	8421504	1	54	0	p	350010218300015000	0-54			10.1016/j.cell.2006.10.050		Cell	The RSA complex targets Protein Phosphatase 2A to centrosomes and regulates mitotic spindle assembly in C. elegans	Anne-Lore	2007	0		
663	chrI	10228096	10228119	3500081929	23		10228096	10228119	8421504	1	23	0	g	350008192900000000	0-23						Y106G6E.5 (ced-12): sEx11990 | Flickr - Photo Sharing!	www.flickr.com	0	0		
663	chrI	10232271	10232298	3500372468	24		10232271	10232298	8421504	3	5,4,15	0,7,12	g	350037246800000019,350037246800000042	8-32,8-32						INTERFERON ANTAGONISTS, ANTIBODIES THERETO AND ASSOCIATED METHODS OF USE - Patent application	www.faqs.org	0	0		
663	chrI	10235327	10277383	3500443014	240		10235327	10277383	8421504	6	40,40,41,39,40,40	0,209,29923,30466,41763,42016	c,g	350044301400000004,350044301400000005,350044301400000005,350044301400000006,350044301400000006	0-80,0-80,0-80,0-80,0-80						R输入输出 ← 糗世界	pgfe.umassmed.edu	0	0		
663	chrI	10235327	10277383	3500152442	240		10235327	10277383	8421504	6	40,40,41,39,40,40	0,209,29923,30466,41763,42016	c,g	350015244200000004,350015244200000005,350015244200000005,350015244200000006,350015244200000006	0-80,0-80,0-80,0-80,0-80						R输入输出 - xiaofeng1982的日志 - 网易博客	1982.blog.163.com	0	0		
663	chrI	10248476	10251842	3500073945	453		10248476	10251842	8421504	5	86,129,139,91,8	0,292,1188,2682,3358	p,c,g	350007394500015011,350007394500000000,350007394500000000,350007394500015001,350007394500015006	0-453,24-45,24-45,0-177,0-189						The LIM Region of a Presumptive Caenorhabditis elegans Transcription Factor is an Iron-Sulfur- and Zinc-Containing Metallodomain	www.jstor.org	0	0		
663	chrI	10249797	10251215	3500402966	63		10249797	10251215	8421504	2	6,57	0,1361	p	350040296600015039	0-63						No. CHEMISTRY OF U.S.A. in of Characterization the TGFP1-inducible hie5 Its Putative Novel Zinc Finger Protein and Possible Involvement in	www.jbc.org	0	0		
663	chrI	10252233	10252256	3500235390	23		10252233	10252256	8421504	1	23	0	c	350023539000000007	8-31		12736204	10.1242/dev.00500	0950-1991	Development	The C. elegans LIM homeobox gene lin-11 specifies multiple cell fates during vulval development	Gupta	2003	7		
663	chrI	10252261	10254048	3500240572	180		10252261	10254048	8421504	3	42,102,36	0,365,1751	p	350024057200015010	135-606						Expression and regulation of Lhx6and Lhx7, a novel subfamily of LIM homeodomain encoding genes, suggests a role in mammalian head development	ev.biologists.org	0	0		
663	chrI	10304142	10304173	3500466198	25		10304142	10304173	8421504	3	4,14,7	0,5,24	g	350046619800000277	4-30						#QUERY: #Match: All #Classification: Transcription factor #PDB_ID ENTRY_ID PUBMED_ID RESOLUTION SPEC	melolab.org	0	0		
663	chrI	10304142	10304173	3500461998	25		10304142	10304173	8421504	3	4,14,7	0,5,24	g	350046199800000008	4-30						#QUERY: #Match: All #Type: Alpha/Beta #PDB_ID ENTRY_ID PUBMED_ID RESOLUTION SPECIES MULTICOMPLEXITY 	melolab.org	0	0		
663	chrI	10330005	10330055	3500039678	50		10330005	10330055	8421504	1	50	0	g	350003967800000001	0-50						Machine Learning for Genomic Sequence Analysis - (Wissenschaftliche Aussprache)	sonnenburgs.de	0	0		
663	chrI	10341004	10345639	3500252627	2355		10341004	10345639	8421504	8	160,586,339,249,253,261,262,245	0,614,1548,2254,2774,3237,3556,4390	p,g	350025262700000000,350025262700015000	0-2355,0-1974						aph-2encodes a novel extracellular protein required for GLP-1-mediated signaling	ev.biologists.org	0	0		
663	chrI	10348803	10348958	3500395114	40		10348803	10348958	8421504	2	20,20	0,135	c,g	350039511400000039,350039511400000039,350039511400000038,350039511400000038	0-20,0-20,0-20,0-20		23103171	10.1016/j.celrep.2012.09.019	2211-1247	Cell Reports	Cell Reports - Antagonism between MES-4 and Polycomb Repressive Complex 2 Promotes Appropriate Gene Expression in C. elegans Germ Cells	Gaydos	2012	0		
663	chrI	10348803	10348958	3500150118	40		10348803	10348958	8421504	2	20,20	0,135	c,g	350015011800000039,350015011800000039,350015011800000038,350015011800000038	0-20,0-20,0-20,0-20		23103171	10.1016/j.celrep.2012.09.019	2211-1247	Cell Reports	Cell Reports - Antagonism between MES-4 and Polycomb Repressive Complex 2 Promotes Appropriate Gene Expression in C. elegans Germ Cells	Gaydos	2012	0		
663	chrI	10349343	10349367	3500344284	23		10349343	10349367	8421504	2	19,4	0,20	g	350034428400000621	3-27						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
664	chrI	10356515	10356864	3500093196	234		10356515	10356864	8421504	2	78,156	0,193	p,c	350009319600015004,350009319600000004	0-234,0-234						PANDIT - PF02244	www.ebi.ac.uk	0	0		
664	chrI	10385911	10390391	3500334852	115		10385911	10390391	8421504	4	32,21,34,28	0,406,903,4452	c,g	350033485200000003,350033485200000003,350033485200000011,350033485200000011,350033485200000005,350033485200000005,350033485200000004,350033485200000004	0-32,0-32,0-21,0-21,0-34,0-34,0-28,0-28						Molecular characterization of the metabotropic glutamate receptor family in Caenorhabditis elegans. - ResearchGate	.researchgate.net	0	0		
664	chrI	10386482	10386674	3500173626	45		10386482	10386674	8421504	2	4,41	0,151	p	350017362600015046	3-48						Sequence Range: 1 to 2747 >HindIII >KpnI >BamHI CATGCATGCAGCGTTTACTTAAGCTTGGTACCGAGCTCGGATCCACTAGT >EcoRI >BstXI| CCAGTGTGGTGGAATTCACCATGAAGATGTTGACAAGACTGCAAGTTCTT METABOTROPIC GLUTAMATE > ACCTTAGCTTTGTTTTCAAAGGGATTTTTACTCTCTTTAGGGGACCATAA CTTTCTAAGGAGAG	www.cdna.org	0	0		
664	chrI	10394271	10394300	3500451247	24		10394271	10394300	8421504	2	15,9	0,20	g	350045124700000058	8-40						DNA encoding plant chitinases	Ryals	1995	0		
664	chrI	10394271	10394300	3500358504	24		10394271	10394300	8421504	2	15,9	0,20	g	350035850400000062	8-40						Inducible herbicide resistance	Ryals	1997	0		
664	chrI	10394271	10394300	3500156643	24		10394271	10394300	8421504	2	15,9	0,20	g	350015664300000056	8-40					Patent	DNA encoding plant chitinases (Patent US:5880328)	Frederich	1999	0		
664	chrI	10394271	10394300	3500139344	24		10394271	10394300	8421504	2	15,9	0,20	g	350013934400000063	8-40						DNA sequences encoding polypeptides having beta-1,3-glucanase activity	Meins	2001	0		
664	chrI	10394271	10394300	3500126685	24		10394271	10394300	8421504	2	15,9	0,20	g	350012668500000063	8-40						 DNA Sequences Encoding Polypeptides Having Beta 	www.docstoc.com	0	0		
664	chrI	10394271	10394300	3500086010	24		10394271	10394300	8421504	2	15,9	0,20	g	350008601000000030	8-40						 DNA Sequences Encoding SAR8.2 Proteins And Uses Thereof 	www.docstoc.com	0	0		
664	chrI	10399192	10400168	3500439137	693		10399192	10400168	8421504	3	366,177,150	0,592,826	p	350043913700015068,350043913700015066,350043913700015064,350043913700015062	0-162,0-180,0-177,0-174						Human proteins having transmembrane domains and DNAs encoding these proteins	Kato	2003	0		
664	chrI	10400042	10400066	3500173250	23		10400042	10400066	8421504	2	19,4	0,20	c,g	350017325000000277,350017325000000277	0-24,0-24						Engineered Listeria and methods of use thereof	Dubensky	2006	0		
664	chrI	10430498	10430524	3500026001	23		10430498	10430524	8421504	3	5,4,14	0,7,12	g	350002600100000149	3-27						US Patent # 6,887,988. Plant reproduction polynucleotides and methods of use - Patents.com	www.patents.com	0	0		
664	chrI	10431222	10431245	3500352303	23		10431222	10431245	8421504	1	23	0	g	350035230300000471	14-45						Anti-bacterial methods and materials	Holden	2000	0		
664	chrI	10433495	10435012	3500270920	195		10433495	10435012	8421504	4	45,48,56,46	0,946,1364,1471	p	350027092000015011,350027092000015005,350027092000015003,350027092000015002	0-45,0-48,0-48,0-54						Somatic sex determination in Caenorhabditis elegans is modulated by SUP-26 repression of tra-2 translation	mcdb.colorado.edu	0	0		
664	chrI	10464604	10464632	3500313071	24		10464604	10464632	8421504	3	6,13,5	0,9,23	g	350031307100000037	4-28						 <HTML> <HEAD><TITLE>a<<a<<a1c1cdegccoc3/4aaaC/a1/4a?a1/4aa<<aaa(c)a1aaaa3a1/2C/e3	www.j-tokkyo.com	0	0		
664	chrI	10475320	10475348	3500183215	23		10475320	10475348	8421504	2	15,8	0,20	g	350018321500000005	12-35		15788570	10.1091/mbc.E04-06-0483	1059-1524	Molecular Biology of the Cell	Glycoprotein gp130 of Dictyostelium discoideum Influences Macropinocytosis and Adhesion	Chia	2005	5		
665	chrI	10516177	10516411	3500197656	222		10516177	10516411	8421504	3	72,75,75	0,78,159	p	350019765600015067,350019765600015066,350019765600015065	0-72,0-75,0-75						Karakterisatie van neuromedine U-, tachykinine- en GnRH-verwante receptoren	w.scriptiebank.be	0	0		
665	chrI	10543692	10544679	3500237513	486		10543692	10544679	8421504	4	156,123,171,36	0,651,777,951	p	350023751300015078,350023751300015081,350023751300015083	0-180,9-186,0-135						50 human secreted proteins	Komatsoulis	2000	0		
665	chrI	10552744	10553783	3500079993	63		10552744	10553783	8421504	3	23,19,21	0,441,1018	c,g	350007999300000003,350007999300000005,350007999300000005,350007999300000004,350007999300000004	10-33,17-36,17-36,10-31,10-31		23900546	10.1242/dev.094011	0950-1991	Development	The NM23-H1/H2 homolog NDK-1 is required for full activation of Ras signaling in C. elegans	Masoudi	2013	7		
665	chrI	10563399	10563497	3500111863	45		10563399	10563497	8421504	2	36,9	0,89	p	350011186300015014	0-45						METHODS AND COMPOSITIONS FOR REGULATION OF STEM CELL SURVIVAL, PROLIFERATION, AND DIFFERENTIATION BY PROTEIN UBIQUITINATION - Patent application	www.faqs.org	0	0		
665	chrI	10565106	10566351	3500348901	41		10565106	10566351	8421504	2	20,21	0,1224	g	350034890100000000,350034890100000001	0-20,0-21		21930893	10.1101/gr.115626.110	1088-9051	Genome Research	A novel candidate cis-regulatory motif pair in the promoters of germline and oogenesis genes in C. elegans	Linhart	2012	14		
665	chrI	10565106	10566351	3500267063	41		10565106	10566351	8421504	2	20,21	0,1224	g	350026706300000000,350026706300000001	0-20,0-21		21930893	10.1101/gr.115626.110		Genome Research	A novel candidate cis-regulatory motif pair in the promoters of germline and oogenesis genes in C. elegans	Chaim	2012	0		
665	chrI	10566528	10566551	3500337432	23		10566528	10566551	8421504	1	23	0	c	350033743200001939	19-42						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
665	chrI	10566528	10566551	3500260606	23		10566528	10566551	8421504	1	23	0	c	350026060600002999	0-23						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
665	chrI	10580600	10580623	3500315721	23		10580600	10580623	8421504	1	23	0	c	350031572100000955	0-23						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
665	chrI	10586869	10588478	3500129768	61		10586869	10588478	8421504	2	25,36	0,1573	c,g	350012976800000016,350012976800000017	9-34,16-52		17942487	10.1242/dev.005363	0950-1991	Development	The C. elegans ROR receptor tyrosine kinase, CAM-1, non-autonomously inhibits the Wnt pathway	Green	2007	7		
665	chrI	10597505	10597538	3500237068	26		10597505	10597538	8421504	3	8,12,6	0,10,27	c,g	350023706800000022,350023706800000022	14-40,14-40						<?xml version="1.0" encoding="UTF-8"?> <!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD 	www.mdpi.com	0	0		
665	chrI	10604131	10604162	3500415441	31		10604131	10604162	8421504	1	31	0	g	350041544100000380,350041544100000378	43-75,43-75						Genomic tRNA Database: Caenorhabditis brenneri (WUGSC 4.0 Jan 2007)	gtrnadb.ucsc.edu	0	0		
665	chrI	10606254	10606278	3500254375	23		10606254	10606278	8421504	2	4,19	0,5	c	350025437500000017	1-24						High-resolution transcriptional analysis of the symbiotic plasmid of Rhizobiumsp. NGR234	enome.imb-jena.de	0	0		
83	chrI	10614684	10617841	3500063158	41		10614684	10617841	8421504	2	20,21	0,3136	c	350006315800000330,350006315800000246	5-25,14-35						Method for Producing Polyunsaturated C20 and C22 Fatty Acids with at Least Four Double Bonds in Transgenic Plants - Patent application	www.faqs.org	0	0		
666	chrI	10646132	10646157	3500143000	23		10646132	10646157	8421504	2	10,13	0,12	g	350014300000000003	0-23						竹嵌紋病毒移動蛋白基因變異之探討 －與鞘蛋白基因與衛星核酸變異之ڽ	oj1.sinica.edu.tw	0	0		
666	chrI	10709624	10709716	3500223858	32		10709624	10709716	8421504	3	8,3,21	0,56,71	c	350022385800000858	0-32							biomedcentral.com	0	0		
666	chrI	10724328	10731433	3500003185	38		10724328	10731433	8421504	4	14,5,4,15	0,15,7085,7090	c,g	350000318500000477,350000318500000477,350000318500000367	10-29,10-29,19-38						Anti-bacterial methods and materials	Holden	2000	0		
666	chrI	10731600	10731626	3500394547	23		10731600	10731626	8421504	2	15,8	0,18	c	350039454700000131	21-44						MODULATION OF TUDOR-SN EXPRESSION - Patent application	www.faqs.org	0	0		
666	chrI	10734474	10734578	3500254195	45		10734474	10734578	8421504	2	6,39	0,65	p	350025419500015112	0-45						Synthetic or natural peptides binding protein phosphatase 2a, identification method and uses	Cayla	2005	0		
667	chrI	10750898	10775036	3500154339	101		10750898	10775036	8421504	2	51,50	0,24088	c	350015433900000035,350015433900000137	0-51,0-50							biomedcentral.com	0	0		
667	chrI	10750907	10774037	3500042291	157		10750907	10774037	8421504	9	23,20,6,19,24,7,14,20,24	0,37,12782,13432,14339,21224,22041,22511,23106	c,g	350004229100000018,350004229100000018,350004229100000016,350004229100000016,350004229100000014,350004229100000015,350004229100000007,350004229100000013,350004229100000023,350004229100000023,350004229100000006	18-41,18-41,20-40,20-40,22-41,22-42,24-48,20-41,20-40,20-40,24-48						The significance of DAF-16 and its role in the phenotypic covariance of longevity, immunity and stress resistance in the Caenorhabditis nematodes	theses.bham.ac.uk	0	0		
667	chrI	10752613	10774862	3500373611	106		10752613	10774862	8421504	5	25,20,20,20,21	0,848,12822,21419,22228	c,g	350037361100000000,350037361100000002,350037361100000004,350037361100000003,350037361100000003,350037361100000001,350037361100000001	0-25,0-20,0-20,0-20,0-20,0-21,0-21						Mapping the breakpoints of the daf-16(mgDf50) allele	www.wormbook.org	0	0		
667	chrI	10761880	10773294	3500428045	60		10761880	10773294	8421504	3	20,20,20	0,3533,11394	c,g	350042804500000000,350042804500000002,350042804500000001,350042804500000001	0-20,0-20,0-20,0-20						PHOSPHORYLATION OF α-SYNUCLEIN AT SER129 REDUCES NEURONAL DYSFUNCTION BY LOWERING ITS MEMBRANE-BINDING PROPERTY IN CAENORHABDITIS ELEGANS	www.jbc.org	0	0		
667	chrI	10762767	10776681	3500116523	3954		10762767	10776681	8421504	42	60,55,57,57,55,56,55,55,55,24,31,57,13,6,35,55,47,8,55,60,55,57,57,55,55,57,54,55,47,164,182,220,113,396,59,57,57,57,53,57,55,1096	0,65,123,183,245,304,365,425,485,545,811,846,908,922,1571,1611,1671,2431,2444,8779,8844,8902,8962,9024,9083,9143,9205,9264,9324,10179,10505,10746,11215,11998,12396,12458,12518,12578,12640,12698,12760,12818	g	350011652300000025,350011652300000026	0-3284,0-2545						Therapeutic and diagnostic tools for impaired glucose tolerance conditions - US Patent 7414169 Description	ww.patentstorm.us	0	0		
667	chrI	10762767	10776681	3500023596	3954		10762767	10776681	8421504	42	60,55,57,57,55,56,55,55,55,24,31,57,13,6,35,55,47,8,55,60,55,57,57,55,55,57,54,55,47,164,182,220,113,396,59,57,57,57,53,57,55,1096	0,65,123,183,245,304,365,425,485,545,811,846,908,922,1571,1611,1671,2431,2444,8779,8844,8902,8962,9024,9083,9143,9205,9264,9324,10179,10505,10746,11215,11998,12396,12458,12518,12578,12640,12698,12760,12818	g	350002359600000025,350002359600000026	0-3284,0-2545						US Patent # 7,414,169. Therapeutic and diagnostic tools for impaired glucose tolerance conditions - Patents.com	www.patents.com	0	0		
667	chrI	10763590	10764400	3500274120	40		10763590	10764400	8421504	2	20,20	0,790	c,g	350027412000000006,350027412000000006,350027412000000007,350027412000000007	0-20,0-20,0-20,0-20						C. elegans tubby regulates life span and fat storage by two independent mechanisms 10.1016/j.cmet.2005.06.004 : Cell Metabolism | ScienceDirect.com	sciencedirect.com	0	0		
667	chrI	10763590	10764400	3500190907	40		10763590	10764400	8421504	2	20,20	0,790	c,g	350019090700000000,350019090700000000,350019090700000001,350019090700000001	0-20,0-20,0-20,0-20						Neurotransmitter signaling can regulate life span in C. elegans	Tissenbaum	2004	0		
667	chrI	10763590	10764400	3500099218	40		10763590	10764400	8421504	2	20,20	0,790	c,g	350009921800000006,350009921800000006,350009921800000007,350009921800000007	0-20,0-20,0-20,0-20						CiteULike: regulates life span and fat storage by two independent mechanisms	www.citeulike.org	0	0		
667	chrI	10763590	10764400	3500097080	40		10763590	10764400	8421504	2	20,20	0,790	c,g	350009708000000004,350009708000000004,350009708000000005,350009708000000005	0-20,0-20,0-20,0-20						Methods of identifying longevity modulators and therapeutic methods of use thereof	Oh	2005	0		
667	chrI	10763590	10764400	3500092547	40		10763590	10764400	8421504	2	20,20	0,790	c,g	350009254700000004,350009254700000004,350009254700000005,350009254700000005	0-20,0-20,0-20,0-20					Patent	Methods of identifying longevity modulators and therapeutic methods of use thereof (Patent US:7858327)	Oh	2010	0		
667	chrI	10763590	10764400	3500029551	40		10763590	10764400	8421504	2	20,20	0,790	c,g	350002955100000000,350002955100000000,350002955100000001,350002955100000001,350002955100000002,350002955100000002	0-20,0-20,0-20,0-20,0-20,0-20						Neurotransmitter signaling can regulate life span in - US Patent 7914998 Description	ww.patentstorm.us	0	0		
667	chrI	10765200	10772993	3500370054	40		10765200	10772993	8421504	2	20,20	0,7773	c,g	350037005400000004,350037005400000004,350037005400000005,350037005400000005	0-20,0-20,0-20,0-20						Methods for prolonging the health benefits triggered by a dietary restriction using a sphingosine kinase inhibitor	Aguilaniu	2010	0		
667	chrI	10765267	10772994	3500408441	43		10765267	10772994	8421504	3	5,16,22	0,7681,7705	c,g	350040844100000006,350040844100000007,350040844100000007	0-21,0-22,0-22					Patent	Increasing life span by modulation of Smek (Patent US:7288385)	Dillin	2007	0		
667	chrI	10765267	10772994	3500380342	43		10765267	10772994	8421504	3	5,16,22	0,7681,7705	c,g	350038034200000025,350038034200000006,350038034200000026,350038034200000026,350038034200000007,350038034200000007	0-21,0-21,0-22,0-22,0-22,0-22						INCREASING LIFE SPAN BY MODULATION OF Smek - Patent application	www.faqs.org	0	0		
667	chrI	10768330	10769228	3500330042	44		10768330	10769228	8421504	2	22,22	0,876	g	350033004200000000,350033004200000001	0-22,0-22						Clustering of Genetically Defined Allele Classes in the Caenorhabditis elegans DAF-2 Insulin/IGF-1 Receptor--《遗传学杂志》--医学期刊频道--首席医学ߵ	journal.9med.net	0	0		
667	chrI	10768330	10769228	3500287802	44		10768330	10769228	8421504	2	22,22	0,876	g	350028780200000000,350028780200000001	0-22,0-22						Clustering of Genetically Defined Allele Classes in the Caenorhabditis elegans DAF-2 Insulin/IGF-1 Receptor	www.genetics.org	0	0		
667	chrI	10770049	10773650	3500283640	82		10770049	10773650	8421504	4	20,20,20,22	0,123,3468,3579	c,g	350028364000000002,350028364000000003,350028364000000003,350028364000000004,350028364000000004,350028364000000005,350028364000000005	0-20,0-20,0-20,0-20,0-20,0-22,0-22		23263989	10.1128/MCB.01462-12		Molecular and Cellular Biology	The Conserved PHD1-PHD2 Domain of ZFP-1/AF10 Is a Discrete Functional Module Essential for Viability in Caenorhabditis elegans	Daphne	2013	0		
667	chrI	10771496	10774916	3500385072	1458		10771496	10774916	8421504	7	642,162,90,80,220,113,151	0,1452,1776,1878,2017,2486,3269	p	350038507200015005,350038507200015010,350038507200015015,350038507200015050,350038507200015056,350038507200015020,350038507200015025,350038507200015030,350038507200015068,350038507200015035,350038507200015040	0-201,0-240,0-240,0-210,0-126,0-213,0-216,0-102,0-69,0-138,0-108						Analysis of FOXO transcriptional networks	ive.library.uu.nl	0	0		
667	chrI	10772036	10772995	3500259767	40		10772036	10772995	8421504	2	20,20	0,939	c,g	350025976700000036,350025976700000036,350025976700000037,350025976700000037	0-20,0-20,0-20,0-20		18828672	10.1371/journal.pbio.0060233		PLoS Biology	Caenorhabditis elegans HCF-1 Functions in Longevity Maintenance as a DAF-16 Regulator	Ji	2008	0		
667	chrI	10773380	10773405	3500325726	25		10773380	10773405	8421504	1	25	0	c,g	350032572600000001,350032572600000001	24-49,24-49						Myriam Passannante, Khaoula Belhaj,* Alina von Essen, Simon G. Sprecher, Fritz Mu¨ller and Chantal Wicky	doc.rero.ch	0	0		
667	chrI	10773448	10773623	3500358750	38		10773448	10773623	8421504	3	6,13,19	0,65,156	c,g	350035875000000002,350035875000000003,350035875000000003	0-19,0-19,0-19						Free Radical Biology & Medicine	library.ibp.ac.cn	0	0		
667	chrI	10773508	10774891	3500425976	40		10773508	10774891	8421504	2	20,20	0,1363	c,g	350042597600000000,350042597600000001,350042597600000001	0-20,0-20,0-20		22745480	10.1523/JNEUROSCI.1494-11.2012	0270-6474	The Journal of Neuroscience	Neurite Sprouting and Synapse Deterioration in the Aging Caenorhabditis elegans Nervous System	Toth	2012	7		
667	chrI	10773508	10774891	3500052975	40		10773508	10774891	8421504	2	20,20	0,1363	c,g	350005297500000000,350005297500000001,350005297500000001	0-20,0-20,0-20						Cellular/Molecular NeuriteSproutingandSynapseDeteriorationintheAging Caenorhabditiselegans NervousSystem	www.jneurosci.org	0	0		
667	chrI	10774013	10774855	3500213969	44		10774013	10774855	8421504	2	22,22	0,820	c,g	350021396900000012,350021396900000012,350021396900000013,350021396900000013	0-22,0-22,0-22,0-22		19924292	10.1371/journal.pbio.1000245	1545-7885	PLOS Biology	PLOS Biology: Role of CBP and SATB-1 in Aging, Dietary Restriction, and Insulin-Like Signaling	Zhang	2009	0		
667	chrI	10774013	10774855	3500172109	44		10774013	10774855	8421504	2	22,22	0,820	c,g	350017210900000012,350017210900000012,350017210900000013,350017210900000013	0-22,0-22,0-22,0-22		19924292	10.1371/journal.pbio.1000245		PLoS Biology	Role of CBP and SATB-1 in Aging, Dietary Restriction, and Insulin-Like Signaling	Minhua	2009	0		
667	chrI	10774941	10774986	3500421968	45		10774941	10774986	8421504	1	45	0	c	350042196800000000	0-45						CGC Strain TJ356	egans.som.vcu.edu	0	0		
667	chrI	10775006	10775036	3500232768	30		10775006	10775036	8421504	1	30	0	c,g	350023276800000001,350023276800000001	31-61,31-61						Supporting Online Material	ww.sciencemag.org	0	0		
667	chrI	10776642	10776665	3500168430	23		10776642	10776665	8421504	1	23	0	g	350016843000000006	0-23						Role of hydrogen peroxide in the lifespan of C. elegans	uni-greifswald.de	0	0		
667	chrI	10818927	10819651	3500092599	60		10818927	10819651	8421504	3	20,20,20	0,41,704	c,g	350009259900000011,350009259900000011,350009259900000018,350009259900000018,350009259900000019	0-20,0-20,0-20,0-20,0-20		18780728	10.1534/genetics.108.093310		Genetics	ADBP-1 Regulates an ADAR RNA-Editing Enzyme to Antagonize RNA-Interference-Mediated Gene Silencing in Caenorhabditis elegans	Hiromitsu	2008	0		
667	chrI	10825015	10825042	3500198703	23		10825015	10825042	8421504	2	13,10	0,17	g	350019870300000042	25-48						Method for Producing Polyunsaturated Long-Chain Fatty Acids in Transgenic Organisms - Patent application	www.faqs.org	0	0		
667	chrI	10855510	10855534	3500031785	23		10855510	10855534	8421504	2	6,17	0,7	c	350003178500000026	6-29						SRM 2395	www.cstl.nist.gov	0	0		
667	chrI	10859630	10859654	3500373188	23		10859630	10859654	8421504	2	12,11	0,13	g	350037318800000431	2-25						Microsatellites database	insilico.ehu.es	0	0		
667	chrI	10862061	10862084	3500144357	23		10862061	10862084	8421504	1	23	0	c	350014435700000022	22-45						Bioinformatics note V3	load.bioon.com.cn	0	0		
667	chrI	10864034	10871268	3500068199	44		10864034	10871268	8421504	4	9,12,12,11	0,13,7210,7223	c	350006819900000656,350006819900000367	0-21,8-31						RNAi INHIBITION OF INFLUENZA VIRUS REPLICATION - Patent application	www.faqs.org	0	0		
667	chrI	10871244	10871268	3500284394	23		10871244	10871268	8421504	2	12,11	0,13	c	350028439400000367	8-31						RNAi INHIBITION OF INFLUENZA VIRUS REPLICATION	Fougerolles	2011	0		
667	chrI	10871244	10871268	3500253796	23		10871244	10871268	8421504	2	12,11	0,13	c	350025379600000367	8-31					Patent	Enhancement of influenza gene expression (Patent US:8227188)	Fougerolles	2012	0		
667	chrI	10871244	10871268	3500241875	23		10871244	10871268	8421504	2	12,11	0,13	c	350024187500000367	8-31					Patent	Enhancement of influenza gene expression (Patent US:8227188)	Fougerolles	2012	0		
667	chrI	10871244	10871268	3500070088	23		10871244	10871268	8421504	2	12,11	0,13	c	350007008800000367	8-31						RNAI INHIBITION OF INFLUENZA VIRUS REPLICATION	Fougerolles	2006	0		
667	chrI	10871244	10871268	3500019915	23		10871244	10871268	8421504	2	12,11	0,13	c	350001991500000367	8-31						Rnai Inhibition Of Influenza Virus Replication 	.freshpatents.com	0	0		
668	chrI	10885442	10887609	3500318813	50		10885442	10887609	8421504	2	25,25	0,2142	c,g	350031881300000001,350031881300000001,350031881300000000,350031881300000000	0-25,0-25,0-25,0-25						C. elegans PARK8-Related Kinase, Regulates Axonal-Dendritic Polarity of SV Proteins	download.cell.com	0	0		
668	chrI	10964712	10968158	3500133193	57		10964712	10968158	8421504	2	28,29	0,3417	g	350013319300000002,350013319300000000	0-28,51-80		15930110	10.1242/dev.01868	0950-1991	Development	The Caenorhabditis elegans spe-38 gene encodes a novel four-pass integral membrane protein required for sperm function at fertilization	Chatterjee	2005	7		
668	chrI	10964712	10968158	3500049805	57		10964712	10968158	8421504	2	28,29	0,3417	g	350004980500000002,350004980500000000	0-28,51-80		15930110	10.1242/dev.01868	0950-1991	Development	The Caenorhabditis elegans spe-38 gene encodes a novel four-pass integral membrane protein required for sperm function at fertilization	Chatterjee	2005	7		
668	chrI	11005301	11005327	3500255382	23		11005301	11005327	8421504	2	7,16	0,10	g	350025538200000002,350025538200000003	3-25,3-24						Topics and Techniques in Forensic DNA Analysis	www.cstl.nist.gov	0	0		
669	chrI	11016373	11016400	3500246361	24		11016373	11016400	8421504	2	12,12	0,15	c	350024636100000040	0-24						Bacterial collagenase gene of Vibrio alginolyticus	Shibano	1990	0		
669	chrI	11063613	11063641	3500079365	26		11063613	11063641	8421504	3	13,7,6	0,14,22	c	350007936500000203	8-38					Patent	嘌呤类物质产生菌及嘌呤类物质的制备方法 (Patent CN:1831115)	Song Ye Ji 	2012	0		
669	chrI	11088537	11090157	3500006718	40		11088537	11090157	8421504	2	1,39	0,1581	c	350000671800000241	12-52						CHIMERIC THERAPEUTICS, COMPOSITIONS, AND METHODS FOR USING SAME - Patent application	www.faqs.org	0	0		
669	chrI	11088537	11090147	3500223858	30		11088537	11090147	8421504	2	1,29	0,1581	c	350022385800000260	55-85							biomedcentral.com	0	0		
669	chrI	11092563	11092587	3500375490	24		11092563	11092587	8421504	1	24	0	g	350037549000000269	13-37						PHYLOGENETIC RELATIONSHIPS IN THE FAMILY AMARYLLIDACEAE	etd.uovs.ac.za	0	0		
669	chrI	11111575	11111607	3500017711	25		11111575	11111607	8421504	3	11,9,5	0,15,27	g	350001771100000343	0-25						<Html><Title> Complet list of 1c8u hssp file Complet list of	cnptia.embrapa.br	0	0		
670	chrI	11158208	11158235	3500198341	24		11158208	11158235	8421504	2	19,5	0,22	g	350019834100000106	11-35						<Html><Title> Complet list of 1c7s hssp file Complet list of	cnptia.embrapa.br	0	0		
670	chrI	11158208	11158235	3500186865	24		11158208	11158235	8421504	2	19,5	0,22	g	350018686500000020,350018686500000006,350018686500000111,350018686500000048,350018686500000132,350018686500000127,350018686500000151	23-47,7-31,20-44,10-34,15-39,21-45,13-37						<Html><Title> Complet list of 3gs6 hssp file Complet list of	cnptia.embrapa.br	0	0		
670	chrI	11158208	11158235	3500143070	24		11158208	11158235	8421504	2	19,5	0,22	g	350014307000000215,350014307000000691	20-44,4-28						<Html><Title> Complet list of 3a2p hssp file Complet list of	cnptia.embrapa.br	0	0		
670	chrI	11158208	11158235	3500120381	24		11158208	11158235	8421504	2	19,5	0,22	g	350012038100000202,350012038100000230	11-35,7-31						<Html><Title> Complet list of 1mpf hssp file Complet list of	cnptia.embrapa.br	0	0		
670	chrI	11198464	11198824	3500071173	360		11198464	11198824	8421504	1	360	0	g	350007117300000023,350007117300000019,350007117300000022,350007117300000020,350007117300000096,350007117300000021	0-120,0-68,0-120,64-129,0-20,0-120						Phylogenetische Heterogenität der 7S-RNAs von Eukaryonten	uhr-uni-bochum.de	0	0		
670	chrI	11201812	11214996	3500157073	40		11201812	11214996	8421504	3	15,5,20	0,17,13164	c,g	350015707300000022,350015707300000044	9-29,14-34							shfieldclinic.org	0	0		
670	chrI	11220901	11220926	3500395446	24		11220901	11220926	8421504	2	18,6	0,19	c	350039544600001808	23-47						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
671	chrI	11305666	11305694	3500460838	23		11305666	11305694	8421504	2	6,17	0,11	g	350046083800000002	8-31						多様性の生成方法 （公開公報 2010042017）｜アスタミューゼ - astamuse	astamuse.com	0	0		
671	chrI	11312027	11323069	3500236586	86		11312027	11323069	8421504	4	20,25,21,20	0,27,7708,11022	c,g	350023658600000011,350023658600000011,350023658600000012,350023658600000012,350023658600000006,350023658600000006,350023658600000005,350023658600000005	0-20,0-20,0-25,0-25,0-21,0-21,0-20,0-20		21196525	10.1534/genetics.110.124487		Genetics	The LIN-15A and LIN-56 Transcriptional Regulators Interact to Negatively Regulate EGF/Ras Signaling in Caenorhabditis elegans Vulval Cell-Fate Determination	Ewa	2011	0		
671	chrI	11377606	11383055	3500196959	42		11377606	11383055	8421504	4	7,14,15,6	0,11,5427,5443	c,g	350019695900002051,350019695900001776	5-26,5-31						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
672	chrI	11404175	11416409	3500148673	146		11404175	11416409	8421504	7	21,21,21,21,21,21,20	0,1987,2113,4042,5269,5969,12214	c,g	350014867300000001,350014867300000001,350014867300000004,350014867300000004,350014867300000002,350014867300000002,350014867300000003,350014867300000003,350014867300000006,350014867300000006,350014867300000005,350014867300000005,350014867300000007,350014867300000007	0-21,0-21,0-21,0-21,0-21,0-21,0-21,0-21,0-21,0-21,0-21,0-21,0-20,0-20						The Bro1-Domain Protein, EGO-2, Promotes Notch Signaling in Caenorhabditis elegans--《遗传学杂志》--医学期刊频道--首席医学网	journal.9med.net	0	0		
672	chrI	11427444	11427471	3500367251	23		11427444	11427471	8421504	2	9,14	0,13	g	350036725100000163	14-37						<HTML> <TITLE>BLAST Search Results  Complet list of 1m2n hssp file Complet list of	cnptia.embrapa.br	0	0		
672	chrI	11520315	11520340	3500131108	24		11520315	11520340	8421504	2	4,20	0,5	c	350013110800001089	18-44						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
673	chrI	11542161	11549002	3500231920	41		11542161	11549002	8421504	3	20,6,15	0,6817,6826	c,g	350023192000001220,350023192000001220,350023192000001529	0-20,0-20,14-35						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
673	chrI	11551713	11551737	3500165371	23		11551713	11551737	8421504	2	16,7	0,17	g	350016537100000142	0-23						NOVEL ATP:CITRATE LYASE GENES - Patent application	www.faqs.org	0	0		
673	chrI	11579746	11584178	3500353748	42		11579746	11584178	8421504	2	23,19	0,4413	c,g	350035374800001492,350035374800001584	0-23,0-19						<HTML> <TITLE>BLAST Search Results  Complet list of 1lbb hssp file Complet list of	cnptia.embrapa.br	0	0		
673	chrI	11620043	11620067	3500459511	23		11620043	11620067	8421504	2	10,13	0,11	c	350045951100000154	0-23						<Html><Title> Complet list of 3ksq hssp file Complet list of	cnptia.embrapa.br	0	0		
673	chrI	11620043	11620067	3500327405	24		11620043	11620067	8421504	1	24	0	c	350032740500000077,350032740500000075	20-44,15-38						<Html><Title> Complet list of 1o8q hssp file Complet list of	cnptia.embrapa.br	0	0		
673	chrI	11620044	11629856	3500242967	41		11620044	11629856	8421504	3	21,5,15	0,9790,9797	c	350024296700000639,350024296700000544	0-21,8-28						<Html><Title> Complet list of 1j2p hssp file Complet list of	cnptia.embrapa.br	0	0		
673	chrI	11620044	11620070	3500405107	26		11620044	11620070	8421504	1	26	0	c	350040510700000298,350040510700000324,350040510700000014	8-32,0-22,0-22						<Html><Title> Complet list of 1epx hssp file Complet list of	cnptia.embrapa.br	0	0		
673	chrI	11620044	11620070	3500251711	26		11620044	11620070	8421504	1	26	0	c	350025171100000586,350025171100000323,350025171100000600	1-27,9-31,3-26						<Html><Title> Complet list of 1ea9 hssp file Complet list of	cnptia.embrapa.br	0	0		
673	chrI	11620044	11620070	3500114068	25		11620044	11620070	8421504	2	14,11	0,15	c	350011406800000480	10-35						<Html><Title> Complet list of 1uh9 hssp file Complet list of	cnptia.embrapa.br	0	0		
673	chrI	11620044	11620068	3500331014	24		11620044	11620068	8421504	1	24	0	c	350033101400000501	18-42						<Html><Title> Complet list of 1wsr hssp file Complet list of	cnptia.embrapa.br	0	0		
673	chrI	11620044	11620068	3500121076	24		11620044	11620068	8421504	1	24	0	c	350012107600000031	4-28						<Html><Title> Complet list of 3od6 hssp file Complet list of	cnptia.embrapa.br	0	0		
673	chrI	11620044	11620067	3500451613	23		11620044	11620067	8421504	1	23	0	c	350045161300000146	1-24						<Html><Title> Complet list of 3pmx hssp file Complet list of	cnptia.embrapa.br	0	0		
673	chrI	11620044	11620067	3500426058	23		11620044	11620067	8421504	1	23	0	c	350042605800000021	9-32						<Html><Title> Complet list of 2v3z hssp file Complet list of	cnptia.embrapa.br	0	0		
673	chrI	11620044	11620067	3500409013	23		11620044	11620067	8421504	1	23	0	c	350040901300000194	7-30						<Html><Title> Complet list of 1q6y hssp file Complet list of	cnptia.embrapa.br	0	0		
673	chrI	11620044	11620067	3500374559	23		11620044	11620067	8421504	1	23	0	c	350037455900000024	11-34						<Html><Title> Complet list of 3f00 hssp file Complet list of	cnptia.embrapa.br	0	0		
673	chrI	11620044	11620067	3500369079	23		11620044	11620067	8421504	1	23	0	c	350036907900000469,350036907900000263,350036907900000556,350036907900000610,350036907900000247	9-31,9-30,1-24,7-29,8-30						<Html><Title> Complet list of 1omo hssp file Complet list of	cnptia.embrapa.br	0	0		
673	chrI	11620044	11620067	3500306261	23		11620044	11620067	8421504	1	23	0	c	350030626100000161,350030626100000155	0-22,11-34						<Html><Title> Complet list of 2b6p hssp file Complet list of	cnptia.embrapa.br	0	0		
673	chrI	11620044	11620067	3500281528	23		11620044	11620067	8421504	1	23	0	c	350028152800000122	14-37						<Html><Title> Complet list of 2pfl hssp file Complet list of	cnptia.embrapa.br	0	0		TP53
673	chrI	11620044	11620067	3500254463	23		11620044	11620067	8421504	1	23	0	c	350025446300000285	9-32						<Html><Title> Complet list of 1rvv hssp file Complet list of	cnptia.embrapa.br	0	0		
673	chrI	11620044	11620067	3500245494	23		11620044	11620067	8421504	1	23	0	c	350024549400000294	11-34						<Html><Title> Complet list of 2x2w hssp file Complet list of	cnptia.embrapa.br	0	0		
673	chrI	11620044	11620067	3500186062	23		11620044	11620067	8421504	1	23	0	c	350018606200000340,350018606200000110	0-21,0-21						<Html><Title> Complet list of 1a2f hssp file Complet list of	cnptia.embrapa.br	0	0		
673	chrI	11620044	11620067	3500177899	23		11620044	11620067	8421504	1	23	0	c	350017789900000351	0-23						<Html><Title> Complet list of 3f55 hssp file Complet list of	cnptia.embrapa.br	0	0		
673	chrI	11620044	11620067	3500171219	23		11620044	11620067	8421504	1	23	0	c	350017121900000101,350017121900000245,350017121900000374	23-46,10-33,0-23						<Html><Title> Complet list of 1pma hssp file Complet list of	cnptia.embrapa.br	0	0		
673	chrI	11620044	11620067	3500126594	23		11620044	11620067	8421504	1	23	0	c	350012659400000035	9-32						<Html><Title> Complet list of 3bqb hssp file Complet list of	cnptia.embrapa.br	0	0		
673	chrI	11620044	11620067	3500125682	23		11620044	11620067	8421504	1	23	0	c	350012568200000198,350012568200000069,350012568200000041	15-38,10-33,9-29						<Html><Title> Complet list of 1lqa hssp file Complet list of	cnptia.embrapa.br	0	0		
673	chrI	11620044	11620067	3500074491	23		11620044	11620067	8421504	1	23	0	c	350007449100000035	21-44						<Html><Title> Complet list of 1cmp hssp file Complet list of	cnptia.embrapa.br	0	0		
673	chrI	11620044	11620067	3500033414	23		11620044	11620067	8421504	1	23	0	c	350003341400000323,350003341400000600	9-31,3-26						<Html><Title> Complet list of 1ea9 hssp file Complet list of	cnptia.embrapa.br	0	0		
673	chrI	11620044	11620067	3500005213	23		11620044	11620067	8421504	1	23	0	c	350000521300000013	0-23						<Html><Title> Complet list of 1a5c hssp file Complet list of	cnptia.embrapa.br	0	0		
673	chrI	11620045	11620069	3500171322	23		11620045	11620069	8421504	2	13,10	0,14	c	350017132200000052	0-23						<Html><Title> Complet list of 3dxt hssp file Complet list of	cnptia.embrapa.br	0	0		
673	chrI	11629867	11629893	3500146713	26		11629867	11629893	8421504	1	26	0	c	350014671300000288	22-48						无乳链球菌抗原Ⅰ和Ⅱ	A*Mei Ke 	2010	0		
673	chrI	11629867	11629893	3500137812	26		11629867	11629893	8421504	1	26	0	c	350013781200000310,350013781200000272	18-44,18-44						无乳链球菌抗原Ⅰ和Ⅱ	A*Mei Ke 	2010	0		
673	chrI	11629867	11629893	3500132896	26		11629867	11629893	8421504	1	26	0	c	350013289600000282	22-48						无乳链球菌抗原Ⅰ和Ⅱ	A*Mei Ke 	2010	0		
674	chrI	11665990	11666014	3500031510	24		11665990	11666014	8421504	1	24	0	g	350003151000000310	10-34						<Html><Title> Complet list of 3iha hssp file Complet list of	cnptia.embrapa.br	0	0		
674	chrI	11753848	11753876	3500329005	23		11753848	11753876	8421504	2	15,8	0,20	c	350032900500000053,350032900500000054	1-24,0-23						Characterization of SsoSSB, Sso1450,	b.uni-bayreuth.de	0	0		
674	chrI	11767680	11767712	3500216944	28		11767680	11767712	8421504	3	12,3,13	0,13,19	g	350021694400000377	2-30						rec_num ORF_name deletion_alias gene_names UPTAG_sequence	ence.stanford.edu	0	0		
675	chrI	11798890	11798920	3500348158	25		11798890	11798920	8421504	3	5,6,14	0,7,16	c	350034815800000296	8-37						<Html><Title> Complet list of 1r9d hssp file Complet list of	cnptia.embrapa.br	0	0		
675	chrI	11813884	11813910	3500041187	23		11813884	11813910	8421504	2	14,9	0,17	c	350004118700000005,350004118700000004	18-41,0-23		19555461	10.1111/j.1365-2958.2009.06764.x		Molecular Microbiology	The ethanolamine branch of the Kennedy pathway is essential in the bloodstream form of Trypanosoma brucei	Federica	2009	0		
675	chrI	11851945	11873153	3500003937	109		11851945	11873153	8421504	4	22,21,44,22	0,2396,16123,21186	c,g	350000393700000013,350000393700000012,350000393700000010,350000393700000009,350000393700000008	8-30,0-21,7-29,6-28,6-28		22615577	10.1371/journal.pgen.1002663	1553-7404	PLOS Genetics	PLOS Genetics: Integrin α PAT-2/CDC-42 Signaling Is Required for Muscle-Mediated Clearance of Apoptotic Cells in Caenorhabditis elegans	Hsieh	2012	0		
675	chrI	11854400	11854430	3500223858	30		11854400	11854430	8421504	1	30	0	c	350022385800000509	51-81							biomedcentral.com	0	0		
675	chrI	11865990	11867078	3500088918	114		11865990	11867078	8421504	2	94,20	0,1068	p	350008891800015003	0-114						and the Immune System of Drosophila melanogaster.	edoc.hu-berlin.de	0	0		
675	chrI	11888509	11888609	3500083869	41		11888509	11888609	8421504	2	20,21	0,79	g	350008386900000022,350008386900000003	0-20,0-21						<?xml version="1.0" encoding="utf-8"?> <!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD	ke.sciencemag.org	0	0		
675	chrI	11894448	11894540	3500112449	23		11894448	11894540	8421504	3	17,1,5	0,83,87	c	350011244900000008	9-32					Patent	Rice actin gene and promoter (Patent US:5641876)	McElroy	1997	0		
675	chrI	11896704	11896729	3500372090	23		11896704	11896729	8421504	2	5,18	0,7	c	350037209000000001,350037209000000000	4-27,8-31		23297219	10.1073/pnas.1213283110	0027-8424	Proceedings of the National Academy of Sciences	Function of Piwi, a nuclear Piwi/Argonaute protein, is independent of its slicer activity	Darricarrere	2013	10		
675	chrI	11902641	11902666	3500304866	24		11902641	11902666	8421504	2	9,15	0,10	c	350030486600000108	0-24						Methods For Identifying Modulators Of Kinesin Activity 	.freshpatents.com	0	0		
675	chrI	11907620	11908131	3500350443	99		11907620	11908131	8421504	3	12,37,50	0,13,461	c,g	350035044300000152,350035044300000151,350035044300000151	0-49,0-50,0-50						OLIGONUCLEOTIDE ANALOGUES FOR DETECTING AND ANALYZING NUCLEIC ACIDS - Exiqon, A/s	www.sumobrain.com	0	0		
675	chrI	11925268	11925358	3500080177	90		11925268	11925358	8421504	1	90	0	p	350008017700015019	0-90						Regulatory Mimicry in Listeria monocytogenes Actin-Based Motility	www.med.yale.edu	0	0		
676	chrI	11935734	11956618	3500296810	90		11935734	11956618	8421504	4	20,24,24,22	0,17859,19591,20862	c,g	350029681000000005,350029681000000010,350029681000000013,350029681000000013,350029681000000011	0-20,0-24,0-24,0-24,0-22			10.1534/genetics.104.028423		Genetics	The L-Type Cyclin CYL-1 and the Heat-Shock-Factor HSF-1 Are Required for Heat-Shock-Induced Protein Expression in Caenorhabditis elegans	Yvonne	2004	0		
676	chrI	11941685	11941713	3500048974	23		11941685	11941713	8421504	3	13,5,5	0,15,23	g	350004897400000028	13-36						Arabidopsis transcription factors WRKY18 and WRKY40 in plant immunity	s.ub.uni-koeln.de	0	0		
676	chrI	11953790	11961953	3500237924	52		11953790	11961953	8421504	2	27,25	0,8138	c,g	350023792400000016,350023792400000015,350023792400000014,350023792400000014	10-37,0-27,12-37,12-37						International Journal for Parasitology	.researchgate.net	0	0		
676	chrI	11953858	11955460	3500213969	46		11953858	11955460	8421504	3	22,1,23	0,1455,1579	c	350021396900000015,350021396900000014	0-23,0-23		19924292	10.1371/journal.pbio.1000245	1545-7885	PLOS Biology	PLOS Biology: Role of CBP and SATB-1 in Aging, Dietary Restriction, and Insulin-Like Signaling	Zhang	2009	0		
676	chrI	11953858	11955314	3500172109	23		11953858	11955314	8421504	2	22,1	0,1455	c	350017210900000015	0-23		19924292	10.1371/journal.pbio.1000245		PLoS Biology	Role of CBP and SATB-1 in Aging, Dietary Restriction, and Insulin-Like Signaling	Minhua	2009	0		
676	chrI	11958252	11958830	3500070022	48		11958252	11958830	8421504	2	24,24	0,554	c,g	350007002200000017,350007002200000017,350007002200000016,350007002200000016	0-24,0-24,0-24,0-24		24009527	10.1371/journal.pgen.1003737		PLoS Genetics	Deletion of microRNA-80 Activates Dietary Restriction to Extend C. elegans Healthspan and Lifespan	Mehul	2013	0		
676	chrI	11965621	11965649	3500197929	24		11965621	11965649	8421504	3	5,5,14	0,7,14	g	350019792900003023	2-26						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
676	chrI	11979430	11985429	3500446855	2792		11979430	11985429	8421504	14	56,5,49,128,123,115,109,202,725,352,304,349,106,169	0,57,63,1109,1304,1480,1636,2403,2865,3846,4457,4957,5527,5830	c,g	350044685500000010,350044685500000109,350044685500000109,350044685500000028,350044685500000028,350044685500000110,350044685500000110,350044685500000111,350044685500000111,350044685500000029,350044685500000112,350044685500000112,350044685500000113,350044685500000113,350044685500000114,350044685500000114,350044685500000115,350044685500000115,350044685500000116,350044685500000116,350044685500000117,350044685500000118,350044685500000118,350044685500000119,350044685500000119,350044685500000120,350044685500000120,350044685500000030,350044685500000030	0-2790,0-62,0-62,79-203,79-203,59-120,59-120,60-120,60-120,0-476,60-120,60-120,60-120,60-120,60-120,60-120,60-120,60-120,55-120,55-120,0-60,0-60,0-60,0-63,0-63,19-79,19-79,0-22,0-22						Étude de la fonction des Rho GAP au cours du développement embryonnaire du nématode caenorhabditis elegans	.archipel.uqam.ca	0	0		
676	chrI	11984599	11984626	3500244830	23		11984599	11984626	8421504	2	11,12	0,15	c	350024483000000391,350024483000000392	18-41,18-41						METHODS FOR LOWERING SERUM CHOLESTROL IN A SUBJECT USING INHIBITION OF PCSK9 - ALNYLAM PHARMACEUTICALS, INC.	www.sumobrain.com	0	0		
676	chrI	12012017	12012045	3500167906	23		12012017	12012045	8421504	2	16,7	0,21	c	350016790600000027	17-40						DISSERTAÇÃO MAPEAMENTO GENÉTICO E DETECÇÃO DE QTLs EM UM CRUZAMENTO DE LIMÃO ‘CRAVO’ E CITRUMELO ‘SWINGLE’	www.iac.sp.gov.br	0	0		
676	chrI	12018059	12018087	3500157564	23		12018059	12018087	8421504	2	17,6	0,22	c,g	350015756400000021,350015756400000021	0-23,0-23						<!DOCTYPE HTML PUBLIC i3/4-//IETF//DTD HTML 3.0//ENi3/4> <!- SPECIFICATION OF LANGUAGE-> <HTML> 	wheat.pw.usda.gov	0	0		
84	chrI	12043174	12064043	3500028321	43		12043174	12064043	8421504	4	14,9,7,13	0,17,20845,20856	g	350002832100000114,350002832100000209	0-23,4-24						<Html><Title> Complet list of 3o4s hssp file Complet list of	cnptia.embrapa.br	0	0		
677	chrI	12061013	12061039	3500074491	26		12061013	12061039	8421504	1	26	0	c	350007449100000355	0-26						<Html><Title> Complet list of 1cmp hssp file Complet list of	cnptia.embrapa.br	0	0		
677	chrI	12061013	12061036	3500138723	23		12061013	12061036	8421504	1	23	0	c	350013872300000002	20-43						<Html><Title> Complet list of 1xqc hssp file Complet list of	cnptia.embrapa.br	0	0		
677	chrI	12061014	12061041	3500306261	27		12061014	12061041	8421504	1	27	0	c	350030626100000233,350030626100000537	0-23,22-47						<Html><Title> Complet list of 2b6p hssp file Complet list of	cnptia.embrapa.br	0	0		
677	chrI	12061014	12061040	3500343354	26		12061014	12061040	8421504	1	26	0	c	350034335400000258,350034335400000230,350034335400000228	11-33,19-45,11-31						<Html><Title> Complet list of 3hdn hssp file Complet list of	cnptia.embrapa.br	0	0		
677	chrI	12061014	12061040	3500176170	26		12061014	12061040	8421504	1	26	0	c	350017617000000219,350017617000000364	0-25,12-36						<Html><Title> Complet list of 1dj1 hssp file Complet list of	cnptia.embrapa.br	0	0		
677	chrI	12061014	12061040	3500168119	26		12061014	12061040	8421504	1	26	0	c	350016811900000850,350016811900000821,350016811900000786	16-41,0-25,11-35						<Html><Title> Complet list of 2yvg hssp file Complet list of	cnptia.embrapa.br	0	0		
677	chrI	12061014	12061040	3500035753	26		12061014	12061040	8421504	1	26	0	c	350003575300000480	9-35						<Html><Title> Complet list of 2qbq hssp file Complet list of	cnptia.embrapa.br	0	0		
677	chrI	12061014	12061039	3500383768	25		12061014	12061039	8421504	1	25	0	c	350038376800002737	2-27						@DGFC08P1:101:C0836ACXX:1:1101:4848:115207:1/1 ATCCATGTCCCTACAAAGGACATGAACTCATCATTTTTTATGGCTGCATAGT	markovitzlab.com	0	0		
677	chrI	12061014	12061039	3500228701	25		12061014	12061039	8421504	1	25	0	c	350022870100000002	0-25						Zur Evolution des Cytoskeletts beim Sibirischen Stör Acipenser baeri	imed.uni-mainz.de	0	0		
677	chrI	12061014	12061039	3500227125	25		12061014	12061039	8421504	1	25	0	c	350022712500000232	0-25						<Html><Title> Complet list of 1aow hssp file Complet list of	cnptia.embrapa.br	0	0		
677	chrI	12061014	12061039	3500218436	25		12061014	12061039	8421504	1	25	0	c	350021843600000467	0-25						<Html><Title> Complet list of 2aqi hssp file Complet list of	cnptia.embrapa.br	0	0		
677	chrI	12061014	12061039	3500186232	25		12061014	12061039	8421504	1	25	0	c	350018623200000131	0-25						<Html><Title> Complet list of 2bhw hssp file Complet list of	cnptia.embrapa.br	0	0		
677	chrI	12061014	12061039	3500159986	25		12061014	12061039	8421504	1	25	0	c	350015998600000191,350015998600000266	0-25,0-25						<Html><Title> Complet list of 1cmu hssp file Complet list of	cnptia.embrapa.br	0	0		
677	chrI	12061014	12061039	3500116785	25		12061014	12061039	8421504	1	25	0	c	350011678500000422	12-37						<Html><Title> Complet list of 1og5 hssp file Complet list of	cnptia.embrapa.br	0	0		
677	chrI	12061014	12061039	3500036314	25		12061014	12061039	8421504	1	25	0	c	350003631400000064	11-36						<Html><Title> Complet list of 1umk hssp file Complet list of	cnptia.embrapa.br	0	0		
677	chrI	12061014	12061039	3500033414	25		12061014	12061039	8421504	1	25	0	c	350003341400000454	11-36						<Html><Title> Complet list of 1ea9 hssp file Complet list of	cnptia.embrapa.br	0	0		
677	chrI	12061014	12061039	3500008851	25		12061014	12061039	8421504	1	25	0	c	350000885100000218	11-36						<Html><Title> Complet list of 1e32 hssp file Complet list of	cnptia.embrapa.br	0	0		
677	chrI	12061014	12061037	3500394783	23		12061014	12061037	8421504	1	23	0	c	350039478300000138	20-43						<Html><Title> Complet list of 1dj9 hssp file Complet list of	cnptia.embrapa.br	0	0		
677	chrI	12061015	12061046	3500363058	31		12061015	12061046	8421504	1	31	0	c	350036305800000175,350036305800000311	15-39,3-29						<Html><Title> Complet list of 2vpj hssp file Complet list of	cnptia.embrapa.br	0	0		
677	chrI	12061015	12061041	3500143070	26		12061015	12061041	8421504	1	26	0	c	350014307000000878,350014307000000922	3-27,11-36						<Html><Title> Complet list of 3a2p hssp file Complet list of	cnptia.embrapa.br	0	0		
677	chrI	12061015	12061039	3500386136	24		12061015	12061039	8421504	1	24	0	c	350038613600000137	18-42						<Html><Title> Complet list of 1b0k hssp file Complet list of	cnptia.embrapa.br	0	0		
677	chrI	12061015	12061039	3500251711	24		12061015	12061039	8421504	1	24	0	c	350025171100000468	10-34						<Html><Title> Complet list of 1ea9 hssp file Complet list of	cnptia.embrapa.br	0	0		
677	chrI	12061015	12061039	3500080298	24		12061015	12061039	8421504	1	24	0	c	350008029800000219	4-28						<Html><Title> Complet list of 2dhb hssp file Complet list of	cnptia.embrapa.br	0	0		
677	chrI	12061015	12061038	3500264710	23		12061015	12061038	8421504	1	23	0	c	350026471000000077	26-49						<Html><Title> Complet list of 3ezp hssp file Complet list of	cnptia.embrapa.br	0	0		
677	chrI	12061016	12061042	3500318954	26		12061016	12061042	8421504	1	26	0	c	350031895400000103	0-26						<Html><Title> Complet list of 2bka hssp file Complet list of	cnptia.embrapa.br	0	0		
677	chrI	12061016	12061042	3500096011	26		12061016	12061042	8421504	1	26	0	c	350009601100000247,350009601100000459,350009601100000275	23-47,0-24,0-20						<Html><Title> Complet list of 2vex hssp file Complet list of	cnptia.embrapa.br	0	0		
677	chrI	12061016	12061041	3500405107	25		12061016	12061041	8421504	1	25	0	c	350040510700000330	23-48						<Html><Title> Complet list of 1epx hssp file Complet list of	cnptia.embrapa.br	0	0		
677	chrI	12061016	12061041	3500066638	25		12061016	12061041	8421504	1	25	0	c	350006663800000065,350006663800000125	0-25,11-36						<Html><Title> Complet list of 1ffr hssp file Complet list of	cnptia.embrapa.br	0	0		
677	chrI	12061016	12061040	3500428528	24		12061016	12061040	8421504	1	24	0	c	350042852800000161	0-24						<Html><Title> Complet list of 2zux hssp file Complet list of	cnptia.embrapa.br	0	0		SOX8
677	chrI	12061016	12061040	3500406671	24		12061016	12061040	8421504	1	24	0	c	350040667100000422	10-34						<Html><Title> Complet list of 3eew hssp file Complet list of	cnptia.embrapa.br	0	0		
677	chrI	12061016	12061040	3500369079	24		12061016	12061040	8421504	1	24	0	c	350036907900000641	11-35						<Html><Title> Complet list of 1omo hssp file Complet list of	cnptia.embrapa.br	0	0		
677	chrI	12061016	12061040	3500321117	24		12061016	12061040	8421504	1	24	0	c	350032111700000098	2-26						<Html><Title> Complet list of 1pa1 hssp file Complet list of	cnptia.embrapa.br	0	0		
677	chrI	12061016	12061040	3500313292	24		12061016	12061040	8421504	1	24	0	c	350031329200000153	0-24						<Html><Title> Complet list of 3bax hssp file Complet list of	cnptia.embrapa.br	0	0		
677	chrI	12061016	12061040	3500018725	24		12061016	12061040	8421504	1	24	0	c	350001872500000116	0-24						<Html><Title> Complet list of 1bu8 hssp file Complet list of	cnptia.embrapa.br	0	0		
677	chrI	12061016	12061040	3500017711	24		12061016	12061040	8421504	1	24	0	c	350001771100000145	12-36						<Html><Title> Complet list of 1c8u hssp file Complet list of	cnptia.embrapa.br	0	0		
677	chrI	12061016	12061040	3500013195	24		12061016	12061040	8421504	1	24	0	c	350001319500000312	11-35						<Html><Title> Complet list of 1sug hssp file Complet list of	cnptia.embrapa.br	0	0		
677	chrI	12061017	12061041	3500301737	24		12061017	12061041	8421504	1	24	0	c	350030173700000364	0-24						<Html><Title> Complet list of 3ihg hssp file Complet list of	cnptia.embrapa.br	0	0		
677	chrI	12061018	12061042	3500031510	24		12061018	12061042	8421504	1	24	0	c	350003151000000343	0-24						<Html><Title> Complet list of 3iha hssp file Complet list of	cnptia.embrapa.br	0	0		
677	chrI	12144973	12145160	3500224092	96		12144973	12145160	8421504	4	23,33,20,20	0,60,106,167	c	350022409200000002,350022409200000011,350022409200000013,350022409200000012,350022409200000003	0-23,0-20,0-19,0-20,0-20			10.1186/1471-2199-6-20	1471-2199	BMC Molecular Biology	Pseudouridine modification in Caenorhabditis elegans spliceosomal snRNAs: unique modifications are found in regions involved in snRNA-snRNA interactions	Patton	2005	3		
677	chrI	12144980	12145042	3500110061	62		12144980	12145042	8421504	1	62	0	c	350011006100000104,350011006100000105,350011006100000106,350011006100000107,350011006100000108,350011006100000109	0-25,0-27,0-25,0-25,0-25,0-25						5.8S-T-14 HBII-239 GCGATGGATCGGTTGCATCGAGTAT 5.8S-G-75 U96a,U96b AATTGCAGACGCTTAGAGTGGTGAA 18S-A-2	pbase.sysu.edu.cn	0	0		
677	chrI	12153109	12153134	3500436229	23		12153109	12153134	8421504	2	18,5	0,20	c	350043622900000067	14-37						cDNA encoding a BMP type II receptor	Rosenbaum	1994	0		
677	chrI	12168393	12176189	3500395446	41		12168393	12176189	8421504	3	7,14,20	0,8,7776	c,g	350039544600000270,350039544600003974	0-27,7-27						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
677	chrI	12170259	12170285	3500169524	23		12170259	12170285	8421504	2	15,8	0,18	c	350016952400000322	3-26						<Html><Title> Complet list of 6ccp hssp file Complet list of	cnptia.embrapa.br	0	0		
677	chrI	12170332	12170362	3500227125	25		12170332	12170362	8421504	2	13,12	0,18	c	350022712500000315	1-26						<Html><Title> Complet list of 1aow hssp file Complet list of	cnptia.embrapa.br	0	0		
678	chrI	12198450	12223794	3500190843	58		12198450	12223794	8421504	5	11,14,16,6,11	0,16,25306,25324,25333	g	350019084300001540,350019084300000889	16-44,0-36						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
678	chrI	12198599	12198642	3500440559	43		12198599	12198642	8421504	1	43	0	c	350044055900000001,350044055900000017	15-58,15-58						Human suppressor tRNA oligonucleotides and methods of use for same	Panchal	1999	0		
678	chrI	12210493	12210517	3500416808	23		12210493	12210517	8421504	2	6,17	0,7	c	350041680800000225	21-44					Patent	Recombinant herpesvirus of turkeys and uses thereof (Patent US:5853733)	Cochran	1998	0		
678	chrI	12210493	12210517	3500280721	23		12210493	12210517	8421504	2	6,17	0,7	c	350028072100000232	21-44						<HTML><HEAD><meta http-equiv="Content-Type" content="text/html; charset=ISO-8859-1"><LINK REL="SHORT	.economie.fgov.be	0	0		
678	chrI	12229299	12229339	3500208409	40		12229299	12229339	8421504	1	40	0	c	350020840900000002	0-40						一般信号值都在5000以上 - 豆丁网	www.docin.com	0	0		
678	chrI	12229305	12229342	3500386452	37		12229305	12229342	8421504	1	37	0	c	350038645200000071,350038645200000073,350038645200000075,350038645200000074,350038645200000092	3-29,9-32,6-31,7-31,1-28						NEUROPROTECTIVE MOLECULES AND METHODS OF TREATING NEUROLOGICAL DISORDERS AND INDUCING STRESS GRANULES	Anderson	2011	0		
678	chrI	12229305	12229342	3500235647	37		12229305	12229342	8421504	1	37	0	c	350023564700000071,350023564700000074,350023564700000075,350023564700000073,350023564700000092	3-29,7-31,6-31,9-32,1-28						NEUROPROTECTIVE MOLECULES AND METHODS OF TREATING NEUROLOGICAL DISORDERS AND INDUCING STRESS GRANULES - Patent application	www.faqs.org	0	0		
678	chrI	12242419	12242442	3500394734	23		12242419	12242442	8421504	1	23	0	g	350039473400000015	5-30		16033802	10.1242/dev.01924	0950-1991	Development	An allelic series reveals essential roles for FY in plant development in addition to flowering-time control	Henderson	2005	7		
678	chrI	12245808	12245837	3500423053	23		12245808	12245837	8421504	3	7,5,11	0,10,18	c	350042305300000003	8-31				0270-7306		Rab35 Mediates Transport of Cdc42 and Rac1 to the Plasma Membrane during Phagocytosis 	mcb.asm.org	0	6		
678	chrI	12273408	12273432	3500394430	23		12273408	12273432	8421504	2	4,19	0,5	c	350039443000000324	10-33						1. INTRODUÇÃO 1.1- O parasita	www.bdtd.ucb.br	0	0		
678	chrI	12286932	12287355	3500296810	44		12286932	12287355	8421504	2	24,20	0,403	g	350029681000000008,350029681000000009	0-24,0-20			10.1534/genetics.104.028423		Genetics	The L-Type Cyclin CYL-1 and the Heat-Shock-Factor HSF-1 Are Required for Heat-Shock-Induced Protein Expression in Caenorhabditis elegans	Yvonne	2004	0		
678	chrI	12295329	12295355	3500348029	23		12295329	12295355	8421504	2	18,5	0,21	g	350034802900000055	9-34						Sunflower disease resistance genes	Bidney	2000	0		
678	chrI	12297995	12298018	3500003185	23		12297995	12298018	8421504	1	23	0	g	350000318500000034	14-42						Anti-bacterial methods and materials	Holden	2000	0		
678	chrI	12306270	12306348	3500353690	24		12306270	12306348	8421504	3	14,1,9	0,19,69	c	350035369000000082	2-33						An Optimized Set of Human Telomere Clones for Studying Telomere Integrity and Architecture	enetics.emory.edu	0	0		
679	chrI	12322172	12322247	3500395446	25		12322172	12322247	8421504	3	2,16,7	0,49,68	c	350039544600003880	7-36						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
679	chrI	12361455	12361633	3500380836	23		12361455	12361633	8421504	3	5,10,8	0,8,170	c	350038083600000343	0-24						US Patent # 7,186,541. 3-hydroxypropionic acid and other organic compounds - Patents.com	www.patents.com	0	0		
679	chrI	12361455	12361633	3500370305	23		12361455	12361633	8421504	3	5,10,8	0,8,170	c	350037030500000334	0-24						 3 	www.docstoc.com	0	0		
679	chrI	12361455	12361633	3500166501	23		12361455	12361633	8421504	3	5,10,8	0,8,170	c	350016650100000343	0-24						3-hydroxypropionic acid and other organic compounds - US Patent 7186541 Description	ww.patentstorm.us	0	0		
679	chrI	12361455	12361633	3500104401	23		12361455	12361633	8421504	3	5,10,8	0,8,170	c	350010440100000342	3-27						3-HYDROXYPROPIONIC ACID AND OTHER ORGANIC COMPOUNDS - Patent application	www.faqs.org	0	0		
679	chrI	12369688	12369718	3500205156	25		12369688	12369718	8421504	2	8,17	0,13	g	350020515600000002	0-27						生物信息教程上 - 豆丁网	www.docin.com	0	0		
679	chrI	12370595	12370621	3500394783	23		12370595	12370621	8421504	2	17,6	0,20	g	350039478300000308	7-30						<Html><Title> Complet list of 1dj9 hssp file Complet list of	cnptia.embrapa.br	0	0		
679	chrI	12382347	12382373	3500083693	23		12382347	12382373	8421504	2	13,10	0,16	c	350008369300000004	0-23						Dual Functions of the Heartless Fibroblast Growth Factor Receptor in Development of the Drosophila Embryonic Mesoderm	h.med.harvard.edu	0	0		
679	chrI	12395816	12395848	3500196959	25		12395816	12395848	8421504	3	8,3,14	0,13,18	c,g	350019695900001829,350019695900001829	7-32,7-32						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
679	chrI	12432861	12433495	3500276014	42		12432861	12433495	8421504	2	20,22	0,612	g	350027601400000007,350027601400000006	0-20,0-22						Chromosome-Wide Regulation of Meiotic Crossover Formation in Caenorhabditis elegans Requires Properly Assembled Chromosome Axes	www.genetics.org	0	0		
679	chrI	12445657	12445735	3500166979	24		12445657	12445735	8421504	3	14,2,8	0,18,70	c	350016697900000132	13-37						METHODS FOR ENHANCING GENOME STABILITY AND TELOMERE ELONGATION IN EMBRYONIC STEM CELLS - Patent application	www.faqs.org	0	0		
680	chrI	12461789	12461840	3500197656	51		12461789	12461840	8421504	1	51	0	p	350019765600015156	0-51						Karakterisatie van neuromedine U-, tachykinine- en GnRH-verwante receptoren	w.scriptiebank.be	0	0		
680	chrI	12497473	12497499	3500080694	25		12497473	12497499	8421504	2	5,20	0,6	g	350008069400000348	20-45						MIXING AND MATCHING TC PROTEINS FOR PEST CONTROL - Patent application	www.faqs.org	0	0		
680	chrI	12504876	12504899	3500147387	23		12504876	12504899	8421504	1	23	0	c	350014738700000068	12-35						Phylogenetic Position of the Dicyemid Mesozoa Inferred from 18s rDNA Sequences	www.biolbull.org	0	0		
680	chrI	12530294	12530317	3500142331	23		12530294	12530317	8421504	1	23	0	c	350014233100000002	8-31						 SpringerImages - Transformation of rice with pRiceFOX, a binary Ti plasmid vector for overexpressing FL-cDNAs in plants. (A) Schematic structure of the pRiceFOX plasmid. The expression vector pRiceFOX allows unidirectional cloning of individual rice FL-c	pringerimages.com	0	0		
680	chrI	12532891	12532929	3500172906	29		12532891	12532929	8421504	3	7,9,13	0,11,25	c	350017290600000542	2-32					Patent	Immunostimulatory sequence oligonucleotides and methods of using the same (Patent CN:101693890)	D*Di Na 	2012	0		
680	chrI	12532992	12533855	3500034726	41		12532992	12533855	8421504	2	20,21	0,842	c,g	350003472600000012,350003472600000013,350003472600000013	19-39,18-39,18-39						The use of eukaryotic genes affecting chromatin separation for diagnosis and treatment of proliferative diseases	Echeverri	2005	0		
680	chrI	12538220	12538780	3500453426	39		12538220	12538780	8421504	2	19,20	0,540	c,g	350045342600000001,350045342600000001,350045342600000000	0-19,0-19,0-20						PAR-6 is a conserved PDZ domain-containing protein that colocalizes with PAR-3 in Caenorhabditis elegans embryos. - ResearchGate	.researchgate.net	0	0		
680	chrI	12538220	12538780	3500068797	39		12538220	12538780	8421504	2	19,20	0,540	c,g	350006879700000001,350006879700000001,350006879700000000	0-19,0-19,0-20						PAR-6 is a conserved PDZ domain-containing protein that colocalizes with PAR-3 in Caenorhabditis elegans embryos	ev.biologists.org	0	0		
680	chrI	12562808	12562836	3500148007	23		12562808	12562836	8421504	2	11,12	0,16	g	350014800700000001	0-23		19627593	10.1186/1471-2148-9-175	1471-2148	BMC Evolutionary Biology	Molecular phylogenetics and evolutionary history of ariid catfishes revisited: a comprehensive sampling	Betancur-R	2009	4		
680	chrI	12568720	12571438	3500334429	105		12568720	12571438	8421504	5	20,21,22,22,20	0,506,805,1885,2698	c,g	350033442900000001,350033442900000003,350033442900000003,350033442900000000,350033442900000005,350033442900000005,350033442900000004,350033442900000004	0-20,0-21,0-21,0-22,0-22,0-22,0-20,0-20		23141066	10.1016/j.neuron.2012.08.043		Neuron	Regulation of DLK-1 kinase activity by calcium-mediated dissociation from an inhibitory isoform	Dong	2012	0		
680	chrI	12569783	12572783	3500216599	41		12569783	12572783	8421504	2	20,21	0,2979	c,g	350021659900000003,350021659900000003,350021659900000002,350021659900000002	0-20,0-20,0-21,0-21						METHODS AND COMPOSITIONS RELATED TO DLK-1 AND THE P38 MAPK PATHWAY IN NERVE REGENERATION - Patent application	www.faqs.org	0	0		
681	chrI	12594572	12595715	3500419856	46		12594572	12595715	8421504	2	24,22	0,1121	c,g	350041985600000014,350041985600000014,350041985600000013,350041985600000013	0-24,0-24,0-22,0-22						Large-Scale Sequencing Reveals 21U-RNAs and Additional MicroRNAs and Endogenous siRNAs in C. elegans	tellab.wi.mit.edu	0	0		
681	chrI	12594572	12595715	3500375579	46		12594572	12595715	8421504	2	24,22	0,1121	c,g	350037557900000014,350037557900000014,350037557900000013,350037557900000013	0-24,0-24,0-22,0-22						Large-Scale Sequencing Reveals 21U-RNAs and Additional MicroRNAs and Endogenous siRNAs in C. elegans	tellab.wi.mit.edu	0	0		
681	chrI	12594572	12595715	3500271863	46		12594572	12595715	8421504	2	24,22	0,1121	c,g	350027186300000007,350027186300000007,350027186300000008,350027186300000008	0-24,0-24,0-22,0-22						Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel	biomedcentral.com	0	0		
681	chrI	12609482	12618238	3500453426	60		12609482	12618238	8421504	3	20,20,20	0,284,8736	g	350045342600000002,350045342600000003,350045342600000005	0-20,0-20,0-20						PAR-6 is a conserved PDZ domain-containing protein that colocalizes with PAR-3 in Caenorhabditis elegans embryos. - ResearchGate	.researchgate.net	0	0		
681	chrI	12609482	12618238	3500068797	60		12609482	12618238	8421504	3	20,20,20	0,284,8736	g	350006879700000002,350006879700000003,350006879700000005	0-20,0-20,0-20						PAR-6 is a conserved PDZ domain-containing protein that colocalizes with PAR-3 in Caenorhabditis elegans embryos	ev.biologists.org	0	0		
681	chrI	12621159	12623074	3500337672	1119		12621159	12623074	8421504	6	112,144,556,144,140,23	0,156,413,1018,1730,1892	p,c,g	350033767200000000,350033767200015004,350033767200015010,350033767200015016,350033767200015022,350033767200015028,350033767200000001,350033767200000001	3-23,0-216,0-237,0-210,0-210,0-222,0-23,0-23						Supplementary Materials for	ww.sciencemag.org	0	0		
681	chrI	12623999	12624027	3500063898	23		12623999	12624027	8421504	2	12,11	0,17	g	350006389800000017	7-34						转基因非人动物及其用途	H.De Lei Si Le 	2013	0		
681	chrI	12624424	12624496	3500197656	72		12624424	12624496	8421504	1	72	0	p	350019765600015227	0-72						Karakterisatie van neuromedine U-, tachykinine- en GnRH-verwante receptoren	w.scriptiebank.be	0	0		
681	chrI	12653143	12653977	3500022688	270		12653143	12653977	8421504	5	72,42,30,63,63	0,501,558,705,771	p	350002268800015020,350002268800015024,350002268800015026,350002268800015027	0-72,9-93,18-81,0-63						テンサイの細胞質雄性不稔性におけるミトコンドリア遺 Issue Date http://hdl.handle.net/2115/12155	lib.hokudai.ac.jp	0	0		
681	chrI	12653188	12653213	3500431134	25		12653188	12653213	8421504	1	25	0	c	350043113400000010	0-25						Variable nuclear markers for a Sonoran Desert bark beetle, Araptus attenuatus Wood (Curculionidae: Scolytinae), with applications to related genera	erlab.bio.vcu.edu	0	0		
681	chrI	12653626	12653677	3500027621	51		12653626	12653677	8421504	1	51	0	p	350002762100015027	0-51						TEREZA CRISTINA VIEIRA de REZENDE	itorio.bce.unb.br	0	0		ATP5A1
85	chrI	12669371	12750134	3500453426	1456		12669371	12750134	8421504	12	76,134,94,192,98,121,94,197,392,19,19,20	0,244,910,1934,2975,3142,3313,4467,4676,50028,50474,80743	p,c,g	350045342600000016,350045342600015005,350045342600000017,350045342600000017,350045342600015006,350045342600000018,350045342600000018,350045342600015022,350045342600015007,350045342600000019,350045342600000019,350045342600015023,350045342600015008,350045342600000020,350045342600015009,350045342600000021,350045342600000021,350045342600015010,350045342600000022,350045342600000022,350045342600015011,350045342600000023,350045342600015035,350045342600015012,350045342600000024,350045342600000024,350045342600015013,350045342600000025,350045342600000025,350045342600015037,350045342600015026,350045342600015014,350045342600000026,350045342600015015,350045342600000027,350045342600000027,350045342600015027,350045342600000028,350045342600000028,350045342600000010,350045342600000029,350045342600000029,350045342600015018,350045342600000030,350045342600000030,350045342600015019,350045342600000031,350045342600000032,350045342600000033,350045342600000006,350045342600000007,350045342600000009	0-120,0-60,0-60,0-60,0-60,0-60,0-60,0-117,0-60,0-60,0-60,0-120,0-60,0-60,0-66,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-120,0-63,0-60,0-60,0-60,0-61,0-61,0-411,0-120,0-60,0-60,0-60,0-60,0-60,0-57,0-60,0-60,0-20,0-60,0-60,0-60,0-61,0-61,0-45,0-47,0-60,0-332,0-19,0-19,0-20						PAR-6 is a conserved PDZ domain-containing protein that colocalizes with PAR-3 in Caenorhabditis elegans embryos. - ResearchGate	.researchgate.net	0	0		
85	chrI	12669371	12750134	3500068797	1441		12669371	12750134	8421504	13	76,134,94,192,98,121,94,197,60,317,19,19,20	0,244,910,1934,2975,3142,3313,4467,4676,4751,50028,50474,80743	p,c,g	350006879700000016,350006879700015017,350006879700015001,350006879700000017,350006879700000017,350006879700015002,350006879700000018,350006879700000018,350006879700015003,350006879700000019,350006879700000019,350006879700015004,350006879700000020,350006879700015005,350006879700000021,350006879700000021,350006879700015006,350006879700000022,350006879700000022,350006879700015020,350006879700015007,350006879700000023,350006879700015027,350006879700015009,350006879700000024,350006879700000024,350006879700015010,350006879700000025,350006879700000025,350006879700015030,350006879700015011,350006879700000026,350006879700015012,350006879700000027,350006879700000027,350006879700000028,350006879700000028,350006879700000010,350006879700000029,350006879700000029,350006879700015015,350006879700000030,350006879700000030,350006879700015016,350006879700000031,350006879700000032,350006879700000033,350006879700000006,350006879700000007,350006879700000009	0-120,0-93,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-66,0-60,0-60,0-60,0-60,0-60,729-1836,0-51,0-60,0-120,0-63,0-60,0-60,0-60,0-61,0-61,12-429,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-20,0-60,0-60,0-60,0-61,0-61,0-45,0-47,0-60,0-317,0-19,0-19,0-20						PAR-6 is a conserved PDZ domain-containing protein that colocalizes with PAR-3 in Caenorhabditis elegans embryos	ev.biologists.org	0	0		
681	chrI	12669615	12673948	3500455277	64		12669615	12673948	8421504	3	22,23,19	0,1753,4314	c,g	350045527700000004,350045527700000004,350045527700000007,350045527700000008,350045527700000008	7-29,7-29,7-30,9-28,9-28						CDC-42 controls early cell polarity and spindle orientation in C. elegans Monica Gotta, Mary C. Abraham and Julie Ahringer	.gurdon.cam.ac.uk	0	0		
681	chrI	12683417	12683445	3500083736	28		12683417	12683445	8421504	1	28	0	c	350008373600000131	48-76						<script type="text/javascript"> if (typeof($) == 'undefined') window.location.pathname = "/p	ww.patentlens.net	0	0		
681	chrI	12709399	12709429	3500274581	25		12709399	12709429	8421504	2	12,13	0,17	c	350027458100000316	0-25							n.biotec.uiuc.edu	0	0		
682	chrI	12735096	12736523	3500014227	24		12735096	12736523	8421504	2	9,15	0,1412	c	350001422700000027	7-31						Methods for Incorporating Unnatural Amino Acids in Eukaryotic Cells	Chin	2011	0		
682	chrI	12741713	12741746	3500197802	27		12741713	12741746	8421504	3	13,4,10	0,14,23	g	350019780200000029,350019780200000028	0-27,0-27						Yeast cells engineered to produce pheromone system protein surrogates and uses therefor	Fowlkes	2002	0		
682	chrI	12741713	12741746	3500152838	27		12741713	12741746	8421504	3	13,4,10	0,14,23	g	350015283800000023	0-27						US Patent # 5,876,951. Yeast cells engineered to produce pheromone system protein surrogates and uses therefor - Patents.com	www.patents.com	0	0		
682	chrI	12741713	12741746	3500046024	30		12741713	12741746	8421504	2	20,10	0,23	g	350004602400000032,350004602400000023	0-19,0-27						Yeast cells engineered to produce pheromone system protein surrogates, and uses therefor - US Patent 7235648 Description	ww.patentstorm.us	0	0		
682	chrI	12761520	12761545	3500093212	23		12761520	12761545	8421504	3	4,14,5	0,5,20	g	350009321200000038	5-28						Diagnose von Filarieninfektionen im Menschen und im Überträger mit Hilfe der Polymerase-Kettenreaktion	ub.uni-hamburg.de	0	0		
682	chrI	12784141	12784168	3500211468	23		12784141	12784168	8421504	2	6,17	0,10	c	350021146800000035	21-45						Insect-specific paralytic neurotoxin genes for use in biological insect control: methods and compositions	Tomalski	1990	0		
682	chrI	12796310	12844380	3500000902	43		12796310	12844380	8421504	5	12,7,5,12,7	0,17,26,48050,48063	c,g	350000090200000075,350000090200000398	19-43,11-30						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
682	chrI	12811738	12811767	3500426992	24		12811738	12811767	8421504	2	12,12	0,17	g	350042699200000430	23-47						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
682	chrI	12821847	12821913	3500346018	66		12821847	12821913	8421504	1	66	0	p	350034601800015014	0-66						CHARACTERIZATION OF LpSK6: A LYCOPERSICON	.diagnosisnet.com	0	0		GSK3A
683	chrI	12882742	12920247	3500190843	47		12882742	12920247	8421504	4	21,4,5,17	0,22,37480,37488	g	350019084300001612,350019084300001450	8-33,3-25						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
683	chrI	12919107	12923271	3500253254	60		12919107	12923271	8421504	3	19,22,19	0,2899,4145	c,g	350025325400000006,350025325400000007,350025325400000001,350025325400000001	0-19,23-45,12-31,12-31			10.1002/cm.20102		Cell motility and the cytoskeleton	Caenorhabditis elegans Expresses Three Functional Profilins in a Tissue-Specific Manner	D.	2006	0		
683	chrI	12941178	12945090	3500461285	78		12941178	12945090	8421504	4	20,20,19,19	0,798,3694,3893	c,g	350046128500000057,350046128500000057,350046128500000056,350046128500000056,350046128500000059,350046128500000059,350046128500000058,350046128500000058	0-20,0-20,0-20,0-20,0-19,0-19,0-19,0-19						KRUPPEL-LIKE FACTORS AND FAT REGULATION - Patent application	www.faqs.org	0	0		
683	chrI	12943797	12943821	3500335751	23		12943797	12943821	8421504	2	9,14	0,10	c,g	350033575100000007,350033575100000007	2-25,2-25						Blackwell Science, Ltd Genetic variation in two populations of the rough-skinned newt ( Taricha granulosa ) assessed using novel tetranucleotide microsatellite loci	e.oregonstate.edu	0	0		
683	chrI	12943797	12943821	3500054279	23		12943797	12943821	8421504	2	9,14	0,10	c,g	350005427900000007,350005427900000007	2-25,2-25						Blackwell Science, Ltd Genetic variation in two populations of the rough-skinned newt ( Taricha granulosa ) assessed using novel tetranucleotide microsatellite loci	www.bio.tamu.edu	0	0		
683	chrI	12964880	12964922	3500009376	42		12964880	12964922	8421504	1	42	0	c	350000937600006100	0-43						 Galaxy | Dataset | FASTQ Groomer on data 2	popgenie.org:8080	0	0		
683	chrI	12965428	12965642	3500397627	40		12965428	12965642	8421504	2	20,20	0,194	c,g	350039762700000009,350039762700000008,350039762700000008	0-20,0-20,0-20		12421712	10.1242/dev.00175	0950-1991	Development	Genomic analysis of neural crest induction	Gammill	2002	7		
683	chrI	12965428	12965642	3500037423	40		12965428	12965642	8421504	2	20,20	0,194	c,g	350003742300000009,350003742300000008,350003742300000008	0-20,0-20,0-20						Genomic analysis of neural crest induction	ev.biologists.org	0	0		
683	chrI	12966180	12966203	3500041721	23		12966180	12966203	8421504	1	23	0	c,g	350004172100000010,350004172100000010	0-23,0-23						INAUGURAL - DISSERTATION	uni-heidelberg.de	0	0		
85	chrI	12971570	13000557	3500068806	41		12971570	13000557	8421504	4	15,6,15,5	0,18,28966,28982	c,g	350006880600000190,350006880600000099	8-30,21-41						ELONGASES AND METHODS FOR PRODUCING POLYUNSATURATED FATTY ACIDS IN TRANSGENIC ORGANISMS - Patent application	www.faqs.org	0	0		
684	chrI	12976532	12976727	3500434995	60		12976532	12976727	8421504	2	27,33	0,162	p	350043499500015000	0-63						Molecular cloning, sequence analysis and homology modeling of galE encoding UDP-galactose 4-epimerase of Aeromonas hydrophila	ioinformation.net	0	0		GALE
684	chrI	12976532	12976727	3500283734	60		12976532	12976727	8421504	2	27,33	0,162	p	350028373400015000	0-63					Bioinformation	Molecular cloning, sequence analysis and homology modeling of galE encoding UDP-galactose 4-epimerase of Aeromonas hydrophila	Shivani	2009	0		GALE
684	chrI	12981884	12981910	3500166683	24		12981884	12981910	8421504	3	8,11,5	0,9,21	c	350016668300000847,350016668300000849	1-38,1-38						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
684	chrI	12985637	12985662	3500453101	23		12985637	12985662	8421504	2	18,5	0,20	g	350045310100000143	0-23						 Nucleotide Sequences Encoding Anthonomous Toxic Polypeptides From Bacillus Thuringiensis 	www.docstoc.com	0	0		
684	chrI	12994296	12995121	3500197656	90		12994296	12995121	8421504	3	45,15,30	0,729,795	p	350019765600015107,350019765600015111	0-45,0-45						Karakterisatie van neuromedine U-, tachykinine- en GnRH-verwante receptoren	w.scriptiebank.be	0	0		
684	chrI	13021416	13021443	3500148268	24		13021416	13021443	8421504	2	11,13	0,14	g	350014826800000031	0-24						メチシリン耐性黄色ブドウ球菌の検出方法ならびにその検出用プライマ	astamuse.com	0	0		
684	chrI	13075803	13075827	3500418506	23		13075803	13075827	8421504	2	10,13	0,11	g	350041850600000012	0-23						A set of primers for length and nucleotide-substitution polymorphism in chloroplastic DNA of Olea europaea (Oleaceae)	.researchgate.net	0	0		
684	chrI	13077516	13077541	3500352612	23		13077516	13077541	8421504	2	6,17	0,8	g	350035261200001270	21-44						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
684	chrI	13084667	13084698	3500359712	28		13084667	13084698	8421504	3	4,18,6	0,5,25	c	350035971200000312	0-28						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
685	chrI	13131462	13131487	3500173250	23		13131462	13131487	8421504	3	14,5,4	0,15,21	g	350017325000000352	10-33						Engineered Listeria and methods of use thereof	Dubensky	2006	0		
685	chrI	13154564	13155077	3500349769	42		13154564	13155077	8421504	4	6,15,15,6	0,7,490,507	g	350034976900000007,350034976900000004,350034976900000000,350034976900000001,350034976900000003	5-26,8-29,10-31,10-31,8-29						 Bioscope sam output - SEQanswers	seqanswers.com	0	0		
685	chrI	13203401	13203479	3500314770	24		13203401	13203479	8421504	2	17,7	0,71	c	350031477000000082	20-44						Nuclei acid and polypeptide compositions encoding lepidopteran-toxic polypeptides	Baum	1999	0		
685	chrI	13203401	13203479	3500007879	24		13203401	13203479	8421504	2	17,7	0,71	c	350000787900000081	20-44						Lepidopteran-resistent transgenic plants	Baum	1999	0		
686	chrI	13289549	13289572	3500189921	23		13289549	13289572	8421504	1	23	0	g	350018992100000039	6-39						METHOD FOR IDENTIFICATION OF T-LYMPHOCYTE ANTIGENS	Brown	2009	0		
686	chrI	13310075	13310256	3500395114	40		13310075	13310256	8421504	2	20,20	0,161	c,g	350039511400000026,350039511400000026,350039511400000027	0-20,0-20,0-20		23103171	10.1016/j.celrep.2012.09.019	2211-1247	Cell Reports	Cell Reports - Antagonism between MES-4 and Polycomb Repressive Complex 2 Promotes Appropriate Gene Expression in C. elegans Germ Cells	Gaydos	2012	0		
686	chrI	13310075	13310256	3500150118	40		13310075	13310256	8421504	2	20,20	0,161	c,g	350015011800000026,350015011800000026,350015011800000027	0-20,0-20,0-20		23103171	10.1016/j.celrep.2012.09.019	2211-1247	Cell Reports	Cell Reports - Antagonism between MES-4 and Polycomb Repressive Complex 2 Promotes Appropriate Gene Expression in C. elegans Germ Cells	Gaydos	2012	0		
686	chrI	13352097	13354387	3500405992	54		13352097	13354387	8421504	2	30,24	0,2266	p	350040599200015000	117-171						Expressed sequence tag profiling identifies developmental and anatomic partitioning of gene expression in the mouse prostate Denise E Abbott , Colin *Pritchard , Nigel J Clegg , Camari Ferguson Ruth Dumpit , Robert A Sikes	genomebiology.com	0	0		
686	chrI	13352097	13354387	3500254660	54		13352097	13354387	8421504	2	30,24	0,2266	p	350025466000015000	117-171						Expressed sequence tag profiling identifies developmental and anatomic partitioning of gene expression in the mouse prostate Denise E Abbott , Colin *Pritchard , Nigel J Clegg , Camari Ferguson Ruth Dumpit , Robert A Sikes	pedb.org/PUBLICAT	0	0		
686	chrI	13361702	13361816	3500100022	114		13361702	13361816	8421504	1	114	0	p	350010002200015081	54-168						Peptide-dicer substrate rna conjugates as delivery vehicles for sirna	Ahmadian	2007	0		
686	chrI	13361702	13361780	3500208064	78		13361702	13361780	8421504	1	78	0	p	350020806400015035	0-78						COMPOSITIONS AND METHODS FOR LIPID AND POLYPEPTIDE BASED siRNA INTRACELLULAR DELIVERY	Cui	2007	0		
687	chrI	13382549	13382573	3500397394	23		13382549	13382573	8421504	2	6,17	0,7	g	350039739400000002	2-25						Identi¢cation of a cDNA encoding an active asparaginyl endopeptidase of Schistosoma mansoni and its expression in Pichia pastoris	olab.stanford.edu	0	0		
687	chrI	13384189	13389831	3500153784	102		13384189	13389831	8421504	6	19,21,20,20,14,8	0,4743,5124,5200,5266,5634	c,g	350015378400000012,350015378400000002,350015378400000002,350015378400000006,350015378400000006,350015378400000003,350015378400000003,350015378400000007	0-19,16-37,16-37,0-20,0-20,17-37,17-37,0-22			10.1186/2046-2395-2-9	2046-2395	Longevity & Healthspan	The SFT-1 and OXA-1 respiratory chain complex assembly factors influence lifespan by distinct mechanisms in C. elegans	Maxwell	2013	0		
687	chrI	13403211	13403259	3500197656	48		13403211	13403259	8421504	1	48	0	p	350019765600015155	0-48						Karakterisatie van neuromedine U-, tachykinine- en GnRH-verwante receptoren	w.scriptiebank.be	0	0		
687	chrI	13442700	13442727	3500079225	24		13442700	13442727	8421504	3	4,5,15	0,5,12	c	350007922500000024	2-26						Wang et al. Characterization of single nucleotide polymorphism (SNP) markers for the Chinese black sleeper, Bostrychus sinensis. Afr. J. Biotechnol.	demicjournals.org	0	0		
687	chrI	13463426	13463943	3500014227	45		13463426	13463943	8421504	2	22,23	0,494	g	350001422700000000,350001422700000001	0-22,2-25						Methods for Incorporating Unnatural Amino Acids in Eukaryotic Cells	Chin	2011	0		
687	chrI	13470128	13470153	3500343811	23		13470128	13470153	8421504	2	13,10	0,15	g	350034381100003484	16-40						1531 26.93 2.31 1.16 sequence_4 1 432 (149568) + Gypsy12-ZM_I LTR/Gypsy 	nomics.purdue.edu	0	0		
688	chrI	13543370	13548503	3500285271	111		13543370	13548503	8421504	3	45,29,37	0,1779,5096	c,g	350028527100000011,350028527100000010,350028527100000010,350028527100000016,350028527100000016,350028527100000009,350028527100000008	8-53,8-32,8-32,7-28,7-28,10-34,0-37		16571673	10.1091/mbc.E05-12-1170	1059-1524	Molecular Biology of the Cell	Regulation of Synaptic Transmission by RAB-3 and RAB-27 in Caenorhabditis elegans	Mahoney	2006	5		
688	chrI	13543721	13544373	3500268417	69		13543721	13544373	8421504	3	29,20,20	0,504,632	c,g	350026841700000000,350026841700000000,350026841700000002,350026841700000002,350026841700000003,350026841700000003,350026841700000001	0-20,0-20,0-20,0-20,0-20,0-20,0-20						ナショナルバイオリソースプロジェクト (NBRP) C.elegans Mutants	.shigen.nig.ac.jp	0	0		
688	chrI	13578984	13579011	3500030766	24		13578984	13579011	8421504	2	12,12	0,15	c	350003076600000805	12-36						>vs_0 TACCAACAGCTACTCCCATGCAAAGCACTTTCTTAAGCTGGAATTTGACCATAGCCTTAGT >vs_1 AGTAACCGCGATTCCAACACAAA	biomedcentral.com	0	0		
688	chrI	13579213	13579238	3500231569	25		13579213	13579238	8421504	1	25	0	c	350023156900000011	0-25						Use of rbcLand trnL-Fas a Two-Locus DNA Barcode for Identification of NW-European Ferns: An Ecological Perspective	www.ecbol.org	0	0		
688	chrI	13579213	13579238	3500116410	25		13579213	13579238	8421504	1	25	0	c	350011641000000011	0-25						The fate of a colonizer: successful but lonely?	ive.library.uu.nl	0	0		
688	chrI	13619704	13619729	3500148414	24		13619704	13619729	8421504	2	17,7	0,18	c,g	350014841400000713,350014841400000713	5-29,5-29						Development of novel anti-microbial agents based on bacteriophage genomics	Pelletier	1999	0		
689	chrI	13698871	13698898	3500245292	24		13698871	13698898	8421504	2	7,17	0,10	c	350024529200000005	0-24						Supporting Information	www.pnas.org	0	0		
689	chrI	13712638	13712749	3500395481	24		13712638	13712749	8421504	3	14,9,1	0,18,110	c	350039548100000164	10-34						Apparatus and method for detecting and identifying infectious agents - Patent # 6649356 - PatentGenius	.patentgenius.com	0	0		
689	chrI	13713322	13713350	3500301737	24		13713322	13713350	8421504	2	15,9	0,19	c	350030173700000193	0-24						<Html><Title> Complet list of 3ihg hssp file Complet list of	cnptia.embrapa.br	0	0		
689	chrI	13724701	13724803	3500357579	40		13724701	13724803	8421504	2	21,19	0,83	c,g	350035757900000007,350035757900000007,350035757900000006,350035757900000006	0-21,0-21,0-19,0-19		19424872	10.1007/s11357-008-9046-3		Age	Genetic analysis of hyl-1, the C. elegans homolog of LAG1/LASS1	Patricia	2008	0		
689	chrI	13738909	13738935	3500367251	24		13738909	13738935	8421504	2	12,12	0,14	g	350036725100001252	14-38						<HTML> <TITLE>BLAST Search Results  Complet list of 3ct2 hssp file Complet list of	cnptia.embrapa.br	0	0		
692	chrI	14147669	14147694	3500008851	25		14147669	14147694	8421504	1	25	0	g	350000885100000349	61-86						<Html><Title> Complet list of 1e32 hssp file Complet list of	cnptia.embrapa.br	0	0		
692	chrI	14153339	14153484	3500161471	39		14153339	14153484	8421504	3	20,8,11	0,79,134	c	350016147100000001,350016147100000000	0-20,0-19		21731485	10.1371/journal.ppat.1002074		PLoS Pathogens	Candida albicans Infection of Caenorhabditis elegans Induces Antifungal Immune Defenses	Read	June	0		
693	chrI	14207138	14207167	3500134619	28		14207138	14207167	8421504	2	15,13	0,16	c,g	350013461900000840,350013461900000840	7-45,7-45						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
693	chrI	14231742	14231770	3500452606	23		14231742	14231770	8421504	2	9,14	0,14	c	350045260600000102	0-23						BsuisMicroarraySpreadsheet.xls	www.docstoc.com	0	0		
693	chrI	14231742	14231770	3500007155	23		14231742	14231770	8421504	2	9,14	0,14	c	350000715500000102	0-23						Sheet1	www.docstoc.com	0	0		
693	chrI	14264619	14264646	3500362698	23		14264619	14264646	8421504	2	6,17	0,10	g	350036269800000236	1-25						Rubber tree genome download sequences	ww4a.biotec.or.th	0	0		
693	chrI	14275893	14275923	3500115005	24		14275893	14275923	8421504	3	13,6,5	0,16,25	g	350011500500000143	0-24						<Html><Title> Complet list of 2x4z hssp file Complet list of	cnptia.embrapa.br	0	0		
694	chrI	14311163	14312705	3500143070	46		14311163	14312705	8421504	2	20,26	0,1516	c,g	350014307000000390,350014307000000361	28-48,3-29						<Html><Title> Complet list of 3a2p hssp file Complet list of	cnptia.embrapa.br	0	0		
694	chrI	14312679	14312707	3500341598	28		14312679	14312707	8421504	1	28	0	c	350034159800000250,350034159800000006,350034159800000218	13-39,0-22,22-43						<Html><Title> Complet list of 1asz hssp file Complet list of	cnptia.embrapa.br	0	0		
694	chrI	14312679	14312707	3500218436	28		14312679	14312707	8421504	1	28	0	c	350021843600000093,350021843600000097,350021843600000095	0-26,2-27,2-27						<Html><Title> Complet list of 2aqi hssp file Complet list of	cnptia.embrapa.br	0	0		
694	chrI	14312679	14312707	3500035753	28		14312679	14312707	8421504	1	28	0	c	350003575300000092,350003575300000503	10-36,11-33						<Html><Title> Complet list of 2qbq hssp file Complet list of	cnptia.embrapa.br	0	0		
694	chrI	14312679	14312706	3500354008	27		14312679	14312706	8421504	1	27	0	c	350035400800000302,350035400800000084	6-32,4-28						<Html><Title> Complet list of 3mun hssp file Complet list of	cnptia.embrapa.br	0	0		
694	chrI	14312679	14312705	3500428528	26		14312679	14312705	8421504	1	26	0	c	350042852800000111	0-26						<Html><Title> Complet list of 2zux hssp file Complet list of	cnptia.embrapa.br	0	0		
694	chrI	14312679	14312705	3500408786	26		14312679	14312705	8421504	1	26	0	c	350040878600000324	12-38						<Html><Title> Complet list of 1w6k hssp file Complet list of	cnptia.embrapa.br	0	0		
694	chrI	14312679	14312705	3500327405	26		14312679	14312705	8421504	1	26	0	c	350032740500000106,350032740500000277	6-32,0-24						<Html><Title> Complet list of 1o8q hssp file Complet list of	cnptia.embrapa.br	0	0		
694	chrI	14312679	14312705	3500306261	26		14312679	14312705	8421504	1	26	0	c	350030626100000376	20-46						<Html><Title> Complet list of 2b6p hssp file Complet list of	cnptia.embrapa.br	0	0		
694	chrI	14312679	14312705	3500299879	26		14312679	14312705	8421504	1	26	0	c	350029987900000078	19-45						<Html><Title> Complet list of 1acb hssp file Complet list of	cnptia.embrapa.br	0	0		
694	chrI	14312679	14312705	3500126074	26		14312679	14312705	8421504	1	26	0	c	350012607400000112	0-26						<Html><Title> Complet list of 1m2n hssp file Complet list of	cnptia.embrapa.br	0	0		
694	chrI	14312679	14312705	3500096011	26		14312679	14312705	8421504	1	26	0	c	350009601100000324	3-29						<Html><Title> Complet list of 2vex hssp file Complet list of	cnptia.embrapa.br	0	0		
694	chrI	14312679	14312705	3500078842	26		14312679	14312705	8421504	1	26	0	c	350007884200000406	0-26						<Html><Title> Complet list of 3exb hssp file Complet list of	cnptia.embrapa.br	0	0		
694	chrI	14312679	14312705	3500074491	26		14312679	14312705	8421504	1	26	0	c	350007449100000246	11-37						<Html><Title> Complet list of 1cmp hssp file Complet list of	cnptia.embrapa.br	0	0		
694	chrI	14312679	14312705	3500030592	26		14312679	14312705	8421504	1	26	0	c	350003059200000098	10-36						<Html><Title> Complet list of 1slm hssp file Complet list of	cnptia.embrapa.br	0	0		
694	chrI	14312679	14312704	3500135285	25		14312679	14312704	8421504	1	25	0	c	350013528500000422	0-25						<Html><Title> Complet list of 1t4j hssp file Complet list of	cnptia.embrapa.br	0	0		
694	chrI	14312679	14312703	3500331756	24		14312679	14312703	8421504	1	24	0	c	350033175600000262	0-24						<Html><Title> Complet list of 2v23 hssp file Complet list of	cnptia.embrapa.br	0	0		
694	chrI	14312679	14312703	3500251711	24		14312679	14312703	8421504	1	24	0	c	350025171100000692	0-24						<Html><Title> Complet list of 1ea9 hssp file Complet list of	cnptia.embrapa.br	0	0		
694	chrI	14312679	14312703	3500073876	24		14312679	14312703	8421504	1	24	0	c	350007387600000095	0-24						<Html><Title> Complet list of 1tn7 hssp file Complet list of	cnptia.embrapa.br	0	0		
694	chrI	14312679	14312703	3500033414	24		14312679	14312703	8421504	1	24	0	c	350003341400000692	0-24						<Html><Title> Complet list of 1ea9 hssp file Complet list of	cnptia.embrapa.br	0	0		
694	chrI	14312679	14312702	3500185528	23		14312679	14312702	8421504	1	23	0	c	350018552800000017	0-23						Compositions and methods for improving production of recombinant polypeptides	Bogin	2010	0		
694	chrI	14312679	14312702	3500083128	23		14312679	14312702	8421504	1	23	0	c	350008312800000017	0-23						COMPOSITIONS AND METHODS FOR IMPROVING PRODUCTION OF RECOMBINANT POLYPEPTIDES	Bogin	2009	0		
694	chrI	14312680	14312705	3500339664	25		14312680	14312705	8421504	1	25	0	c	350033966400000109	5-30						<Html><Title> Complet list of 1bc0 hssp file Complet list of	cnptia.embrapa.br	0	0		
694	chrI	14312680	14312705	3500322237	25		14312680	14312705	8421504	1	25	0	c	350032223700000289	0-32						<Html><Title> Complet list of 1rz1 hssp file Complet list of	cnptia.embrapa.br	0	0		
694	chrI	14312680	14312705	3500319585	25		14312680	14312705	8421504	1	25	0	c	350031958500000191,350031958500000077,350031958500000203,350031958500000299	0-23,0-25,0-22,0-24						<Html><Title> Complet list of 3ckx hssp file Complet list of	cnptia.embrapa.br	0	0		
694	chrI	14312680	14312705	3500301737	25		14312680	14312705	8421504	1	25	0	c	350030173700000057	0-25						<Html><Title> Complet list of 3ihg hssp file Complet list of	cnptia.embrapa.br	0	0		
694	chrI	14312680	14312705	3500267539	25		14312680	14312705	8421504	1	25	0	c	350026753900001499	0-25						@DGFC08P1:101:C0836ACXX:1:1101:5132:139620:6/1 GACACCCGTAAAGGGTCTGTGCTGAGGAGGATTAGTATAAGAGGAAGGCATG	markovitzlab.com	0	0		
694	chrI	14312680	14312705	3500226963	25		14312680	14312705	8421504	1	25	0	c	350022696300000346	5-30						<Html><Title> Complet list of 1juk hssp file Complet list of	cnptia.embrapa.br	0	0		
694	chrI	14312680	14312705	3500185929	25		14312680	14312705	8421504	1	25	0	c	350018592900000065	2-27						HSSP HOMOLOGY DERIVED SECONDARY STRUCTURE OF PROTEINS , VERSION 1.1 2001 PDBID 1bf2 DATE 	tp.cbi.pku.edu.cn	0	0		
694	chrI	14312680	14312705	3500164555	25		14312680	14312705	8421504	1	25	0	c	350016455500000188,350016455500000309	22-47,4-29						<Html><Title> Complet list of 1ptu hssp file Complet list of	cnptia.embrapa.br	0	0		
694	chrI	14312680	14312705	3500089568	25		14312680	14312705	8421504	1	25	0	c	350008956800000068	4-29						<Html><Title> Complet list of 2vhv hssp file Complet list of	cnptia.embrapa.br	0	0		
694	chrI	14312680	14312705	3500030022	25		14312680	14312705	8421504	1	25	0	c	350003002200000224	4-29						<Html><Title> Complet list of 1xi6 hssp file Complet list of	cnptia.embrapa.br	0	0		
694	chrI	14312682	14312707	3500412569	25		14312682	14312707	8421504	1	25	0	c	350041256900000790,350041256900001109	15-39,12-35						HWI-ST314_0080:1:1:18049:3655#0 73 gi|110640213|ref|NC_008253.1| 742514 37 101M = 742514 0 GCGAAGGCG	.toulouse.inra.fr	0	0		
694	chrI	14312682	14312707	3500338097	25		14312682	14312707	8421504	1	25	0	c	350033809700006466,350033809700000118,350033809700005808,350033809700003936	0-24,0-25,12-34,19-41						 Galaxy | Dataset | FASTQ Groomer on data 1	popgenie.org:8080	0	0		
694	chrI	14312682	14312707	3500279177	25		14312682	14312707	8421504	1	25	0	c	350027917700000771,350027917700001412,350027917700003411	1-26,0-23,0-22						NG-5226_9I1_4_1_3244_7526 99 gi|49256807|emb|Y08501.2| 61018 29 83M = 61177 203 AATTATATACCTGCTAATCC	.toulouse.inra.fr	0	0		
694	chrI	14312682	14312707	3500129293	25		14312682	14312707	8421504	1	25	0	c	350012929300000384,350012929300000233	8-32,1-26						<Html><Title> Complet list of 2wta hssp file Complet list of	cnptia.embrapa.br	0	0		
694	chrI	14312682	14312706	3500461888	24		14312682	14312706	8421504	1	24	0	c	350046188800000121	0-24						 Galaxy | Dataset | FASTQ to Tabular	popgenie.org:8080	0	0		
694	chrI	14312682	14312706	3500348158	24		14312682	14312706	8421504	1	24	0	c	350034815800000162	9-33						<Html><Title> Complet list of 1r9d hssp file Complet list of	cnptia.embrapa.br	0	0		
694	chrI	14312774	14312807	3500452880	27		14312774	14312807	8421504	3	9,13,5	0,14,28	c	350045288000000125	0-28						Polymorphisms in the transcription factor binding sites of host genes influences evolutionary susceptibility to falciparum malaria	demicjournals.org	0	0		
694	chrI	14322460	14328820	3500307147	1332		14322460	14328820	8421504	9	60,122,122,35,160,71,264,289,209	0,108,1090,1997,2035,2830,4556,4879,6151	p	350030714700015001,350030714700015004,350030714700015006,350030714700015008,350030714700015010,350030714700015015,350030714700015017,350030714700015013	0-192,0-207,0-210,0-204,0-207,0-210,0-57,0-66						A Field Guide to GenBank.ppt	www.docstoc.com	0	0		
694	chrI	14391099	14395385	3500344391	93		14391099	14395385	8421504	4	22,30,22,19	0,1022,4066,4267	c,g	350034439100000026,350034439100000029,350034439100000029,350034439100000024,350034439100000024,350034439100000023,350034439100000023,350034439100000020,350034439100000020,350034439100000019,350034439100000019	0-22,0-23,0-23,0-24,0-24,0-24,0-24,0-22,0-22,0-19,0-19						eat-2 and eat-18 Are Required for Nicotinic Neurotransmission in the Caenorhabditis elegans	mrc-lmb.cam.ac.uk	0	0		
694	chrI	14395437	14395462	3500159205	25		14395437	14395462	8421504	1	25	0	c,g	350015920500000005,350015920500000005	0-25,0-25		18519804	10.1096/fj.08-110502	0892-6638	The FASEB Journal	Levamisole resistance resolved at the single-channel level in Caenorhabditis elegans	Qian	2008	6		
695	chrI	14437030	14451420	3500283193	79		14437030	14451420	8421504	4	20,21,19,19	0,8292,11857,14371	c,g	350028319300000005,350028319300000005,350028319300000009,350028319300000009,350028319300000011,350028319300000010,350028319300000010	0-20,0-20,0-21,0-21,0-19,11-30,11-30		17251264	10.1242/dev.02790	0950-1991	Development	The P-type ATPase CATP-1 is a novel regulator of C. elegans developmental timing that acts independently of its predicted pump function	Ruaud	2007	7		
695	chrI	14461939	14461968	3500229537	26		14461939	14461968	8421504	2	12,14	0,15	g	350022953700000099	11-44						Method and means to modulate programmed cell death in eukaryotic cells - Patent application	www.faqs.org	0	0		
695	chrI	14461939	14461968	3500218028	26		14461939	14461968	8421504	2	12,14	0,15	g	350021802800000192	11-44					Patent	Methods and means to modulate programmed cell death in eukaryotic cells (Patent CN:1289680)	E*Ba Bi Chu Ke 	2006	0		
695	chrI	14494900	14494925	3500353224	23		14494900	14494925	8421504	2	18,5	0,20	c	350035322400000056	11-34						The Schizosaccharomyces pombe Mediator.	www.bi.ku.dk	0	0		
695	chrI	14508797	14537954	3500438304	42		14508797	14537954	8421504	3	14,6,22	0,17,29135	c,g	350043830400000111,350043830400000028	0-21,0-22						<Html><Title> Complet list of 2b45 hssp file Complet list of	cnptia.embrapa.br	0	0		
695	chrI	14512650	14523712	3500115610	142		14512650	14523712	8421504	5	24,24,46,23,25	0,5855,6031,10973,11037	c,g	350011561000000010,350011561000000010,350011561000000006,350011561000000006,350011561000000009,350011561000000009,350011561000000002,350011561000000001,350011561000000000	14-38,14-38,24-48,24-48,13-35,13-35,24-51,0-23,0-25						Method of screening for agents inhibiting chloride intracellular channels	Hobert	2003	0		
86	chrI	14537931	14588624	3500426058	44		14537931	14588624	8421504	3	23,1,20	0,1249,50673	c	350042605800000164,350042605800000202,350042605800000024	0-22,13-37,16-36						<Html><Title> Complet list of 2v3z hssp file Complet list of	cnptia.embrapa.br	0	0		
86	chrI	14537931	14588624	3500321117	45		14537931	14588624	8421504	3	23,2,20	0,1249,50673	c	350032111700000061,350032111700000328,350032111700000095,350032111700000097	12-36,1-24,6-26,8-28						<Html><Title> Complet list of 1pa1 hssp file Complet list of	cnptia.embrapa.br	0	0		
86	chrI	14537931	14588624	3500007863	44		14537931	14588624	8421504	3	23,1,20	0,1249,50673	c	350000786300000046,350000786300000106,350000786300000080	0-24,1-24,12-32						<Html><Title> Complet list of 3doo hssp file Complet list of	cnptia.embrapa.br	0	0		
86	chrI	14537931	14588602	3500301737	43		14537931	14588602	8421504	4	23,1,12,7	0,1249,50650,50664	c	350030173700000182,350030173700000146,350030173700000451	23-42,0-23,1-20						<Html><Title> Complet list of 3ihg hssp file Complet list of	cnptia.embrapa.br	0	0		
86	chrI	14537931	14585489	3500319585	43		14537931	14585489	8421504	3	23,5,15	0,47537,47543	c	350031958500000307,350031958500000329	12-35,0-22						<Html><Title> Complet list of 3ckx hssp file Complet list of	cnptia.embrapa.br	0	0		
86	chrI	14537931	14585443	3500412506	46		14537931	14585443	8421504	3	23,1,22	0,1249,47490	c	350041250600000376,350041250600000174,350041250600000063,350041250600000337	0-24,0-23,4-27,14-36						<Html><Title> Complet list of 1cyf hssp file Complet list of	cnptia.embrapa.br	0	0		
695	chrI	14537931	14539182	3500406671	25		14537931	14539182	8421504	2	23,2	0,1249	c	350040667100000753,350040667100000414,350040667100000228	0-23,0-23,1-24						<Html><Title> Complet list of 3eew hssp file Complet list of	cnptia.embrapa.br	0	0		
695	chrI	14537931	14539182	3500245494	25		14537931	14539182	8421504	2	23,2	0,1249	c	350024549400000167,350024549400000075	11-32,0-24						<Html><Title> Complet list of 2x2w hssp file Complet list of	cnptia.embrapa.br	0	0		
695	chrI	14537931	14539181	3500387629	24		14537931	14539181	8421504	2	23,1	0,1249	c	350038762900002734	3-27						@DGFC08P1:101:C0836ACXX:1:1101:4848:115207:1/2 ATCCATGTCCCTACAAAGGACATGAACTCATCATTTTTTATGGCTGCATAGT	markovitzlab.com	0	0		
695	chrI	14537931	14539181	3500354008	24		14537931	14539181	8421504	2	23,1	0,1249	c	350035400800000279,350035400800000235,350035400800000219	0-24,10-33,17-40						<Html><Title> Complet list of 3mun hssp file Complet list of	cnptia.embrapa.br	0	0		
695	chrI	14537931	14539181	3500325166	24		14537931	14539181	8421504	2	23,1	0,1249	c	350032516600000181,350032516600000066,350032516600000129	23-47,1-23,0-23						<Html><Title> Complet list of 4ccx hssp file Complet list of	cnptia.embrapa.br	0	0		
695	chrI	14537931	14539181	3500322237	24		14537931	14539181	8421504	2	23,1	0,1249	c	350032223700000116,350032223700000308,350032223700000147	11-35,12-36,18-41						<Html><Title> Complet list of 1rz1 hssp file Complet list of	cnptia.embrapa.br	0	0		
695	chrI	14537931	14539181	3500311218	24		14537931	14539181	8421504	2	23,1	0,1249	c	350031121800000183	7-31						<Html><Title> Complet list of 1lpb hssp file Complet list of	cnptia.embrapa.br	0	0		
695	chrI	14537931	14539181	3500264407	24		14537931	14539181	8421504	2	23,1	0,1249	c	350026440700000195,350026440700000377,350026440700000031,350026440700000365	11-35,7-30,2-25,0-23						<Html><Title> Complet list of 3qic hssp file Complet list of	cnptia.embrapa.br	0	0		
695	chrI	14537931	14539181	3500185929	24		14537931	14539181	8421504	2	23,1	0,1249	c	350018592900000069,350018592900000106	0-23,0-23						HSSP HOMOLOGY DERIVED SECONDARY STRUCTURE OF PROTEINS , VERSION 1.1 2001 PDBID 1bf2 DATE 	tp.cbi.pku.edu.cn	0	0		
695	chrI	14537931	14539181	3500169524	24		14537931	14539181	8421504	2	23,1	0,1249	c	350016952400000353,350016952400000061,350016952400000119	12-36,1-23,0-23						<Html><Title> Complet list of 6ccp hssp file Complet list of	cnptia.embrapa.br	0	0		
695	chrI	14537931	14539181	3500138125	24		14537931	14539181	8421504	2	23,1	0,1249	c	350013812500000042,350013812500000118,350013812500000115	0-24,0-23,0-23						<Html><Title> Complet list of 1kxn hssp file Complet list of	cnptia.embrapa.br	0	0		
695	chrI	14537931	14539181	3500135285	24		14537931	14539181	8421504	2	23,1	0,1249	c	350013528500000007,350013528500000058,350013528500000063,350013528500000062,350013528500000057	11-34,0-21,16-39,9-29,1-22						<Html><Title> Complet list of 1t4j hssp file Complet list of	cnptia.embrapa.br	0	0		
695	chrI	14537931	14539181	3500126508	24		14537931	14539181	8421504	2	23,1	0,1249	c	350012650800000351,350012650800000127,350012650800000065	11-35,0-23,1-24						<Html><Title> Complet list of 3ccx hssp file Complet list of	cnptia.embrapa.br	0	0		
695	chrI	14537931	14539181	3500125682	24		14537931	14539181	8421504	2	23,1	0,1249	c	350012568200000577,350012568200000563	0-24,24-47						<Html><Title> Complet list of 1lqa hssp file Complet list of	cnptia.embrapa.br	0	0		
695	chrI	14537931	14539181	3500105251	24		14537931	14539181	8421504	2	23,1	0,1249	c	350010525100000341	0-24						<Html><Title> Complet list of 2rc1 hssp file Complet list of	cnptia.embrapa.br	0	0		
695	chrI	14537931	14539181	3500090659	24		14537931	14539181	8421504	2	23,1	0,1249	c	350009065900000289,350009065900000136,350009065900000306,350009065900000330	0-24,15-38,0-23,22-45						<Html><Title> Complet list of 1l1f hssp file Complet list of	cnptia.embrapa.br	0	0		
695	chrI	14537931	14539181	3500089568	24		14537931	14539181	8421504	2	23,1	0,1249	c	350008956800000086	5-29						<Html><Title> Complet list of 2vhv hssp file Complet list of	cnptia.embrapa.br	0	0		
695	chrI	14537931	14539181	3500031510	24		14537931	14539181	8421504	2	23,1	0,1249	c	350003151000000303,350003151000000345	0-21,25-48						<Html><Title> Complet list of 3iha hssp file Complet list of	cnptia.embrapa.br	0	0		
695	chrI	14537931	14539181	3500030276	24		14537931	14539181	8421504	2	23,1	0,1249	c	350003027600000223,350003027600000065,350003027600000137	0-24,1-24,0-23						<Html><Title> Complet list of 7ccp hssp file Complet list of	cnptia.embrapa.br	0	0		
695	chrI	14537931	14539181	3500030022	24		14537931	14539181	8421504	2	23,1	0,1249	c	350003002200000234,350003002200000002	12-36,16-39						<Html><Title> Complet list of 1xi6 hssp file Complet list of	cnptia.embrapa.br	0	0		
695	chrI	14537931	14539181	3500029254	24		14537931	14539181	8421504	2	23,1	0,1249	c	350002925400000232	0-24						<Html><Title> Complet list of 1aow hssp file Complet list of	cnptia.embrapa.br	0	0		
695	chrI	14537931	14539181	3500028321	24		14537931	14539181	8421504	2	23,1	0,1249	c	350002832100000262,350002832100000394	11-34,0-23						<Html><Title> Complet list of 3o4s hssp file Complet list of	cnptia.embrapa.br	0	0		
695	chrI	14537931	14539181	3500017711	24		14537931	14539181	8421504	2	23,1	0,1249	c	350001771100000013,350001771100000051,350001771100000144	17-41,10-33,8-31						<Html><Title> Complet list of 1c8u hssp file Complet list of	cnptia.embrapa.br	0	0		
86	chrI	14537932	14588624	3500082768	44		14537932	14588624	8421504	3	22,2,20	0,1248,50672	c	350008276800000104,350008276800000364,350008276800000120	0-23,1-24,21-41						<Html><Title> Complet list of 3c5e hssp file Complet list of	cnptia.embrapa.br	0	0		
86	chrI	14537932	14588619	3500193112	51		14537932	14588619	8421504	5	22,1,10,5,13	0,1248,50652,50665,50674	c	350019311200000062,350019311200000203,350019311200000096	0-23,0-23,0-28						<Html><Title> Complet list of 1z16 hssp file Complet list of	cnptia.embrapa.br	0	0		
86	chrI	14537932	14553406	3500115005	43		14537932	14553406	8421504	3	22,1,20	0,1248,15454	c,g	350011500500000259,350011500500000166,350011500500000318	23-46,13-36,20-40						<Html><Title> Complet list of 2x4z hssp file Complet list of	cnptia.embrapa.br	0	0		
695	chrI	14537932	14539184	3500158435	26		14537932	14539184	8421504	2	22,4	0,1248	c	350015843500000355,350015843500000051	0-23,0-26						<Html><Title> Complet list of 1ccg hssp file Complet list of	cnptia.embrapa.br	0	0		
695	chrI	14537932	14539182	3500014387	24		14537932	14539182	8421504	2	22,2	0,1248	c	350001438700000014,350001438700000451	8-31,1-24						<Html><Title> Complet list of 1u5h hssp file Complet list of	cnptia.embrapa.br	0	0		
695	chrI	14537932	14539181	3500467483	23		14537932	14539181	8421504	2	22,1	0,1248	c	350046748300000219	5-28						<Html><Title> Complet list of 2dhb hssp file Complet list of	cnptia.embrapa.br	0	0		
695	chrI	14537932	14539181	3500461888	23		14537932	14539181	8421504	2	22,1	0,1248	c	350046188800001014	0-23						 Galaxy | Dataset | FASTQ to Tabular	popgenie.org:8080	0	0		
695	chrI	14537932	14539181	3500412569	23		14537932	14539181	8421504	2	22,1	0,1248	c	350041256900001016	0-23						HWI-ST314_0080:1:1:18049:3655#0 73 gi|110640213|ref|NC_008253.1| 742514 37 101M = 742514 0 GCGAAGGCG	.toulouse.inra.fr	0	0		
695	chrI	14537932	14539181	3500395465	23		14537932	14539181	8421504	2	22,1	0,1248	c	350039546500000050	0-23						<Html><Title> Complet list of 1dzd hssp file Complet list of	cnptia.embrapa.br	0	0		
695	chrI	14537932	14539181	3500368889	23		14537932	14539181	8421504	2	22,1	0,1248	c	350036888900000281,350036888900000161	25-48,0-23						<Html><Title> Complet list of 3gsb hssp file Complet list of	cnptia.embrapa.br	0	0		
695	chrI	14537932	14539181	3500348158	23		14537932	14539181	8421504	2	22,1	0,1248	c	350034815800000079	22-45						<Html><Title> Complet list of 1r9d hssp file Complet list of	cnptia.embrapa.br	0	0		
695	chrI	14537932	14539181	3500345436	23		14537932	14539181	8421504	2	22,1	0,1248	c	350034543600000263,350034543600000257	0-23,0-23						<Html><Title> Complet list of 1gsz hssp file Complet list of	cnptia.embrapa.br	0	0		
695	chrI	14537932	14539181	3500339664	23		14537932	14539181	8421504	2	22,1	0,1248	c	350033966400000064	0-23						<Html><Title> Complet list of 1bc0 hssp file Complet list of	cnptia.embrapa.br	0	0		
695	chrI	14537932	14539181	3500331014	23		14537932	14539181	8421504	2	22,1	0,1248	c	350033101400000375,350033101400000360,350033101400000378,350033101400000368	0-23,0-23,0-23,7-30						<Html><Title> Complet list of 1wsr hssp file Complet list of	cnptia.embrapa.br	0	0		
695	chrI	14537932	14539181	3500327405	23		14537932	14539181	8421504	2	22,1	0,1248	c	350032740500000283	0-23						<Html><Title> Complet list of 1o8q hssp file Complet list of	cnptia.embrapa.br	0	0		
695	chrI	14537932	14539181	3500304626	23		14537932	14539181	8421504	2	22,1	0,1248	c	350030462600000114	0-23						<Html><Title> Complet list of 1t8s hssp file Complet list of	cnptia.embrapa.br	0	0		
695	chrI	14537932	14539181	3500226963	23		14537932	14539181	8421504	2	22,1	0,1248	c	350022696300000193	22-45						<Html><Title> Complet list of 1juk hssp file Complet list of	cnptia.embrapa.br	0	0		
695	chrI	14537932	14539181	3500223945	23		14537932	14539181	8421504	2	22,1	0,1248	c	350022394500000067,350022394500000007	20-43,26-49						<Html><Title> Complet list of 2ou2 hssp file Complet list of	cnptia.embrapa.br	0	0		
695	chrI	14537932	14539181	3500186865	23		14537932	14539181	8421504	2	22,1	0,1248	c	350018686500000050	18-41						<Html><Title> Complet list of 3gs6 hssp file Complet list of	cnptia.embrapa.br	0	0		
695	chrI	14537932	14539181	3500129293	23		14537932	14539181	8421504	2	22,1	0,1248	c	350012929300000260,350012929300000000,350012929300000088,350012929300000043,350012929300000067	25-48,24-47,18-41,0-23,4-27						<Html><Title> Complet list of 2wta hssp file Complet list of	cnptia.embrapa.br	0	0		
695	chrI	14537932	14539181	3500128449	23		14537932	14539181	8421504	2	22,1	0,1248	c	350012844900000096	23-46						<Html><Title> Complet list of 1hak hssp file Complet list of	cnptia.embrapa.br	0	0		
695	chrI	14537932	14539181	3500106028	23		14537932	14539181	8421504	2	22,1	0,1248	c	350010602800000264,350010602800000273	0-22,0-23						<Html><Title> Complet list of 3sqc hssp file Complet list of	cnptia.embrapa.br	0	0		
695	chrI	14537932	14539181	3500078842	23		14537932	14539181	8421504	2	22,1	0,1248	c	350007884200000123	0-23						<Html><Title> Complet list of 3exb hssp file Complet list of	cnptia.embrapa.br	0	0		
695	chrI	14537932	14539181	3500074491	23		14537932	14539181	8421504	2	22,1	0,1248	c	350007449100000059	0-23						<Html><Title> Complet list of 1cmp hssp file Complet list of	cnptia.embrapa.br	0	0		
695	chrI	14537932	14539181	3500063559	23		14537932	14539181	8421504	2	22,1	0,1248	c	350006355900000011,350006355900000060,350006355900000168	13-36,21-44,0-21						<Html><Title> Complet list of 3baj hssp file Complet list of	cnptia.embrapa.br	0	0		
695	chrI	14537932	14539181	3500036175	23		14537932	14539181	8421504	2	22,1	0,1248	c	350003617500000041	5-28						<Html><Title> Complet list of 1jkn hssp file Complet list of	cnptia.embrapa.br	0	0		
695	chrI	14537933	14539182	3500084045	23		14537933	14539182	8421504	2	21,2	0,1247	c	350008404500000182	1-24						<Html><Title> Complet list of 1xhy hssp file Complet list of	cnptia.embrapa.br	0	0		
695	chrI	14540799	14540829	3500120381	26		14540799	14540829	8421504	2	11,15	0,15	g	350012038100000233	0-26						<Html><Title> Complet list of 1mpf hssp file Complet list of	cnptia.embrapa.br	0	0		
696	chrI	14552470	14571697	3500144391	47		14552470	14571697	8421504	2	24,23	0,19204	c	350014439100001025,350014439100000925	4-34,13-36						SPIDER SILK DRAGLINE POLYNUCLEOTIDES, POLYPEPTIDES AND METHODS OF USE THEREOF - Patent application	www.faqs.org	0	0		
696	chrI	14555098	14555131	3500193602	28		14555098	14555131	8421504	3	13,7,8	0,16,25	g	350019360200000002	0-28						(* ::Package:: *) (************************************************************************) (* 	www.cs.ukzn.ac.za	0	0		
696	chrI	14578141	14578168	3500246469	23		14578141	14578168	8421504	2	12,11	0,16	c	350024646900000001,350024646900000000,350024646900000003,350024646900000002,350024646900000562,350024646900000563,350024646900000564,350024646900000565	20-43,20-43,20-43,20-43,20-43,20-43,20-43,20-43						Anchor-Assisted Fragment Selection and Directed Assembly - Patent application	www.faqs.org	0	0		
696	chrI	14578141	14578168	3500212212	23		14578141	14578168	8421504	2	12,11	0,16	c	350021221200000000,350021221200000001,350021221200000002,350021221200000003	20-43,20-43,20-43,20-43						Anchor-Assisted Fragment Selection and Directed Assembly	Stern	2006	0		
696	chrI	14585459	14585484	3500394783	23		14585459	14585484	8421504	2	5,18	0,7	c	350039478300000276	8-31						<Html><Title> Complet list of 1dj9 hssp file Complet list of	cnptia.embrapa.br	0	0		
696	chrI	14588584	14588624	3500242967	34		14588584	14588624	8421504	3	9,5,20	0,13,20	c	350024296700000390	0-34						<Html><Title> Complet list of 1j2p hssp file Complet list of	cnptia.embrapa.br	0	0		
696	chrI	14588587	14588621	3500181876	28		14588587	14588621	8421504	3	6,6,16	0,10,18	c	350018187600000000	0-28							www.facebook.com	0	0		
696	chrI	14588597	14588624	3500263717	25		14588597	14588624	8421504	2	5,20	0,7	c	350026371700000242	5-30						<Html><Title> Complet list of 3lsc hssp file Complet list of	cnptia.embrapa.br	0	0		
696	chrI	14588604	14588630	3500452606	25		14588604	14588630	8421504	2	20,5	0,21	c	350045260600000097,350045260600000090	1-25,11-31						BsuisMicroarraySpreadsheet.xls	www.docstoc.com	0	0		
696	chrI	14588604	14588630	3500007155	24		14588604	14588630	8421504	2	19,5	0,21	c	350000715500000097,350000715500000091	1-25,17-37						Sheet1	www.docstoc.com	0	0		
696	chrI	14614052	14614075	3500178220	23		14614052	14614075	8421504	1	23	0	g	350017822000001641	21-44						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
696	chrI	14621561	14631011	3500101437	67		14621561	14631011	8421504	3	22,21,24	0,2461,9426	c,g	350010143700000002,350010143700000002,350010143700000001,350010143700000001,350010143700000000	10-32,10-32,10-31,10-31,7-31			10.1083/jcb.200110013		The Journal of Cell Biology	Tropomyosin inhibits ADF/cofilin-dependent actin filament dynamics	Shoichiro	2002	0		
697	chrI	14703042	14705974	3500144391	40		14703042	14705974	8421504	4	7,12,10,11	0,10,2908,2921	c	350014439100001103,350014439100000653	4-23,5-26						SPIDER SILK DRAGLINE POLYNUCLEOTIDES, POLYPEPTIDES AND METHODS OF USE THEREOF - Patent application	www.faqs.org	0	0		
697	chrI	14717504	14717576	3500401199	23		14717504	14717576	8421504	3	3,11,9	0,50,63	c	350040119900000138	0-23						<Html><Title> Complet list of 1i1n hssp file Complet list of	cnptia.embrapa.br	0	0		
697	chrI	14720119	14720147	3500121849	24		14720119	14720147	8421504	2	8,16	0,12	c	350012184900000010	10-34						articles Bag1–Hsp70 mediates a physiological stress signalling pathway that regulates Raf-1/ERK and cell growth	.northwestern.edu	0	0		
697	chrI	14768650	14768676	3500384138	23		14768650	14768676	8421504	2	17,6	0,20	g	350038413800000048	20-43						Modified FRT Recombination Site Libraries and Methods of Use - Patent application	www.faqs.org	0	0		
697	chrI	14768650	14768676	3500062108	23		14768650	14768676	8421504	2	17,6	0,20	g	350006210800000048	20-43						Modified Frt Recombination Site Libraries And Methods Of Use 	.freshpatents.com	0	0		
697	chrI	14771031	14772464	3500204876	252		14771031	14772464	8421504	3	156,93,3	0,183,1430	p	350020487600015097,350020487600015099	609-765,480-576						Proteina MnmE	es.scribd.com	0	0		
697	chrI	14778098	14778176	3500453732	78		14778098	14778176	8421504	1	78	0	p	350045373200015010	0-78						intersex, a gene required for female sexual development in Drosophila, is expressed in both sexes and functions together with doublesexto regulate terminal differentiation	ev.biologists.org	0	0		
698	chrI	14838379	14856977	3500291156	42		14838379	14856977	8421504	4	13,10,6,13	0,14,18575,18585	g	350029115600000922,350029115600000230	21-44,21-40						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
698	chrI	14838379	14856977	3500274310	42		14838379	14856977	8421504	4	13,10,6,13	0,14,18575,18585	g	350027431000000189,350027431000000349	0-23,21-40						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
698	chrI	14847339	14847363	3500291238	23		14847339	14847363	8421504	2	7,16	0,8	c,g	350029123800000032,350029123800000032,350029123800000035,350029123800000035	0-35,0-35,0-36,0-36						NimbleGen SeqCap EZChoice Library LR	.roche-biochem.jp	0	0		
698	chrI	14855470	14918249	3500325483	879		14855470	14918249	8421504	5	760,23,51,11,34	0,62529,62657,62724,62745	g	350032548300000007,350032548300000009	69-836,319-2625						Transgenic C. elegans as a model organism for investigations on Alzheimer's disease	Peraus	1999	0		
698	chrI	14855470	14918249	3500325483	829		14855470	14918249	8421504	4	760,24,11,34	0,62684,62724,62745	g	350032548300000017,350032548300000018	69-836,319-2624						Transgenic C. elegans as a model organism for investigations on Alzheimer's disease	Peraus	1999	0		
698	chrI	14855470	14856218	3500073651	744		14855470	14856218	8421504	2	728,16	0,732	g	350007365100000021	1268-2071						用双链rna抑制鉴定基因功能	G*Pu Lai Ting Ke 	2007	0		
698	chrI	14855470	14856218	3500064404	744		14855470	14856218	8421504	2	728,16	0,732	g	350006440400000021	1266-2068					Patent	用双链rna抑制鉴定基因功能 (Patent CN:1198938)	G*Pu Lai Ting Ke 	2005	0		
698	chrI	14855518	14856148	3500452562	630		14855518	14856148	8421504	1	630	0	c,g	350045256200000031,350045256200000030,350045256200000030,350045256200000029,350045256200000028,350045256200000027,350045256200000026,350045256200000025,350045256200000024,350045256200000023	0-70,0-70,0-70,0-70,0-70,0-70,0-70,0-70,0-70,0-70						<!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.0 Transitional//EN"> <HTML><HEAD><TITLE>aao!a$?(c)ae(c)ae31/2</	www.tiandz.com	0	0		
698	chrI	14855518	14856148	3500427561	630		14855518	14856148	8421504	1	630	0	c,g	350042756100000031,350042756100000030,350042756100000030,350042756100000029,350042756100000028,350042756100000027,350042756100000026,350042756100000025,350042756100000024,350042756100000023	0-70,0-70,0-70,0-70,0-70,0-70,0-70,0-70,0-70,0-70						<!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.0 Transitional//EN"> <HTML><HEAD><TITLE>aao!a$?(c)ae(c)ae31/2</	www.tiandz.com	0	0		
698	chrI	14855570	14855634	3500026271	62		14855570	14855634	8421504	2	31,31	0,33	c,g	350002627100000000,350002627100000000,350002627100000001	0-31,0-31,0-31		17526726	10.1128/MCB.02070-06	0270-7306	Molecular and Cellular Biology	Specificity and Complexity of the Caenorhabditis elegans Innate Immune Response	Alper	2007	6		
698	chrI	14855575	14855634	3500150707	45		14855575	14855634	8421504	2	21,24	0,35	c,g	350015070700000003,350015070700000003,350015070700000005	0-21,0-21,0-24			10.1101/gad.332305		Genes & Development	Chromatin and RNAi factors protect the C. elegans germline against repetitive sequences	Valerie	2005	0		
698	chrI	14855581	14855604	3500431405	23		14855581	14855604	8421504	1	23	0	c,g	350043140500000005,350043140500000005	0-23,0-23						The GAR-3 Muscarinic Receptor Cooperates With Calcium Signals to Regulate Muscle Contraction in the Caenorhabditis elegans Pharynx	egans.som.vcu.edu	0	0		
698	chrI	14855581	14855604	3500344391	23		14855581	14855604	8421504	1	23	0	c,g	350034439100000031,350034439100000031	0-23,0-23						eat-2 and eat-18 Are Required for Nicotinic Neurotransmission in the Caenorhabditis elegans	mrc-lmb.cam.ac.uk	0	0		
698	chrI	14855581	14855604	3500334296	23		14855581	14855604	8421504	1	23	0	c,g	350033429600000005,350033429600000005	0-23,0-23						The GAR-3 Muscarinic Receptor Cooperates With Calcium Signals to Regulate Muscle Contraction in the Caenorhabditis elegans Pharynx	www.genetics.org	0	0		
698	chrI	14855681	14856202	3500396785	114		14855681	14856202	8421504	8	28,8,7,12,12,15,9,23	0,29,40,333,346,359,376,498	c,g	350039678500000886,350039678500000878,350039678500000874,350039678500000874	0-45,1-50,0-23,0-23						Vertebrate homologues of unc-53 protein of c. elegans	Bogaert	1998	0		
698	chrI	14856175	14856198	3500139809	23		14856175	14856198	8421504	1	23	0	c,g	350013980900000002,350013980900000002	0-23,0-23						Reporter gene fusions	Boulin	2006	0		
698	chrI	14856329	14856472	3500181690	47		14856329	14856472	8421504	2	22,25	0,118	c,g	350018169000000015,350018169000000015,350018169000000014,350018169000000014	0-22,0-22,0-25,0-25						TaiLieu.VN: Báo cáo y học: "Identification of ciliated sensory neuron-expressed genes in Caenorhabditis elegans using targeted pull-down of poly(A) tails" 	tailieu.vn/doc/ba	0	0		
698	chrI	14856431	14863439	3500200732	1251		14856431	14863439	8421504	9	225,6,63,93,291,300,90,120,63	0,273,285,703,1012,1603,6116,6263,6945	p	350020073200015056,350020073200015055,350020073200015059,350020073200015051,350020073200015049,350020073200015034	0-231,0-63,0-93,0-291,0-300,0-291						Functional domains of the Drosophila melanogaster muscle myosin heavy-chain gene are encoded by alternatively spliced exons. - ResearchGate	.researchgate.net	0	0		
698	chrI	14857356	14857479	3500136884	123		14857356	14857479	8421504	1	123	0	p	350013688400015001	0-123						 <HTML> <HEAD> <meta name="GENERATOR" content="Microsoft Internet Assistant for PowerPoint 97	ww.toxicology.org	0	0		
698	chrI	14857356	14857479	3500033053	123		14857356	14857479	8421504	1	123	0	p	350003305300015001	0-123						Types of Algorithms 	ww.toxicology.org	0	0		
698	chrI	14858813	14863161	3500359647	43		14858813	14863161	8421504	2	22,21	0,4327	c,g	350035964700000007,350035964700000007,350035964700000008	27-49,27-49,28-49						Homologous gene targeting in Caenorhabditis elegans by biolistic transformation	www.umcg.nl	0	0		
698	chrI	14861680	14862754	3500324718	40		14861680	14862754	8421504	2	20,20	0,1054	c,g	350032471800000003,350032471800000003,350032471800000004,350032471800000004	0-20,0-20,0-20,0-20		23682709	10.1186/1471-213X-13-21	1471-213X	BMC Developmental Biology	The C. elegans gene pan-1 encodes novel transmembrane and cytoplasmic leucine-rich repeat proteins and promotes molting and the larva to adult transition	Gissendanner	2013	3		
698	chrI	14861680	14862754	3500187660	40		14861680	14862754	8421504	2	20,20	0,1054	c,g	350018766000000003,350018766000000003,350018766000000004,350018766000000004	0-20,0-20,0-20,0-20						The C. elegans gene pan-1 encodes novel transmembrane and cytoplasmic leucine-rich repeat proteins and promotes molting and the larva to adult transition	biomedcentral.com	0	0		
698	chrI	14861756	14861779	3500082960	23		14861756	14861779	8421504	1	23	0	c,g	350008296000000000,350008296000000000	5-28,5-28						Production of antisense RNA leads to effective and specific inhibitio of n gene expressio inn C. elegans muscle	ev.biologists.org	0	0		
698	chrI	14863499	14863668	3500460501	43		14863499	14863668	8421504	2	23,20	0,149	g	350046050100000006,350046050100000020	18-41,0-20						Mechanismus der Neuroserpin-Demenz an einem Caenorhabditis elegans-Modell (Maupas, 1900) Dougherty, 1953	ub.uni-hamburg.de	0	0		
698	chrI	14863558	14863723	3500177349	165		14863558	14863723	8421504	1	165	0	g	350017734900000001	55-220						载体目录_北京天恩泽	www.tiandz.com	0	0		
698	chrI	14871355	14876411	3500005288	163		14871355	14876411	8421504	8	20,18,20,20,22,23,21,19	0,527,615,687,744,785,3984,5037	c,g	350000528800000000,350000528800000006,350000528800000010,350000528800000005,350000528800000005,350000528800000001,350000528800000001	0-20,0-80,0-23,0-21,0-21,0-19,0-19		14999070	10.1523/JNEUROSCI.5462-03.2004	0270-6474	The Journal of Neuroscience	A Conserved Postsynaptic Transmembrane Protein Affecting Neuromuscular Signaling in Caenorhabditis elegans	Loria	2004	7		
698	chrI	14872123	14872153	3500184474	30		14872123	14872153	8421504	1	30	0	g	350018447400000007	0-30		20484575	10.1091/mbc.E09-12-1010	1059-1524	Molecular Biology of the Cell	The Arf-like GTPase Arl8 Mediates Delivery of Endocytosed Macromolecules to Lysosomes in Caenorhabditis elegans	Nakae	2010	5		
698	chrI	14872123	14872153	3500145167	30		14872123	14872153	8421504	1	30	0	g	350014516700000007	0-30						The Arf-like GTPase Arl8 Mediates Delivery of Endocytosed Macromolecules to Lysosomes in Caenorhabditis elegans	w.molbiolcell.org	0	0		
698	chrI	14882215	14883628	3500144391	38		14882215	14883628	8421504	4	12,7,6,13	0,14,1392,1400	c,g	350014439100000785,350014439100000309,350014439100001017	15-34,12-31,26-45						SPIDER SILK DRAGLINE POLYNUCLEOTIDES, POLYPEPTIDES AND METHODS OF USE THEREOF - Patent application	www.faqs.org	0	0		
698	chrI	14892499	14896604	3500319585	39		14892499	14896604	8421504	4	5,14,6,14	0,8,4080,4091	c	350031958500000141,350031958500000252	0-19,8-28						<Html><Title> Complet list of 3ckx hssp file Complet list of	cnptia.embrapa.br	0	0		
698	chrI	14933892	14940891	3500334751	72		14933892	14940891	8421504	2	70,2	0,6997	p	350033475100015011	0-72						Catalytic subunits of Aplysia neuronal cAMP-dependent protein kinase with two different N termini. - ResearchGate	.researchgate.net	0	0		
699	chrI	14950271	14951522	3500182038	41		14950271	14951522	8421504	2	21,20	0,1231	c,g	350018203800000002,350018203800000003,350018203800000003	0-21,0-20,0-20		9275202		0027-8424	Proceedings of the National Academy of Sciences	smg mutants affect the expression of alternatively spliced SR protein mRNAs in Caenorhabditis elegans	Morrison	1997	10		
699	chrI	14950271	14951522	3500108223	41		14950271	14951522	8421504	2	21,20	0,1231	c,g	350010822300000002,350010822300000003,350010822300000003	0-21,0-20,0-20					Proceedings of the National Academy of Sciences of the United States of America	smg mutants affect the expression of alternatively spliced SR protein mRNAs in Caenorhabditis elegans	Mike	1997	0		
699	chrI	14950352	14950803	3500276014	44		14950352	14950803	8421504	2	22,22	0,429	c,g	350027601400000009,350027601400000009,350027601400000008	0-22,0-22,0-22						Chromosome-Wide Regulation of Meiotic Crossover Formation in Caenorhabditis elegans Requires Properly Assembled Chromosome Axes	www.genetics.org	0	0		
699	chrI	14961849	14964794	3500212679	138		14961849	14964794	8421504	2	63,75	0,2870	p	350021267900015003	15-153						BMC Bioinformatics BioMed Central	biomedcentral.com	0	0		
699	chrI	14997410	14997438	3500131108	23		14997410	14997438	8421504	2	11,12	0,16	g	350013110800001101	0-24						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
699	chrI	14998187	15006313	3500323036	40		14998187	15006313	8421504	3	14,6,20	0,18,8106	c,g	350032303600000061,350032303600001253,350032303600000145	11-31,0-19,15-34						COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF A GENE FROM THE JC VIRUS - Patent application	www.faqs.org	0	0		
699	chrI	15004364	15004390	3500190843	23		15004364	15004390	8421504	2	17,6	0,20	g	350019084300001324	18-41						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
699	chrI	15014913	15016568	3500328382	873		15014913	15016568	8421504	7	189,131,137,71,100,68,177	0,365,857,1150,1227,1386,1478	p	350032838200015056,350032838200015053,350032838200015050,350032838200015047,350032838200015044,350032838200015041	0-177,0-180,0-171,0-168,0-96,0-81						Biochemische und molekularbiologische Charakterisierung von RAIP, einem neuen ER-lokalisierten proapoptotischen Protein.	b.uni-muenchen.de	0	0		
699	chrI	15016139	15016165	3500280414	23		15016139	15016165	8421504	2	8,15	0,11	c	350028041400000051	8-40						Nola Kim D’Souza BSc (Hons.)	ry.murdoch.edu.au	0	0		
699	chrI	15024780	15024808	3500307734	23		15024780	15024808	8421504	2	14,9	0,19	c	350030773400000063	17-40						Simple sequence repeat marker development and genetic mapping in quinoa (Chenopodium quinoa Willd.)	www.ias.ac.in	0	0		
699	chrI	15029620	15029651	3500227519	24		15029620	15029651	8421504	3	6,5,13	0,11,18	g	350022751900000057	16-40						<Html><Title> Complet list of 1han hssp file Complet list of	cnptia.embrapa.br	0	0		
699	chrI	15031472	15034530	3500170924	44		15031472	15034530	8421504	3	3,20,21	0,218,3037	c,g	350017092400000000,350017092400000001	0-23,0-21						F33H2.3: sEx14222 | Flickr - Photo Sharing!	www.flickr.com	0	0		
699	chrI	15040750	15040810	3500198305	60		15040750	15040810	8421504	1	60	0	p	350019830500015004	0-60						RECENT ADVANCES IN THE DOMESTICATION AND BREEDING OF Farfantepenaeus paulensis	www.was.org	0	0		
699	chrI	15061139	15069268	3500250996	1087		15061139	15069268	8421504	6	179,23,24,23,25,813	0,585,908,3042,3125,7316	g	350025099600000033,350025099600000023,350025099600000012,350025099600000014,350025099600000019,350025099600000020	24-3731,0-23,0-23,0-24,0-23,0-25						Kobe University Repository : Thesis	.lib.kobe-u.ac.jp	0	0		
699	chrI	15061879	15064259	3500458413	40		15061879	15064259	8421504	2	20,20	0,2360	g	350045841300000001,350045841300000003	0-20,0-20		22768349	10.1371/journal.pone.0040290		PLoS ONE	Nucleologenesis in the Caenorhabditis elegans Embryo	Darina	2012	0		
699	chrI	15061879	15064259	3500452061	40		15061879	15064259	8421504	2	20,20	0,2360	g	350045206100000001,350045206100000003	0-20,0-20		22768349	10.1371/journal.pone.0040290	1932-6203	PLOS ONE	PLOS ONE: Nucleologenesis in the Caenorhabditis elegans Embryo	Korcekova	2012	4		
699	chrI	15063777	15070260	3500304159	39		15063777	15070260	8421504	2	20,19	0,6464	c,g	350030415900000004,350030415900000002	0-20,0-19						Phylogenetic relationships within the phylum Nematoda as revealed by ribosomal DNA, and their biological implications	edepot.wur.nl	0	0		
699	chrI	15063777	15070260	3500200348	39		15063777	15070260	8421504	2	20,19	0,6464	c,g	350020034800000004,350020034800000002	0-20,0-19						Small subunit rDNA-based phylogeny of the Tylenchida sheds light on relationships among some high-impact plant-parasitic nematodes and the evolution of plant feeding. - ResearchGate	.researchgate.net	0	0		
699	chrI	15063783	15070869	3500351898	76		15063783	15070869	8421504	3	19,20,37	0,5489,7049	c,g	350035189800000018,350035189800000010,350035189800000017,350035189800000020	0-19,24-44,0-22,0-22						Plant Pest Diagnostics Branch	www.cdfa.ca.gov	0	0		
699	chrI	15063783	15070869	3500158326	76		15063783	15070869	8421504	3	19,20,37	0,5489,7049	c,g	350015832600000018,350015832600000010,350015832600000017,350015832600000020	0-19,24-44,0-22,0-22						Plant Pest Diagnostics Branch	www.cdfa.ca.gov	0	0		
699	chrI	15063783	15070852	3500390824	80		15063783	15070852	8421504	4	19,19,21,21	0,5523,6386,7048	c,g	350039082400000006,350039082400000008,350039082400000009,350039082400000002	0-19,0-19,0-21,0-21						Dedication for Plant Parasitic Nematodes in Subtropical and Tropical Agriculture	www.scribd.com	0	0		
699	chrI	15063783	15063822	3500376022	39		15063783	15063822	8421504	1	39	0	g	350037602200000000,350037602200000012	0-19,0-39						PCR-RFLPand sequencing analysis ofribosomal DNAof Bursaphelenchus nematodes related to pinewilt disease(l)	umentation.ird.fr	0	0		
699	chrI	15064289	15070255	3500237136	98		15064289	15070255	8421504	4	25,26,20,27	0,118,5057,5939	c,g	350023713600000001,350023713600000001,350023713600000002,350023713600000002,350023713600000011,350023713600000012	0-25,0-25,0-26,0-26,0-20,0-27		19155321	10.1261/rna.1258309		RNA	Uncoupling of lin-14 mRNA and protein repression by nutrient deprivation in Caenorhabditis elegans	Janette	2009	0		
699	chrI	15064289	15070255	3500162138	98		15064289	15070255	8421504	4	25,26,20,27	0,118,5057,5939	c,g	350016213800000001,350016213800000001,350016213800000002,350016213800000011,350016213800000012	0-25,0-25,0-26,0-20,0-27		19155321	10.1261/rna.1258309	1355-8382	RNA	Uncoupling of lin-14 mRNA and protein repression by nutrient deprivation in Caenorhabditis elegans	Holtz	2009	5		
699	chrI	15064289	15068335	3500395707	3661		15064289	15068335	8421504	3	77,74,3510	0,78,536	g	350039570700000052	0-3661						>X02729 Methanococcus vannielli. # tatctattaccctaccctggggaatggcttggcttgaaacgccgatgaaggacgtggtaa gctg	mafft.cbrc.jp	0	0		
699	chrI	15064289	15068335	3500251487	3661		15064289	15068335	8421504	3	77,74,3510	0,78,536	g	350025148700000011	0-3661						 » LSU rRNAS de eucariotas Biocomputación	bioinfo2.ugr.es	0	0		
699	chrI	15064289	15068335	3500049549	3661		15064289	15068335	8421504	3	77,74,3510	0,78,536	g	350004954900000052	0-3661						<rdf:RDF xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" xmlns:cbrc="http://togo.c	togo.cbrc.jp	0	0		
699	chrI	15064289	15064442	3500384900	41		15064289	15064442	8421504	2	21,20	0,133	c,g	350038490000000005,350038490000000005,350038490000000006	0-21,0-21,0-20		19591834	10.1016/j.ijpara.2009.06.005		International journal for parasitology	Characterization of a fatty acid and retinol binding protein orthologue from the hookworm Ancylostoma ceylanicum	Keke	2009	0		
699	chrI	15064298	15070980	3500110061	697		15064298	15070980	8421504	21	25,25,25,40,33,78,50,64,25,25,25,25,25,27,25,30,25,25,25,50,25	0,61,4993,5106,5325,5359,5468,5536,5676,5728,5904,5937,6139,6193,6258,6301,6349,6395,6493,6535,6657	c	350011006100000000,350011006100000001,350011006100000002,350011006100000004,350011006100000005,350011006100000006,350011006100000007,350011006100000008,350011006100000009,350011006100000010,350011006100000011,350011006100000012,350011006100000013,350011006100000014,350011006100000015,350011006100000016,350011006100000017,350011006100000018,350011006100000020,350011006100000021,350011006100000022,350011006100000023,350011006100000024,350011006100000026,350011006100000027,350011006100000028,350011006100000029,350011006100000030,350011006100000031,350011006100000032,350011006100000033,350011006100000034,350011006100000035,350011006100000036,350011006100000037,350011006100000038,350011006100000039	0-25,0-25,0-25,0-25,0-25,0-25,0-25,0-25,0-25,0-25,0-25,0-25,0-25,0-25,0-25,0-25,0-25,0-25,0-25,0-25,0-25,0-25,0-25,0-25,0-25,0-25,0-25,0-25,0-25,0-25,0-25,0-25,0-25,0-25,0-25,0-25,0-25						5.8S-T-14 HBII-239 GCGATGGATCGGTTGCATCGAGTAT 5.8S-G-75 U96a,U96b AATTGCAGACGCTTAGAGTGGTGAA 18S-A-2	pbase.sysu.edu.cn	0	0		
699	chrI	15064316	15064339	3500406744	23		15064316	15064339	8421504	1	23	0	c	350040674400000000	0-23						Intraspecific diversity of the Cassava Green Mite 	dare.uva.nl	0	0		
699	chrI	15064316	15064339	3500187352	23		15064316	15064339	8421504	1	23	0	c,g	350018735200000001,350018735200000001	0-23,0-23						Resistance of an invasive gastropod to an indigenous trematode parasite in Lake Malawi | Jon Todd - Academia.edu	www.academia.edu	0	0		
699	chrI	15064319	15070665	3500162322	40		15064319	15070665	8421504	2	20,20	0,6326	c	350016232200000002,350016232200000001,350016232200000012,350016232200000013	0-20,0-20,0-20,0-20						an institute of the royal netherlands academy of arts and Sciences	osporium-ecmm.com	0	0		
699	chrI	15064319	15064349	3500007819	28		15064319	15064349	8421504	2	20,8	0,22	c	350000781900000000	12-40						Phylogenetic Inferences in Antennaria (Asteraceae: Gnaphalieae: Cassiniinae) Based on Sequences from Nuclear Ribosomal DNA Internal Transcribed Spacers (ITS) | Randall J. Bayer | Douglas E. Soltis | Pamela S. Soltis | Academic Room	.academicroom.com	0	0		
699	chrI	15064321	15064371	3500300321	40		15064321	15064371	8421504	2	26,14	0,36	g	350030032100000001	71-120						DIFFERENTIATION OF BRUGIA MA-LAYI AND BRUGIA PAHANGIBY PCR-RFLP OF ITSl AND ITS2	is.md.chula.ac.th	0	0		
699	chrI	15064323	15064347	3500322653	24		15064323	15064347	8421504	1	24	0	c	350032265300000000	0-24						Nested PCR to detect and distinguish the sympatric filarial species Onchocerca volvulus Mansonella ozzardi and Mansonella perstans in the Amazon Region	as.ioc.fiocruz.br	0	0		
699	chrI	15064388	15064640	3500193585	57		15064388	15064640	8421504	2	27,30	0,222	c,g	350019358500000000,350019358500000001	0-27,0-30					The Journal of Cell Biology	ncl-1 Is Required for the Regulation of Cell Size and Ribosomal RNA Synthesis in Caenorhabditis elegans 	Deborah	1998	0		
699	chrI	15064400	15064440	3500425488	40		15064400	15064440	8421504	1	40	0	c	350042548800000006	0-40						Modulating XRN2 - NOVARTIS FORSCHUNGSSTIFTUNG, ZWEIGNIEDERLASSUNG, FRIEDRICH MIESCHER INSITITUTE FOR BIOMEDICAL RESEARCH	www.sumobrain.com	0	0		
699	chrI	15064403	15070377	3500102025	62		15064403	15070377	8421504	2	26,36	0,5938	c,g	350010202500000013,350010202500000013,350010202500000020	0-26,0-26,0-36						 mapping quality score in tophat sam file [Archive] - SEQanswers	seqanswers.com	0	0		
699	chrI	15064422	15071017	3500222494	122		15064422	15071017	8421504	6	20,19,21,19,21,22	0,5238,5747,6224,6409,6573	c	350022249400000013,350022249400000000,350022249400000006,350022249400000009,350022249400000001,350022249400000008,350022249400000010,350022249400000012	0-20,0-19,0-19,16-37,0-21,0-19,0-21,0-22						Denaturing gradient gel electrophoresis (DGGE) as a tool for identification of marine nematodes	www.int-res.com	0	0		
699	chrI	15069306	15070991	3500451852	518		15069306	15070991	8421504	12	19,60,41,34,5,100,122,59,3,7,49,19	0,316,486,546,667,861,1004,1334,1395,1399,1517,1666	c	350045185200000062,350045185200000050,350045185200000126,350045185200000120,350045185200000170,350045185200000156,350045185200000165,350045185200000127,350045185200000255,350045185200000231,350045185200000281,350045185200000248,350045185200000256,350045185200000336,350045185200000435,350045185200000396,350045185200000388,350045185200000416,350045185200000383,350045185200000380,350045185200000384,350045185200000421,350045185200000420,350045185200000379,350045185200000376,350045185200000398,350045185200000374,350045185200000390,350045185200000407,350045185200000397,350045185200000364,350045185200000365,350045185200000370,350045185200000412,350045185200000414,350045185200000410,350045185200000411,350045185200000368,350045185200000372,350045185200000373	3-22,3-22,0-60,0-60,0-60,0-272,47-132,40-129,0-89,49-319,20-124,20-125,44-146,31-100,0-176,0-49,0-173,0-175,0-166,0-49,0-49,0-176,0-162,0-49,0-174,0-49,0-173,0-175,0-31,0-46,6-49,6-49,6-49,8-49,8-49,8-49,8-183,9-47,10-173,10-180						#NEXUS [echinoderm consensus -- July 2001] begin data; dimensions ntax=67 nchar=2128; format data	www.nhm.ac.uk	0	0		
699	chrI	15069306	15070220	3500464540	64		15069306	15070220	8421504	3	19,21,24	0,863,890	c	350046454000000000,350046454000000001,350046454000000003	0-19,0-21,0-24						Isolation of C. elegans and related nematodes	nsemblgenomes.org	0	0		
699	chrI	15069306	15070194	3500021021	83		15069306	15070194	8421504	4	19,19,20,25	0,354,506,863	c	350002102100000000,350002102100000004,350002102100000005,350002102100000001	9-28,0-19,0-20,0-25		23284767	10.1371/journal.pone.0051785	1932-6203	PLOS ONE	PLOS ONE: Profiling Nematode Communities in Unmanaged Flowerbed and Agricultural Field Soils in Japan by DNA Barcode Sequencing	Morise	2012	4		
699	chrI	15069306	15070190	3500424701	60		15069306	15070190	8421504	3	19,20,21	0,506,863	c	350042470100000001,350042470100000003,350042470100000002	0-19,0-20,0-21						Isolation of naturally associated bacteria of necromenic Pristionchusnematodes and fitness consequences	eb.biologists.org	0	0		
699	chrI	15069306	15070190	3500389091	40		15069306	15070190	8421504	2	19,21	0,863	c	350038909100000000,350038909100000001	0-19,0-21						地球生命システム　【サブプロジェクト２－極限環境生物システム】	ntmoss.nipr.ac.jp	0	0		
699	chrI	15069306	15070190	3500346919	60		15069306	15070190	8421504	3	19,20,21	0,506,863	c	350034691900000000,350034691900000002,350034691900000001	0-19,0-20,0-21			10.1186/1471-2148-7-104	1471-2148	BMC Evolutionary Biology	Phylogeny of the nematode genus Pristionchus and implications for biodiversity, biogeography and the evolution of hermaphroditism	Mayer	2007	4		
699	chrI	15069306	15070190	3500307378	40		15069306	15070190	8421504	2	19,21	0,863	c	350030737800000000,350030737800000001	0-19,0-21						地球生命システム　【サブプロジェクト２－極限環境生物システム】	tric.rois.ac.jp	0	0		
699	chrI	15069306	15070190	3500307128	60		15069306	15070190	8421504	3	19,20,21	0,506,863	c	350030712800000000,350030712800000002,350030712800000001	0-19,0-20,0-21			10.1186/1742-9994-3-14	1742-9994	Frontiers in Zoology	Sex, bugs and Haldane's rule: the nematode genus Pristionchus in the United States	Herrmann	2006	4		
699	chrI	15069306	15070190	3500198587	60		15069306	15070190	8421504	3	19,20,21	0,506,863	c	350019858700000000,350019858700000002,350019858700000001	0-19,0-20,0-21						Pristionchus pacificus (Nematoda: Diplogastridae) Is Associated with the Oriental Beetle Exomala orientalis (Coleoptera: Scarabaeidae) in Japan	www.csun.edu	0	0		
699	chrI	15069306	15070190	3500186172	60		15069306	15070190	8421504	3	19,20,21	0,506,863	c	350018617200000000,350018617200000002,350018617200000001	0-19,0-20,0-21			10.1186/1742-9994-3-14	1742-9994	Frontiers in Zoology	Sex, bugs and Haldane's rule: the nematode genus Pristionchus in the United States	Herrmann	2006	4		
699	chrI	15069306	15070190	3500140459	126		15069306	15070190	8421504	4	19,66,20,21	0,283,506,863	c	350014045900000020,350014045900000004,350014045900000022,350014045900000021	0-19,47-113,0-20,0-21						Frontiers in Zoology BioMed Central	biomedcentral.com	0	0		
699	chrI	15069306	15070190	3500123058	60		15069306	15070190	8421504	3	19,20,21	0,506,863	c	350012305800000000,350012305800000002,350012305800000001	0-19,0-20,0-21		19703296	10.1186/1471-2148-9-212	1471-2148	BMC Evolutionary Biology	Molecular phylogeny of beetle associated diplogastrid nematodes suggests host switching rather than nematode-beetle coevolution	Mayer	2009	4		
699	chrI	15069306	15070190	3500072581	60		15069306	15070190	8421504	3	19,20,21	0,506,863	c	350007258100000000,350007258100000002,350007258100000001	0-19,0-20,0-21						BMC Evolutionary Biology BioMed Central	biomedcentral.com	0	0		
699	chrI	15069306	15070190	3500064654	60		15069306	15070190	8421504	3	19,20,21	0,506,863	c	350006465400000000,350006465400000002,350006465400000001	0-19,0-20,0-21			10.1186/1742-9994-3-14		Frontiers in Zoology	Sex, bugs and Haldane's rule: the nematode genus Pristionchus in the United States	Matthias	2006	0		
699	chrI	15069306	15069880	3500093749	40		15069306	15069880	8421504	2	19,21	0,553	c	350009374900000002,350009374900000024	3-22,0-21						Identification and characterisation of two haplosporidian parasites of oysters in north Western Australia.	ry.murdoch.edu.au	0	0		
699	chrI	15069306	15069679	3500208765	38		15069306	15069679	8421504	2	19,19	0,354	c	350020876500000000,350020876500000001	0-19,0-19		23563772	10.1590/S0036-46652013000200015	0036-4665	Revista do Instituto de Medicina Tropical de São Paulo	Revista do Instituto de Medicina Tropical de São Paulo - PARASITOLOGICAL AND MOLECULAR DIAGNOSIS IN EXPERIMENTAL Strongyloides venezuelensis INFECTION	Paula	2013	1		
699	chrI	15069306	15069679	3500159405	39		15069306	15069679	8421504	2	20,19	0,354	c	350015940500000002,350015940500000003	0-20,0-19						INSTITUTO OSWALDO CRUZ	w.biopesca.org.br	0	0		
699	chrI	15069306	15069679	3500034574	38		15069306	15069679	8421504	2	19,19	0,354	c	350003457400000000,350003457400000001	0-19,0-19		23563772	10.1590/S0036-46652013000200015	0036-4665	Revista do Instituto de Medicina Tropical de São Paulo	Revista do Instituto de Medicina Tropical de São Paulo - PARASITOLOGICAL AND MOLECULAR DIAGNOSIS IN EXPERIMENTAL Strongyloides venezuelensis INFECTION	Paula	2013	1		
699	chrI	15069417	15069445	3500034586	23		15069417	15069445	8421504	2	16,7	0,21	c	350003458600000019	6-29						THE THAI JOURNAL OF VETERINARY MEDICINE	w.vet.chula.ac.th	0	0		
699	chrI	15069617	15070238	3500349029	47		15069617	15070238	8421504	2	24,23	0,598	c	350034902900000004,350034902900000005	0-24,0-23						Phylogenetic analysis of non-stereotyped behavioural sequences with a successive event-pairing method	www.mnhn.fr	0	0		
699	chrI	15069618	15069641	3500277678	23		15069618	15069641	8421504	1	23	0	c	350027767800000001	0-23		21139578	10.1038/ncomms1133		Nature Communications	A speciation gene for left–right reversal in snails results in anti-predator adaptation	Masaki		0		
699	chrI	15069618	15069641	3500207411	23		15069618	15069641	8421504	1	23	0	c	350020741100000001	0-23		21139578	10.1038/ncomms1133	2041-1733	Nature Communications	A speciation gene for left-right reversal in snails results in anti-predator adaptation	Hoso	2010	0		
699	chrI	15069620	15070871	3500004484	328		15069620	15070871	8421504	10	19,39,32,37,14,22,48,24,21,72	0,24,181,231,557,572,748,872,1032,1179	c	350000448400000344,350000448400000452,350000448400000414,350000448400000410,350000448400000427,350000448400000428,350000448400000445,350000448400000406,350000448400000398,350000448400000395,350000448400000565,350000448400000600,350000448400000598,350000448400000599,350000448400000596,350000448400000597,350000448400000608,350000448400000609,350000448400000607,350000448400000601,350000448400000588,350000448400000610,350000448400000590,350000448400000591,350000448400000592,350000448400000593,350000448400000595,350000448400000807,350000448400001005,350000448400001089,350000448400001106,350000448400001070,350000448400001297,350000448400001303,350000448400001317,350000448400001309,350000448400001412,350000448400001431,350000448400001427,350000448400001428,350000448400001444,350000448400001457,350000448400001454,350000448400001463,350000448400001453,350000448400001460,350000448400001488,350000448400001464,350000448400001490,350000448400001462,350000448400001507,350000448400001471	0-35,0-24,0-24,0-24,0-24,0-24,0-24,0-24,0-24,0-24,0-32,0-30,0-30,0-25,0-30,0-30,8-30,8-30,8-42,8-30,8-29,8-30,8-32,8-30,8-30,8-30,8-30,0-36,0-48,22-46,0-21,0-19,0-21,0-21,0-21,0-21,0-47,0-48,0-47,0-49,0-43,0-21,0-22,0-22,0-23,0-22,0-22,0-21,0-22,0-22,0-22,0-22						#NEXUS [MacClade 3.01 registered to Brent D. Mishler, Duke University] [**The final matrix GP-COMB	jeps.berkeley.edu	0	0		
699	chrI	15069620	15069833	3500031499	103		15069620	15069833	8421504	2	62,41	0,172	c	350003149900000037,350003149900000087,350003149900000021,350003149900000041,350003149900000090	0-60,0-52,31-60,3-44,0-26						Diurnal Modification of a Red-Tide Causing Organism, Chattonella antiqua (Raphidophyceae) from Korea	www.e-algae.kr	0	0		
699	chrI	15069627	15070868	3500009376	102		15069627	15070868	8421504	2	51,51	0,1190	c	350000937600005475,350000937600005566	0-51,0-51						 Galaxy | Dataset | FASTQ Groomer on data 2	popgenie.org:8080	0	0		
699	chrI	15069644	15069682	3500354452	38		15069644	15069682	8421504	1	38	0	c	350035445200000010	7-45						Comparison of taxa of the mussel Mytilus (Bivalvia) by analysis of the nuclear small-subunit rRNA gene sequence - ResearchGate	.researchgate.net	0	0		
699	chrI	15069644	15069669	3500301473	25		15069644	15069669	8421504	1	25	0	c	350030147300000018	23-48						4 	jcb.rupress.org	0	0		
699	chrI	15069650	15069817	3500167162	47		15069650	15069817	8421504	2	25,22	0,145	c	350016716200000001,350016716200000010	0-25,0-22							nematol.unh.edu	0	0		
699	chrI	15069654	15070382	3500234422	49		15069654	15070382	8421504	2	23,26	0,702	c	350023442200000001,350023442200000004	0-23,0-26						Hidden genetic diversity in the green alga Spirogyra (Zygnematophyceae, Streptophyta)	biomedcentral.com	0	0		
699	chrI	15069660	15070871	3500043058	135		15069660	15070871	8421504	6	19,34,21,19,19,23	0,138,509,879,986,1188	c	350004305800000013,350004305800000010,350004305800000011,350004305800000012,350004305800000009,350004305800000007,350004305800000008,350004305800000003	0-19,0-21,0-20,0-21,0-19,0-19,0-19,0-23						Morphological and molecular characterisation of Pratylenchus araucensis n. sp. (Pratylenchidae), a root-lesion nematode Musa	w.corpoica.org.co	0	0		
699	chrI	15069660	15070560	3500208352	100		15069660	15070560	8421504	5	19,20,20,20,21	0,152,470,759,879	c	350020835200000007,350020835200000000,350020835200000001,350020835200000006,350020835200000009	0-19,0-20,0-20,0-20,0-21						Incidence and Genetic Characterization of Gongylonema pulchrum in Cattle Slaughtered in Mazandaran Province, Northern Iran	urnals.tums.ac.ir	0	0		
699	chrI	15069790	15070268	3500217922	100		15069790	15070268	8421504	2	45,55	0,423	c	350021792200000099,350021792200000102	24-69,0-55						METHODS AND MATERIALS FOR CONFERRING RESISTANCE TO PESTS AND PATHOGENS OF PLANTS - Patent application	www.faqs.org	0	0		
699	chrI	15069792	15070872	3500015190	309		15069792	15070872	8421504	8	41,6,7,73,105,19,16,42	0,111,211,376,553,767,806,1038	c	350001519000000141,350001519000000140,350001519000000147,350001519000000146,350001519000000144,350001519000000149,350001519000000148,350001519000000158,350001519000000138,350001519000000139,350001519000000154,350001519000000155,350001519000000137,350001519000000159,350001519000000156,350001519000000157,350001519000000150,350001519000000152,350001519000000153,350001519000000251,350001519000000242,350001519000000254,350001519000000253,350001519000000252,350001519000000246,350001519000000250,350001519000000233,350001519000000232,350001519000000235,350001519000000234,350001519000000236,350001519000000239,350001519000000241,350001519000000243,350001519000000244,350001519000000245,350001519000000248,350001519000000293,350001519000000300,350001519000000330,350001519000000334,350001519000000336,350001519000000350,350001519000000335,350001519000000325,350001519000000333,350001519000000329,350001519000000328,350001519000000343,350001519000000345,350001519000000346,350001519000000337,350001519000000348,350001519000000403,350001519000000425,350001519000000421,350001519000000411,350001519000000413	58-99,58-99,58-99,162-203,58-99,58-99,58-99,161-202,162-203,58-104,58-99,58-99,54-102,58-99,58-99,58-105,58-99,161-207,58-99,28-101,28-101,28-101,135-208,28-101,28-101,28-101,136-209,28-101,135-208,28-101,28-101,28-101,28-101,28-101,28-101,28-100,28-101,0-105,0-105,0-57,0-57,0-57,0-57,0-57,0-57,0-57,0-57,0-57,0-57,0-57,0-57,0-57,0-57,0-42,0-42,0-42,0-42,0-42							research.amnh.org	0	0		
699	chrI	15069792	15069833	3500268081	41		15069792	15069833	8421504	1	41	0	c	350026808100000015	40-81						Molecular evolution and phylogeny of the Laminariales : analysis of the nuclear coded ribosomal cistron	summit.sfu.ca	0	0		
699	chrI	15069792	15069833	3500061648	41		15069792	15069833	8421504	1	41	0	c	350006164800000061,350006164800000033,350006164800000036	3-44,3-44,3-44						Supporting Information 	www.pnas.org	0	0		
699	chrI	15069793	15070621	3500012687	65		15069793	15070621	8421504	4	23,23,14,5	0,399,807,823	c	350001268700000002,350001268700000003,350001268700000001	1-24,0-23,0-19						A megafauna's microfauna: gastrointestinal parasites of New Zealand's extinct moa (Aves: Dinonithiformes) | Nic Rawlence - Academia.edu	www.academia.edu	0	0		
699	chrI	15069793	15070364	3500026899	40		15069793	15070364	8421504	2	20,20	0,551	c	350002689900000000,350002689900000001	0-20,0-20					Journal of nematology	Phylogenetic Relationships of the Marine Nematode Family Comesomatidae	Jyotsna	June	0		
699	chrI	15069795	15070864	3500461888	133		15069795	15070864	8421504	3	38,46,49	0,373,1020	c	350046188800001882,350046188800001870,350046188800000251	51-89,99-145,50-99						 Galaxy | Dataset | FASTQ to Tabular	popgenie.org:8080	0	0		
699	chrI	15069795	15070855	3500376863	80		15069795	15070855	8421504	3	22,34,24	0,431,1036	c	350037686300000008,350037686300000004,350037686300000007,350037686300000002,350037686300000005	0-22,0-23,0-19,0-21,0-21						Root-Knot Nematodes in Golf Course Greens of the Western United States	.ceris.purdue.edu	0	0		
699	chrI	15069798	15070379	3500058686	46		15069798	15070379	8421504	2	22,24	0,557	c	350005868600000002,350005868600000001	0-22,0-24						Multipleoriginsofparasitisminlice	www.inhs.uiuc.edu	0	0		
699	chrI	15069798	15069822	3500360075	23		15069798	15069822	8421504	2	16,7	0,17	c	350036007500000002	0-23						Phylogeny and evolution of Planomonadida (Sulcozoa): eight new species and new genera Fabomonas and Nutomonas | Edvard Glücksman - Academia.edu	www.academia.edu	0	0		
699	chrI	15069798	15069822	3500263535	23		15069798	15069822	8421504	2	16,7	0,17	c	350026353500000002	0-23						The novel marine gliding zooflagellate genus Mantamonas (Mantamonadida ord. n.: Apusozoa) | Edvard Glücksman - Academia.edu	www.academia.edu	0	0		
699	chrI	15069800	15070856	3500082845	61		15069800	15070856	8421504	3	21,20,20	0,716,1036	c	350008284500000002,350008284500000007,350008284500000009	0-21,0-20,0-20						PISCINOODINIUM , A FISH-ECTOPARASITIC DINOFLAGELLATE, ISA MEMBER	www.docstoc.com	0	0		
699	chrI	15069800	15070699	3500466809	196		15069800	15070699	8421504	5	29,20,20,70,57	0,399,628,688,842	c	350046680900000055,350046680900000058,350046680900000061,350046680900000063,350046680900000064	0-30,0-20,0-20,0-70,0-57						Methods of Detecting Root Knot Nematodes - Patent application	www.faqs.org	0	0		
699	chrI	15069803	15070872	3500214341	60		15069803	15070872	8421504	3	20,20,20	0,846,1049	c	350021434100000006,350021434100000007,350021434100000008	0-20,0-20,0-20			10.1111/j.1759-6831.2010.00100.x	1759-6831	Journal of Systematics and Evolution	Molecular phylogeny of the entomopathogenic fungi of the genus Cordyceps (Ascomycota: Clavicipitaceae) and its evolutionary implications - TIAN - 2010 - Journal of Systematics and Evolution - Wiley Online Library	TIAN	2010	0		
699	chrI	15069804	15070671	3500201605	44		15069804	15070671	8421504	2	23,21	0,846	c	350020160500000004,350020160500000008	0-23,0-21						Syst. Biol. 55(1):1–20, 2006 ISSN: 1063-5157 print / 1076-836X online DOI: 10.1080/10635150500354910 Phylogeny of Eunicida (Annelida) and Exploring Data Congruence Using a Partition Addition Bootstrap Alteration (PABA) Approach	gump.auburn.edu	0	0		
699	chrI	15069804	15069827	3500028336	23		15069804	15069827	8421504	1	23	0	c	350002833600000022	0-23						Investigation of molluscan phylogeny using large-subunit and small-subunit nuclear rRNA sequences	gump.auburn.edu	0	0		
699	chrI	15069805	15070999	3500460552	42		15069805	15070999	8421504	2	22,20	0,1174	c	350046055200000014,350046055200000003	0-22,0-20						Molecular survey of endosymbionts in Florida populations of Diaphorina citri (Hemiptera: Psyllidae) and its parasitoids Tamarixia radiata (Hymenoptera: Eulophidae) and Diaphorencyrtus aligarhensis (Hymenoptera: Encyrtidae).	.biomedsearch.com	0	0		
699	chrI	15069805	15069833	3500460357	28		15069805	15069833	8421504	1	28	0	c	350046035700000002,350046035700000001,350046035700000000	0-28,0-28,0-28						16s rDNA SeqAnal	s.people.cofc.edu	0	0		
699	chrI	15069805	15069833	3500450358	28		15069805	15069833	8421504	1	28	0	c	350045035800000000	0-28						科学网—封面	ews.sciencenet.cn	0	0		
699	chrI	15069805	15069833	3500448327	28		15069805	15069833	8421504	1	28	0	c	350044832700000000	0-28						Kyla audra dėl HeLa genomo paskelbimo | Vakarų Lietuvos medicina	www.vlmedicina.lt	0	0		
699	chrI	15069805	15069833	3500414376	28		15069805	15069833	8421504	1	28	0	c	350041437600000000	0-28						Fermentai | 1 puslapis | Balsas.lt	www.balsas.lt	0	0		
699	chrI	15069805	15069833	3500412711	28		15069805	15069833	8421504	1	28	0	c	350041271100000000	0-28						Trumpa genomo istorija: apie sekso naudą ir „genetines avarijas“ | Balsas.lt mobili versija	www.balsas.lt	0	0		
699	chrI	15069805	15069833	3500389748	28		15069805	15069833	8421504	1	28	0	c	350038974800000000	0-28						已有30亿岁的“组织”_大成哥_新浪博客	blog.sina.com.cn	0	0		
699	chrI	15069805	15069833	3500356600	28		15069805	15069833	8421504	1	28	0	c	350035660000000000	0-28						dnr | 1 puslapis | Balsas.lt	www.balsas.lt	0	0		
699	chrI	15069805	15069833	3500346101	28		15069805	15069833	8421504	1	28	0	c	350034610100000000	0-28						genetika | 1 puslapis | Balsas.lt	www.balsas.lt	0	0		
699	chrI	15069805	15069833	3500321896	28		15069805	15069833	8421504	1	28	0	c	350032189600000000	0-28						"Ubikvista" szekvencia	www.mrns.hu	0	0		
699	chrI	15069805	15069833	3500318633	28		15069805	15069833	8421504	1	28	0	c	350031863300000000	0-28						Atliekų | 14 puslapis | Balsas.lt	www.balsas.lt	0	0		
699	chrI	15069805	15069833	3500316398	28		15069805	15069833	8421504	1	28	0	c	350031639800000000	0-28						Trumpa genomo istorija: apie sekso naudą ir „genetines avarijas“ | Balsas.lt	www.balsas.lt	0	0		
699	chrI	15069805	15069833	3500208429	28		15069805	15069833	8421504	1	28	0	c	350020842900000000	0-28						你身体部分“组织”已有30亿岁_中国水运网——打造专业中国水路运输信	www.zgsyb.com	0	0		
699	chrI	15069805	15069833	3500189279	28		15069805	15069833	8421504	1	28	0	c	350018927900000000	0-28						Wilmott Forums - Fractals - Patterns and Chaos	www.wilmott.com	0	0		
699	chrI	15069805	15069833	3500187832	28		15069805	15069833	8421504	1	28	0	c	350018783200000000	0-28						Sekso nauda | 1 puslapis | Balsas.lt	www.balsas.lt	0	0		
699	chrI	15069805	15069833	3500154279	28		15069805	15069833	8421504	1	28	0	c	350015427900000000	0-28						你身体部分“组织”已有30亿岁	pop.6park.com	0	0		
699	chrI	15069805	15069833	3500060599	28		15069805	15069833	8421504	1	28	0	c	350006059900000000	0-28						Trumpa genomo istorija: apie sekso naudą ir „genetines avarijas“ | Balsas.lt	www.balsas.lt	0	0		
699	chrI	15069805	15069828	3500073301	23		15069805	15069828	8421504	1	23	0	c	350007330100000002	0-23						 <HTML> <HEAD><TITLE>aa<<a-aa<<aaaaC/a>>a>>aa*aC/a(r)ae$?aoae3aa3ae$?aoc"aaa -	www.j-tokkyo.com	0	0		
699	chrI	15069806	15070997	3500355465	40		15069806	15070997	8421504	2	19,21	0,1170	c	350035546500000003,350035546500000002	1-20,0-21						The characterization and composition of bacterial communities in soils blended with spent foundry sand	ddr.nal.usda.gov	0	0		
699	chrI	15069808	15071019	3500104900	64		15069808	15071019	8421504	3	22,20,22	0,360,1189	c	350010490000000003,350010490000000005,350010490000000002,350010490000000007	0-22,0-22,0-20,0-22						Michael Noren | The Stylet - 	la.myspecies.info	0	0		
699	chrI	15069808	15071019	3500027000	44		15069808	15071019	8421504	2	22,22	0,1189	c	350002700000000005,350002700000000004,350002700000000001	0-22,0-22,0-22						Blackwell Publishing Ltd Filling a gap in the phylogeny of flatworms: relationships within the Rhabdocoela (Platyhelminthes), inferred from 18S ribosomal DNA sequences	oclib.uhasselt.be	0	0		
699	chrI	15069810	15070852	3500148644	46		15069810	15070852	8421504	2	23,23	0,1019	c	350014864400000000,350014864400000001	0-23,0-23						What is natural? The scale and consequences of marine bioinvasions in the North Atlantic Ocean | Deniz Haydar - Academia.edu	www.academia.edu	0	0		
699	chrI	15069811	15070425	3500219487	67		15069811	15070425	8421504	3	22,22,23	0,357,591	c	350021948700000002,350021948700000005,350021948700000003	0-22,0-22,0-23						Soil inhabiting nematodes of the genera Trischistoma, Tripylina and Tripyla from México and the USA with descriptions of new species	emweb.ucdavis.edu	0	0		
699	chrI	15069812	15070190	3500225465	41		15069812	15070190	8421504	2	20,21	0,357	c	350022546500000024,350022546500000020	0-20,0-21						Towards writing the encyclopaedia of life: an introduction to DNA barcoding	api.ning.com	0	0		
699	chrI	15069851	15070433	3500321842	60		15069851	15070433	8421504	2	24,36	0,546	c	350032184200000001,350032184200000004,350032184200000003	0-24,0-22,5-24						Growth characteristics and phylogenetic analysis of the marine dinoflagellate Dinophysis infundibulus (Dinophyceae)	www.int-res.com	0	0		
699	chrI	15069855	15069879	3500289153	24		15069855	15069879	8421504	1	24	0	c	350028915300000001	0-24						A new species of Orobdella (Hirudinida, Arhynchobdellida, Orobdellidae) from Taipei, Taiwan	pensoft.net	0	0		
699	chrI	15069856	15070667	3500351887	59		15069856	15070667	8421504	3	20,19,20	0,550,791	c	350035188700000004,350035188700000006,350035188700000007	0-20,0-19,0-20		18251796	10.1111/j.1550-7408.2007.00295.x	1550-7408	Journal of Eukaryotic Microbiology	Genetic Diversity of Parasitic Dinoflagellates in the Genus Amoebophrya and Its Relationship to Parasite Biology and Biogeography - KIM - 2007 - Journal of Eukaryotic Microbiology - Wiley Online Library	KIM	2008	0		
699	chrI	15069856	15069879	3500085284	23		15069856	15069879	8421504	1	23	0	c	350008528400000006	19-42			10.4061/2010/145183		Stem Cells International	A Glutamine-Rich Factor Affects Stem Cell Genesis in Leech	Hohenstein	2009	0		
699	chrI	15069865	15070862	3500269550	41		15069865	15070862	8421504	2	22,19	0,978	c	350026955000000012,350026955000000016	18-41,0-19						MARCADORES MOLECULARES PARA IDENTIFICAÇÃO DE CARRAPATOS VETORES DE AGENTES RICKETTSIAIS	www.tede.ufv.br	0	0		
699	chrI	15070168	15070871	3500340254	207		15070168	15070871	8421504	3	42,120,45	0,150,658	c	350034025400000017,350034025400000022,350034025400000000,350034025400000023,350034025400000033	18-60,0-60,5-27,0-60,7-52						Massive occurrence and identification of the nematode Alloionema appendiculatum Schneider (Rhabditida: Alloionematidae) found in Arionidae slugs in Slovenia	aas.bf.uni-lj.si	0	0		
699	chrI	15070168	15070653	3500433376	45		15070168	15070653	8421504	2	23,22	0,463	c	350043337600000005,350043337600000003	0-23,0-22						A preliminary phylogeny of the Pentatomomorpha (Hemiptera: Heteroptera) based on nuclear 18S rDNA and mitochondrial DNA sequences	zy.zhku.edu.cn	0	0		
699	chrI	15070169	15070192	3500111171	23		15070169	15070192	8421504	1	23	0	c	350011117100000067,350011117100000174	0-23,0-22						Docherty, Louise E. (2007) Idendification and characterisation of novel small RNAs from repetitve elements in mammals.	theses.gla.ac.uk	0	0		
699	chrI	15070187	15070812	3500208400	91		15070187	15070812	8421504	3	27,44,20	0,202,605	c	350020840000000002,350020840000000036,350020840000000054,350020840000000022	0-27,16-60,0-37,13-33						MSc Thesis HE Johnson 2010	eprints.ru.ac.za	0	0		
699	chrI	15070200	15070675	3500006858	43		15070200	15070675	8421504	2	22,21	0,454	c	350000685800000075,350000685800000076	0-22,0-21						P53 MODULATOR AND CANCER TARGET	Barton	2008	0		
699	chrI	15070203	15070422	3500353509	75		15070203	15070422	8421504	4	19,27,8,21	0,20,50,198	c	350035350900000011,350035350900000003	0-58,0-21						The 18S Ribosomal DNA Sequence of Strongyloides stercoralis in Iran	urnals.tums.ac.ir	0	0		
699	chrI	15070226	15070855	3500360502	47		15070226	15070855	8421504	2	23,24	0,605	c	350036050200000000,350036050200000002,350036050200000001	0-23,0-21,0-21						MOLECULAR BIOLOGY AND PHYSIOLOGY	ams.cotton.org	0	0		
699	chrI	15070226	15070855	3500212683	44		15070226	15070855	8421504	2	23,21	0,608	c	350021268300000004,350021268300000005	0-23,0-21						Morphological and Molecular Characterization of Meloidogyne mayaguensis Isolates from Florida	journals.fcla.edu	0	0		
699	chrI	15070226	15070855	3500129369	47		15070226	15070855	8421504	2	23,24	0,605	c	350012936900000000,350012936900000002,350012936900000001	0-23,0-21,0-21						MOLECULAR BIOLOGY AND PHYSIOLOGY	www.cotton.org	0	0		
699	chrI	15070228	15070672	3500406273	42		15070228	15070672	8421504	3	22,15,5	0,423,439	c	350040627300000008,350040627300000011	0-22,0-20						5. R EFERENCES	s.ulb.uni-bonn.de	0	0		
699	chrI	15070238	15070855	3500257725	46		15070238	15070855	8421504	2	22,24	0,593	c	350025772500000003,350025772500000008,350025772500000005	0-22,0-21,0-21					Journal of Nematology	Vittatidera zeaphila (Nematoda: Heteroderidae), a new genus and species of cyst nematode parasitic on corn (Zea mays)	Ernest	June	0		
699	chrI	15070238	15070855	3500119538	46		15070238	15070855	8421504	2	22,24	0,593	c	350011953800000003,350011953800000008,350011953800000005	0-22,0-21,0-21						The Society of Nematologists 2010. Vittatidera zeaphila (Nematoda: Heteroderidae), a new genus and species of cyst nematode parasitic on corn (Zea mays	www.ars.usda.gov	0	0		
699	chrI	15070331	15070437	3500456286	103		15070331	15070437	8421504	2	5,98	0,8	c	350045628600000039,350045628600000145	0-103,0-103						HWI-ST314_0077:4:1:20641:10005#0 0 gi|6322960|ref|NC_001144.1| 456546 0 101M * 0 0 CAAATTAAGCCGCAGGC	.toulouse.inra.fr	0	0		
699	chrI	15070342	15070428	3500014081	40		15070342	15070428	8421504	2	20,20	0,66	c	350001408100000002,350001408100000003	0-20,0-20			10.1186/1742-9994-4-18	1742-9994	Frontiers in Zoology	Analysis of the immune-related transcriptome of a lophotrochozoan model, the marine annelid Platynereis dumerilii	Altincicek	2007	4		
699	chrI	15070353	15070670	3500340427	57		15070353	15070670	8421504	2	30,27	0,290	c	350034042700000015,350034042700000006,350034042700000007,350034042700000016	0-30,0-30,0-27,0-27						KATHLEEN M. PRYER, ERIC SCHUETTPELZ, PAUL G. WOLF, HARALD SCHNEIDER, ALAN R. SMITH AND RAYMOND CRANFILL American Journal of Botany 91(10): 1582-1598.	www.amjbot.org	0	0		
699	chrI	15070354	15070512	3500466450	73		15070354	15070512	8421504	3	26,28,19	0,40,139	c	350046645000000000,350046645000000006,350046645000000001	0-26,0-28,0-19						食品中真菌成分檢驗方法－冬蟲夏草成分之檢驗	www.fda.gov.tw	0	0		
699	chrI	15070354	15070512	3500422374	73		15070354	15070512	8421504	3	26,28,19	0,40,139	c	350042237400000000,350042237400000002,350042237400000001	0-26,0-28,0-19						102年9月6日部授食字第1021950329號公告修正 蟹成分之定性檢驗	www.fda.gov.tw	0	0		
699	chrI	15070354	15070512	3500421347	73		15070354	15070512	8421504	3	26,28,19	0,40,139	c	350042134700000000,350042134700000002,350042134700000001	0-26,0-28,0-19						102年9月6日部授食字第1021950329號公告修正 黑鰓兔頭魨成分之定性檢驗	www.fda.gov.tw	0	0		
699	chrI	15070354	15070512	3500262072	73		15070354	15070512	8421504	3	26,28,19	0,40,139	c	350026207200000000,350026207200000006,350026207200000001	0-26,0-28,0-19						 Selerant China > 消息与活动 > 食品法规公告 > 台湾食品法规 > (台湾)行政院卫生署公告：&#	www.selerant.com	0	0		
699	chrI	15070369	15070427	3500347521	45		15070369	15070427	8421504	2	19,26	0,32	c	350034752100000004,350034752100000006	0-19,0-26					Journal of Nematology	Development of PrimeTime-Real-Time PCR for Species Identification of Soybean Cyst Nematode (Heterodera glycines Ichinohe, 1952) in North Carolina	Weimin	2012	0		
699	chrI	15070373	15070425	3500326183	43		15070373	15070425	8421504	2	22,21	0,31	c	350032618300000014,350032618300000011	0-22,4-25						Phylogenetic position of Ooplanctella planoconvexa, gen. et comb. nova and Echinocoleum elegans (Oocystaceae, Trebouxiophyceae, Chlorophyta).	czechphycology.cz	0	0		
699	chrI	15070394	15070420	3500136716	26		15070394	15070420	8421504	1	26	0	c	350013671600000011	0-26		17627276	10.1038/sj.emboj.7601792	ERROR! NO ISSN	The EMBO Journal	Arabidopsis POT1 associates with the telomerase RNP and is required for telomere maintenance	Surovtseva	2007	0		
699	chrI	15070401	15070867	3500289168	43		15070401	15070867	8421504	2	24,19	0,447	c	350028916800000002,350028916800000003	0-24,0-19						International Journal for parasitology	005.pasteur.ac.ir	0	0		
699	chrI	15070402	15070425	3500316699	23		15070402	15070425	8421504	1	23	0	c	350031669900000012	0-23						Polynucleotide probes for detection and quantitation of actinomycetes	Gordon	2000	0		
699	chrI	15070411	15070435	3500340229	24		15070411	15070435	8421504	1	24	0	c	350034022900000010	0-24		17890430	10.1152/ajpheart.00517.2007		American Journal of Physiology - Heart and Circulatory Physiology	Inhibition of MMP-2 gene expression with small interfering RNA in rabbit vascular smooth muscle cells	Hlawaty	2007	0		
699	chrI	15070411	15070435	3500030761	24		15070411	15070435	8421504	1	24	0	c	350003076100000010	0-24		17890430	10.1152/ajpheart.00517.2007		American Journal of Physiology - Heart and Circulatory Physiology	Inhibition of MMP-2 gene expression with small interfering RNA in rabbit vascular smooth muscle cells	Hlawaty	2007	0		
699	chrI	15070411	15070435	3500016863	24		15070411	15070435	8421504	1	24	0	c	350001686300000010	0-24		17890430	10.1152/ajpheart.00517.2007		American Journal of Physiology - Heart and Circulatory Physiology	Inhibition of MMP-2 gene expression with small interfering RNA in rabbit vascular smooth muscle cells	Hlawaty	2007	0		
699	chrI	15070416	15070526	3500127521	40		15070416	15070526	8421504	2	20,20	0,90	c	350012752100000143,350012752100000015,350012752100000142,350012752100000014	0-20,0-20,0-20,0-20						ANIMAL MODEL AND A METHOD FOR PRODUCING AN ANIMAL MODEL - Patent application	www.faqs.org	0	0		
699	chrI	15070416	15070526	3500005563	40		15070416	15070526	8421504	2	20,20	0,90	c	350000556300000012,350000556300000013	0-20,0-20						C/EBPbatthecoreoftheTGF bcytostaticresponseanditsevasionin metastatic breast cancer cells	yadda.icm.edu.pl	0	0		
699	chrI	15070478	15070502	3500296810	24		15070478	15070502	8421504	1	24	0	c	350029681000000003	0-24			10.1534/genetics.104.028423		Genetics	The L-Type Cyclin CYL-1 and the Heat-Shock-Factor HSF-1 Are Required for Heat-Shock-Induced Protein Expression in Caenorhabditis elegans	Yvonne	2004	0		
699	chrI	15070493	15070856	3500313818	46		15070493	15070856	8421504	2	24,22	0,341	c	350031381800000000,350031381800000001	19-43,18-40						SRX007368 - DRA Search	ce.ddbj.nig.ac.jp	0	0		
699	chrI	15070494	15070517	3500378809	23		15070494	15070517	8421504	1	23	0	c	350037880900000000	0-23						תרנכב םוינידירפ לש תיביבאה החירפה לע &	www.water.gov.il	0	0		
699	chrI	15070497	15070854	3500013668	40		15070497	15070854	8421504	2	19,21	0,336	c	350001366800000016,350001366800000011,350001366800000022	0-19,0-20,0-20						Molecular characterisation of an Australian isolate of Bonamia exitiosa	chimer.ifremer.fr	0	0		
699	chrI	15070500	15070524	3500152818	24		15070500	15070524	8421504	1	24	0	c	350015281800000020	0-24			10.1111/j.1365-313X.2005.02505.x	1365-313X	The Plant Journal	Silencing a prohibitin alters plant development and senescence - Chen - 2005 - The Plant Journal - Wiley Online Library	Chen	2005	0		
699	chrI	15070508	15070531	3500128916	23		15070508	15070531	8421504	1	23	0	c	350012891600000008	0-23			10.1083/jcb.200609074		The Journal of Cell Biology	The Qo site of the mitochondrial complex III is required for the transduction of hypoxic signaling via reactive oxygen species production	Eric	June	0		
699	chrI	15070509	15070533	3500055947	24		15070509	15070533	8421504	1	24	0	c	350005594700000010	0-24						The PIWI proteins SMEDWI-2 and SMEDWI-3 are required for stem cell function and piRNA expression in planarians	yeolab.ucsd.edu	0	0		
699	chrI	15070510	15070985	3500302903	171		15070510	15070985	8421504	6	68,6,16,28,40,13	0,69,88,135,322,462	c	350030290300000109,350030290300000080,350030290300000206	0-168,0-168,16-510						#NEXUS [MacClade 4.08 registered to Jeri Parrent, Swedish University of Agricultural Research] BE	www.umich.edu	0	0		
699	chrI	15070514	15070872	3500147387	82		15070514	15070872	8421504	3	33,9,40	0,38,318	c	350014738700000078,350014738700000101	4-48,42-82						Phylogenetic Position of the Dicyemid Mesozoa Inferred from 18s rDNA Sequences	www.biolbull.org	0	0		
699	chrI	15070609	15070648	3500142391	39		15070609	15070648	8421504	1	39	0	c	350014239100000074,350014239100000078	0-39,16-39						20	www.ras.ru/FStora	0	0		
699	chrI	15070653	15070863	3500349591	42		15070653	15070863	8421504	2	20,22	0,188	c	350034959100000003,350034959100000004	0-20,0-22		18205816	10.1111/j.1574-6941.2007.00430.x	1574-6941	FEMS Microbiology Ecology	Spatiotemporal heterogeneity of plankton communities in Lake Donghu, China, as revealed by PCR–denaturing gradient gel electrophoresis and its relation to biotic and abiotic factors - Yu - 2008 - FEMS Microbiology Ecology - Wiley Online Library	Yu	2008	0		
699	chrI	15070750	15070904	3500239630	40		15070750	15070904	8421504	2	20,20	0,134	c	350023963000000003,350023963000000004	0-20,0-20		20369008	10.1371/journal.pone.0009978		PLoS ONE	Phenotypic Covariance of Longevity, Immunity and Stress Resistance in the Caenorhabditis Nematodes	Francis	2010	0		
699	chrI	15070831	15070855	3500416167	24		15070831	15070855	8421504	1	24	0	c	350041616700000002,350041616700000001	0-21,0-21					Journal of Nematology	Morphological and Molecular Characterization of Discocriconemella inarata, an Endemic Nematode from North American Native Tallgrass Prairies	Thomas	2010	0		
699	chrI	15070834	15070857	3500373239	23		15070834	15070857	8421504	1	23	0	c	350037323900000000	0-23		20886243	10.1007/s00572-010-0338-y		Mycorrhiza	Host preferences and differential contributions of deciduous tree species shape mycorrhizal species richness in a mixed Central European forest	Christa	2011	0		
699	chrI	15070834	15070857	3500043953	23		15070834	15070857	8421504	1	23	0	c	350004395300000000	0-23						河北安国7种中药材AM真菌遗传多样性研究_中华文本库	www.chinadmd.com	0	0		
699	chrI	15070835	15070859	3500434121	24		15070835	15070859	8421504	1	24	0	c	350043412100000007	0-24		22140592	10.1371/journal.pntd.0001411		PLoS Neglected Tropical Diseases	Targeting the Wolbachia Cell Division Protein FtsZ as a New Approach for Antifilarial Therapy	Zhiru	2011	0		
699	chrI	15070835	15070859	3500390214	24		15070835	15070859	8421504	1	24	0	c	350039021400000003	0-24						Investigating Growth and Cellular Response of Prorocentrum minimum and Karlodinium veneficum	lawareestuary.org	0	0		
699	chrI	15070836	15070863	3500349563	27		15070836	15070863	8421504	1	27	0	c	350034956300000007	8-35						 Problem with HTSeq-count - SEQanswers	seqanswers.com	0	0		
699	chrI	15070836	15070863	3500190349	27		15070836	15070863	8421504	1	27	0	c	350019034900000007	8-35						 Problem with HTSeq-count - SEQanswers	seqanswers.com	0	0		
699	chrI	15070840	15070863	3500190915	23		15070840	15070863	8421504	1	23	0	c	350019091500000001	0-23						３ 高油脂蓄積微細藻の選抜 は屋外の大量培養に適していることが示さ0	www.s.affrc.go.jp	0	0		
699	chrI	15070843	15070869	3500215269	26		15070843	15070869	8421504	1	26	0	c	350021526900000000	0-26						Phylogenetic relationships among Orostachys subsection Orostachys species (Crassulaceae) based on nuclear and chloroplast DNA data	ww.ibss.febras.ru	0	0		
699	chrI	15070846	15070871	3500272556	25		15070846	15070871	8421504	1	25	0	c	350027255600000000	4-29						Secondary Structure and Phylogenetic Utility of the Ribosomal Internal Transcribed Spacer 2 (ITS2) in Scleractinian Corals	tud.sinica.edu.tw	0	0		
699	chrI	15070846	15070871	3500244520	25		15070846	15070871	8421504	1	25	0	c	350024452000000000	4-29						DNA barcoding reveals the coral "laboratory-rat", Stylophora pistillata encompasses multiple identities. - ResearchGate	.researchgate.net	0	0		
699	chrI	15070966	15070992	3500438397	24		15070966	15070992	8421504	2	6,18	0,8	c	350043839700000092	3-27						Ggttaccttgttacgactt	holytibetour.com	0	0		
699	chrI	15070972	15071020	3500035872	48		15070972	15071020	8421504	1	48	0	c	350003587200000026	10-58							ture.berkeley.edu	0	0		
699	chrI	15070974	15070999	3500151755	25		15070974	15070999	8421504	1	25	0	c	350015175500000009	0-25						II	nematol.unh.edu	0	0		
699	chrI	15070976	15071000	3500411269	24		15070976	15071000	8421504	1	24	0	c	350041126900000001	6-30		24031515	10.1590/S1517-83822010000200026	1517-8382	Brazilian Journal of Microbiology	Brazilian Journal of Microbiology - Biological control of potato black scurf by rhizosphere associated bacteria	Tariq	2010	1		
699	chrI	15070976	15071000	3500366063	24		15070976	15071000	8421504	1	24	0	c	350036606300000001	6-30		24031515	10.1590/S1517-838220100002000026		Brazilian Journal of Microbiology	Biological control of potato black scurf by rhizosphere associated bacteria	Mohsin	2010	0		
699	chrI	15070976	15071000	3500210457	24		15070976	15071000	8421504	1	24	0	c	350021045700000001	6-30		24031515	10.1590/S1517-83822010000200026	1517-8382	Brazilian Journal of Microbiology	Brazilian Journal of Microbiology - Biological control of potato black scurf by rhizosphere associated bacteria	Tariq	2010	1		
699	chrI	15070976	15071000	3500171289	24		15070976	15071000	8421504	1	24	0	c	350017128900000001	6-30						Potential of endophytic bacteria isolated from Sophora alopecuroides nodule in biological control against Verticillium wilt disease	www.cropj.com	0	0		
699	chrI	15070976	15071000	3500128036	24		15070976	15071000	8421504	1	24	0	c	350012803600000001	6-30		24031515	10.1590/S1517-83822010000200026	1517-8382	Brazilian Journal of Microbiology	Brazilian Journal of Microbiology - Biological control of potato black scurf by rhizosphere associated bacteria	Tariq	2010	1		
699	chrI	15070976	15071000	3500026866	24		15070976	15071000	8421504	1	24	0	c	350002686600000001	0-24							www.xkgfs.com	0	0		
699	chrI	15070978	15071002	3500028689	24		15070978	15071002	8421504	1	24	0	c	350002868900000000	0-24		20543049	10.1128/AEM.00546-10		Applied and Environmental Microbiology	Improved Molecular Detection of Angiostrongylus cantonensis in Mollusks and Other Environmental Samples with a Species-Specific Internal Transcribed Spacer 1-Based TaqMan Assay 	Yvonne	2010	0		
699	chrI	15070997	15071020	3500359899	23		15070997	15071020	8421504	1	23	0	c	350035989900000001	2-25					Proceedings of the National Academy of Sciences of the United States of America	Special Feature: Evolution of the chordate body plan: New insights from phylogenetic analyses of deuterostome phyla	Chris	2000	0		
699	chrI	15070997	15071020	3500163180	23		15070997	15071020	8421504	1	23	0	c	350016318000000001	2-25						Evolution of the chordate body plan: New insights from phylogenetic analyses of deuterostome phyla	www.pnas.org	0	0		
585	chrII	1866	4663	3500250463	1284		1866	4663	8421504	7	45,189,151,106,147,183,463	0,639,871,1064,1539,1935,2334	c,g	350025046300000000,350025046300000000	0-1284,0-1284						RubyからRの機能を使う - TogoWiki	.lifesciencedb.jp	0	0		
585	chrII	1866	1916	3500078107	50		1866	1916	8421504	1	50	0	g	350007810700000000	0-50						Perl References	stein.cshl.org	0	0		
585	chrII	7846	7917	3500297500	23		7846	7917	8421504	3	16,6,1	0,19,70	c	350029750000002227	6-37						Marshfield Set 12 Screening	www.cstl.nist.gov	0	0		
585	chrII	24818	24849	3500266829	26		24818	24849	8421504	3	5,16,5	0,7,26	c,g	350026682900001087,350026682900001087	10-36,10-36						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
585	chrII	46317	46341	3500003185	23		46317	46341	8421504	2	8,15	0,9	g	350000318500000559	3-47						Anti-bacterial methods and materials	Holden	2000	0		
585	chrII	51537	52611	3500223400	1074		51537	52611	8421504	1	1074	0	g	350022340000000000	0-1074						pmk-1 | P38 Map Kinase family | genotype ID: 23190906 @ PhenomicDB	www.phenomicdb.de	0	0		
585	chrII	61566	61633	3500287477	23		61566	61633	8421504	3	11,11,1	0,12,66	c	350028747700000001	4-27						FASTERIS - Genome Analyzer - PhiX	www.fasteris.com	0	0		
585	chrII	68480	68505	3500280414	23		68480	68505	8421504	2	5,18	0,7	g	350028041400000029	16-39						Nola Kim D’Souza BSc (Hons.)	ry.murdoch.edu.au	0	0		
585	chrII	72828	72852	3500126461	23		72828	72852	8421504	2	4,19	0,5	c	350012646100000005	14-37					Patent	Brassica regulatory sequence for root-specific or root-abundant gene expression (Patent US:5401836)	Baszczynski	1995	0		FEM1C
585	chrII	107470	107497	3500384606	24		107470	107497	8421504	2	10,14	0,13	g	350038460600000003,350038460600000001	0-24,0-24						 problem running multiz with MAF files - SEQanswers	seqanswers.com	0	0		
585	chrII	107470	107497	3500188946	24		107470	107497	8421504	2	10,14	0,13	g	350018894600000003,350018894600000001	0-24,0-24						 problem running multiz with MAF files - SEQanswers	seqanswers.com	0	0		
73	chrII	128830	135352	3500417920	40		128830	135352	8421504	2	20,20	0,6502	g	350041792000000003,350041792000000002	0-20,0-20						ScienceDirect.com - Developmental Biology - High sensitivity of C. elegans vulval precursor cells to the dose of posterior Wnts	sciencedirect.com	0	0		
586	chrII	193534	194481	3500398325	40		193534	194481	8421504	3	13,7,20	0,61,927	c,g	350039832500000001,350039832500000000,350039832500000000	0-20,0-20,0-20						Gelöste Huminstoffe können die Lebensspanne von Caenorhabditis elegans verlängern und seine Genexpression beeinflussen	www2.hu-berlin.de	0	0		
586	chrII	231004	231028	3500375490	23		231004	231028	8421504	2	8,15	0,9	c	350037549000000312	0-23						PHYLOGENETIC RELATIONSHIPS IN THE FAMILY AMARYLLIDACEAE	etd.uovs.ac.za	0	0		
586	chrII	246907	247048	3500404771	39		246907	247048	8421504	2	20,19	0,122	c,g	350040477100000016,350040477100000016,350040477100000015,350040477100000015	0-20,0-20,0-19,0-19		15767665	10.1128/MCB.25.7.2583-2592.2005	0270-7306	Molecular and Cellular Biology	HCP-4/CENP-C Promotes the Prophase Timing of Centromere Resolution by Enabling the Centromere Association of HCP-6 in Caenorhabditis elegans	Moore	2005	6		
586	chrII	251950	252635	3500464558	40		251950	252635	8421504	2	20,20	0,665	c,g	350046455800000012,350046455800000012,350046455800000011,350046455800000011	19-39,19-39,19-39,19-39			10.1371/journal.pbio.0040242	1545-7885	PLOS Biology	PLOS Biology: Metazoan Scc4 Homologs Link Sister Chromatid Cohesion to Cell and Axon Migration Guidance	Seitan	2006	0		
586	chrII	252220	252248	3500285664	23		252220	252248	8421504	2	17,6	0,22	g	350028566400000029,350028566400000028	0-23,16-39						Herbicide-Resistant Plants, And Polynucleotides And Methods For Providing Same - Patent application	www.faqs.org	0	0		
586	chrII	254100	254125	3500263717	25		254100	254125	8421504	1	25	0	g	350026371700000041	37-62						<Html><Title> Complet list of 3lsc hssp file Complet list of	cnptia.embrapa.br	0	0		
586	chrII	254734	255075	3500011244	45		254734	255075	8421504	4	11,16,6,12	0,158,285,329	g	350001124400000377	15-60						<HTML> <HEAD> <META HTTP-EQUIV="Content-Type" CONTENT="text/html;charset=Shift_JIS"> <TITLE>CREBBP</	ia.med.keio.ac.jp	0	0		
586	chrII	259511	259837	3500092739	39		259511	259837	8421504	2	20,19	0,307	c,g	350009273900000040,350009273900000040,350009273900000041,350009273900000041	0-20,0-20,0-19,0-19		22174070	10.1534/genetics.111.137455		Genetics	Cell Excitability Necessary for Male Mating Behavior in Caenorhabditis elegans Is Coordinated by Interactions Between Big Current and Ether-A-Go-Go Family K+ Channels	Brigitte	2012	0		
587	chrII	298348	298378	3500149393	25		298348	298378	8421504	2	18,7	0,23	g	350014939300000119	5-33					Patent	Bacillus thuringiensis bacteria (Patent US:5854053)	Donovan	1998	0		
587	chrII	305456	347934	3500352303	41		305456	347934	8421504	4	14,6,14,7	0,18,42452,42471	c,g	350035230300000945,350035230300000259	27-48,15-39						Anti-bacterial methods and materials	Holden	2000	0		
587	chrII	305456	347934	3500003185	41		305456	347934	8421504	4	14,6,14,7	0,18,42452,42471	c,g	350000318500000963,350000318500000277	27-48,15-39						Anti-bacterial methods and materials	Holden	2000	0		
587	chrII	316812	316838	3500438304	23		316812	316838	8421504	3	4,5,14	0,5,12	c	350043830400000003	26-49						<Html><Title> Complet list of 2b45 hssp file Complet list of	cnptia.embrapa.br	0	0		
587	chrII	325213	325241	3500193670	23		325213	325241	8421504	2	17,6	0,22	g	350019367000000163	6-29						Methods for enhancing the therapeutic efficacy of topoisomerase inhibitors - Patent application	www.faqs.org	0	0		
587	chrII	329496	329520	3500188455	23		329496	329520	8421504	2	8,15	0,9	g	350018845500000119	20-43						 Polypeptide For A TRP Channel Family Member, TRP 	www.docstoc.com	0	0		
587	chrII	359005	359031	3500375490	23		359005	359031	8421504	2	16,7	0,19	g	350037549000001375	3-26						PHYLOGENETIC RELATIONSHIPS IN THE FAMILY AMARYLLIDACEAE	etd.uovs.ac.za	0	0		
587	chrII	367870	367894	3500006669	23		367870	367894	8421504	2	5,18	0,6	g	350000666900000149	18-41						<Html><Title> Complet list of 1vly hssp file Complet list of	cnptia.embrapa.br	0	0		
587	chrII	388856	388885	3500171168	29		388856	388885	8421504	1	29	0	c	350017116800000009	0-29						Engineering of N. benthamiana L. plants for production of N-acetylgalactosamine-glycosylated proteins - towards development of a plant-based platform for production of protein therapeutics with mucin type O-glycosylation	biomedcentral.com	0	0		
587	chrII	388856	388885	3500001048	29		388856	388885	8421504	1	29	0	c	350000104800000007	0-29		20735851	10.1186/1472-6750-10-62	1472-6750	BMC Biotechnology	Engineering of N. benthamiana L. plants for production of N-acetylgalactosamine-glycosylated proteins - towards development of a plant-based platform for production of protein therapeutics with mucin type O-glycosylation	Daskalova	2010	2		
588	chrII	396467	396736	3500135521	44		396467	396736	8421504	2	20,24	0,245	g	350013552100000000,350013552100000001	0-20,0-24		17409084	10.1534/genetics.106.067223	0016-6731	Genetics	Temporal Dynamics and Linkage Disequilibrium in Natural Caenorhabditis elegans Populations	Barriere	2007	4		
588	chrII	410405	410483	3500347523	23		410405	410483	8421504	2	15,8	0,70	c	350034752300000093	10-33						US Patent # 6,300,091. Herbicide target genes and methods - Patents.com	www.patents.com	0	0		
588	chrII	410405	410483	3500210948	23		410405	410483	8421504	2	15,8	0,70	c	350021094800000093	10-33						Herbicide target genes and methods - Patent # 6300091 - PatentGenius	.patentgenius.com	0	0		
588	chrII	456819	456847	3500132146	26		456819	456847	8421504	3	14,6,6	0,15,22	c	350013214600000883	6-32							www.bch.msu.edu	0	0		
588	chrII	481336	481363	3500105817	25		481336	481363	8421504	2	6,19	0,8	g	350010581700000974	10-35							www.ars.usda.gov	0	0		
588	chrII	494600	494623	3500061790	23		494600	494623	8421504	1	23	0	c	350006179000000004,350006179000000022	0-21,0-22					Patent	Assay for methylation in the gst-pi gene (Patent CA:2326494)	Clark	2005	0		
588	chrII	497462	498656	3500461784	300		497462	498656	8421504	4	123,3,48,126	0,774,780,1068	p	350046178400015042,350046178400015044	0-174,0-126						Newly identified cholinephosphotransferases and ethanolaminephosphotransferases	Huitema	2005	0		
588	chrII	503292	503319	3500158435	23		503292	503319	8421504	2	10,13	0,14	c	350015843500000255	7-30						<Html><Title> Complet list of 1ccg hssp file Complet list of	cnptia.embrapa.br	0	0		
588	chrII	503300	503324	3500263427	24		503300	503324	8421504	1	24	0	c	350026342700000327	0-24						<Html><Title> Complet list of 1gtk hssp file Complet list of	cnptia.embrapa.br	0	0		
588	chrII	503300	503324	3500228395	23		503300	503324	8421504	2	15,8	0,16	c	350022839500000139	0-23						<Html><Title> Complet list of 1hxt hssp file Complet list of	cnptia.embrapa.br	0	0		
588	chrII	503301	503324	3500281528	23		503301	503324	8421504	1	23	0	c	350028152800000039	3-26						<Html><Title> Complet list of 2pfl hssp file Complet list of	cnptia.embrapa.br	0	0		PIM2
588	chrII	519964	520593	3500056194	44		519964	520593	8421504	2	23,21	0,608	g	350005619400000000,350005619400000001	15-38,17-38					Genes & Development	The Caenorhabditis elegans fate-determining gene mab-9 encodes a T-box protein required to pattern the posterior hindgut	Alison	2000	0		
589	chrII	525719	571892	3500343811	43		525719	571892	8421504	4	12,11,16,4	0,15,46152,46169	c	350034381100001509,350034381100001330	3-26,6-26						1531 26.93 2.31 1.16 sequence_4 1 432 (149568) + Gypsy12-ZM_I LTR/Gypsy 	nomics.purdue.edu	0	0		
589	chrII	551535	551562	3500314770	23		551535	551562	8421504	3	12,4,7	0,15,20	g	350031477000000089	1-25						Nuclei acid and polypeptide compositions encoding lepidopteran-toxic polypeptides	Baum	1999	0		
589	chrII	603948	603974	3500193093	23		603948	603974	8421504	2	7,16	0,10	g	350019309300000131	3-27						 Recombinant Vesiculoviruses And Their Uses 	www.docstoc.com	0	0		
589	chrII	607069	607097	3500292172	24		607069	607097	8421504	3	8,12,4	0,11,24	g	350029217200000052	4-28						柱状黄杆菌乙酰辅酶A 合成酶基因及其上游调控序列分析 - 豆丁网	www.docin.com	0	0		
589	chrII	609785	609812	3500458304	23		609785	609812	8421504	2	9,14	0,13	c	350045830400000021	9-32							link.springer.com	0	0		
589	chrII	621157	621183	3500291156	23		621157	621183	8421504	2	8,15	0,11	c	350029115600000713	10-33						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
589	chrII	621157	621183	3500274310	23		621157	621183	8421504	2	8,15	0,11	c	350027431000000316	8-31						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
590	chrII	700721	700796	3500442159	23		700721	700796	8421504	3	10,4,9	0,14,66	c	350044215900000134	17-40						Genome of legionella pneumophila paris and lens strain-diagnostic and epidemiological applications	Christiane	2005	0		
591	chrII	821619	821643	3500028990	23		821619	821643	8421504	2	12,11	0,13	g	350002899000000006	1-24						<!DOCTYPE HTML PUBLIC i3/4-//IETF//DTD HTML 3.0//ENi3/4> <!-- dem 31may04, changed Penner to Somers a	wheat.pw.usda.gov	0	0		
591	chrII	828825	828849	3500299309	24		828825	828849	8421504	1	24	0	c	350029930900000165	11-47						Methods For Increasing The Resistance In Plants To Biotropic Fungi 	.freshpatents.com	0	0		
591	chrII	830026	830055	3500057006	25		830026	830055	8421504	3	5,13,7	0,8,22	g	350005700600000865	4-37						<HTML><HEAD><meta http-equiv="Content-Type" content="text/html; charset=ISO-8859-1"><LINK REL="SHORT	.economie.fgov.be	0	0		
591	chrII	848917	848946	3500191907	27		848917	848946	8421504	2	15,12	0,17	g	350019190700000026	21-48						Multiple drug resistance gene of aspergillus flavus - Patent # 5773214 - PatentGenius	.patentgenius.com	0	0		
591	chrII	886720	886743	3500410101	23		886720	886743	8421504	1	23	0	c	350041010100000003	0-23		20016685	10.1371/journal.pbio.1000256		PLoS Biology	ZBED6, a Novel Transcription Factor Derived from a Domesticated DNA Transposon Regulates IGF2 Expression and Muscle Growth	Ellen	2009	0		
591	chrII	908758	908787	3500211834	26		908758	908787	8421504	2	6,20	0,9	c	350021183400000016	5-39						Genetic analysis of quantitative trait loci for cocoon and silk production quantity in Bombyx mori (Lepidoptera: Bombycidae)	www.eje.cz/pdfart	0	0		
591	chrII	917395	917419	3500172525	23		917395	917419	8421504	2	12,11	0,13	g	350017252500000016	11-40							ultry.mph.msu.edu	0	0		
592	chrII	933780	933807	3500211468	23		933780	933807	8421504	2	17,6	0,21	g	350021146800000020	15-39						Insect-specific paralytic neurotoxin genes for use in biological insect control: methods and compositions	Tomalski	1990	0		
592	chrII	933780	933807	3500037822	23		933780	933807	8421504	2	17,6	0,21	g	350003782200000020	15-39					Patent	Insect-specific paralytic neurotoxin genes for use in biological insect control: methods and compositions (Patent US:5266317)	Miller	1993	0		
592	chrII	935617	935645	3500038735	23		935617	935645	8421504	2	11,12	0,16	c	350003873500000161	3-26						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
592	chrII	936484	936812	3500461285	40		936484	936812	8421504	2	20,20	0,308	c,g	350046128500000075,350046128500000075,350046128500000074,350046128500000074	0-20,0-20,0-20,0-20						KRUPPEL-LIKE FACTORS AND FAT REGULATION - Patent application	www.faqs.org	0	0		
592	chrII	1043843	1043869	3500057948	24		1043843	1043869	8421504	2	12,12	0,14	c	350005794800000075	13-37						Nucleic Acid Molecules Encoding Fatty Acid Desaturase Genes from Plants and Methods of Use - Patent application	www.faqs.org	0	0		
593	chrII	1049386	1049413	3500356983	25		1049386	1049413	8421504	3	4,5,16	0,5,11	c,g	350035698300000099,350035698300000099	10-37,10-37						%N฀฀฀OBTENTION฀U฀ %0$5035%&-6/*7&34*5² %&506-064&	s.inp-toulouse.fr	0	0		
593	chrII	1074512	1074538	3500088013	24		1074512	1074538	8421504	2	11,13	0,13	c	350008801300001911	12-36						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
593	chrII	1074554	1074583	3500017711	26		1074554	1074583	8421504	2	8,18	0,11	c	350001771100000024	17-43						<Html><Title> Complet list of 1c8u hssp file Complet list of	cnptia.embrapa.br	0	0		
593	chrII	1092818	1092866	3500116607	48		1092818	1092866	8421504	1	48	0	p	350011660700015006	0-48						Glycine transporter	Albert	1998	0		
593	chrII	1092818	1092866	3500114615	48		1092818	1092866	8421504	1	48	0	p	350011461500015008	0-48						Glycine transporter	Albert	1999	0		
593	chrII	1128852	1128882	3500233403	24		1128852	1128882	8421504	3	5,5,14	0,8,16	c,g	350023340300000633,350023340300000633	7-31,7-31						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
593	chrII	1139663	1139695	3500190843	27		1139663	1139695	8421504	3	6,15,6	0,9,26	c	350019084300000976	0-28						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
593	chrII	1146479	1146524	3500307504	45		1146479	1146524	8421504	1	45	0	p	350030750400015109	0-45						US Patent # 5,910,626. Acetyl-CoA carboxylase compositions and methods of use - Patents.com	www.patents.com	0	0		
593	chrII	1151642	1151667	3500215765	24		1151642	1151667	8421504	2	7,17	0,8	c	350021576500000012	1-25						2011-04-26_01-velvet-curtain-presentation	ww.slideshare.net	0	0		
593	chrII	1151759	1152128	3500461285	39		1151759	1152128	8421504	2	19,20	0,349	c,g	350046128500000047,350046128500000047,350046128500000048,350046128500000048	0-19,0-19,0-20,0-20						KRUPPEL-LIKE FACTORS AND FAT REGULATION - Patent application	www.faqs.org	0	0		
594	chrII	1234248	1235739	3500440408	39		1234248	1235739	8421504	2	20,19	0,1472	c,g	350044040800000005,350044040800000005,350044040800000004,350044040800000004	0-20,0-20,0-19,0-19		20843862	10.1242/dev.048850	0950-1991	Development	The C. elegans developmental timing protein LIN-42 regulates diapause in response to environmental cues	Tennessen	2010	7		
594	chrII	1279012	1279042	3500139982	26		1279012	1279042	8421504	3	8,6,12	0,10,18	c	350013998200000151	3-29						ISOPRENOID SYNTHASES - Patent application	www.faqs.org	0	0		
595	chrII	1331386	1331412	3500016197	23		1331386	1331412	8421504	2	17,6	0,20	c	350001619700000008	18-41						Neurogenic differentiation gene neurod3 and methods for inducing differentiation of cells	Tapscott	2000	0		
595	chrII	1386047	1401733	3500397262	43		1386047	1401733	8421504	3	22,6,15	0,15664,15671	g	350039726200000969,350039726200000639	0-31,22-43						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
595	chrII	1436893	1437090	3500377280	41		1436893	1437090	8421504	2	20,21	0,176	c,g	350037728000000001,350037728000000001,350037728000000000,350037728000000000	10-30,10-30,10-31,10-31						 <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.0//EN"> <HTML> <HEAD> <meta http-equiv="Content-Type" 	pthefaith1296.com	0	0		
595	chrII	1436893	1437090	3500040997	41		1436893	1437090	8421504	2	20,21	0,176	g	350004099700000001,350004099700000000	10-30,10-31		19763173	10.1371/journal.pgen.1000657		PLoS Genetics	Nucleolar Proteins Suppress Caenorhabditis elegans Innate Immunity by Inhibiting p53/CEP-1	Laura	2009	0		
596	chrII	1473014	1473042	3500455297	24		1473014	1473042	8421504	2	11,13	0,15	g	350045529700000015	1-25						Overexpression of OsWRKY72 gene interferes in the abscisic acid signal and auxin transport pathway of Arabidopsis	rcedb.xtbg.cas.cn	0	0		
596	chrII	1508747	1508840	3500193241	39		1508747	1508840	8421504	2	19,20	0,73	c,g	350019324100000002,350019324100000002,350019324100000003,350019324100000003	0-19,0-19,0-20,0-20						FGT-1 is the major glucose transporter in C. elegans and is central to aging pathways Accepted Manuscript	www.biochemj.org	0	0		
598	chrII	1713845	1713871	3500017285	25		1713845	1713871	8421504	2	6,19	0,7	c	350001728500000052	0-25						(the BASICS Garland Science )M. J. McPherson, S. G. Moller-PCR (the BASICS (Garland Science))-Taylor & Francis(2006)	www.scribd.com	0	0		
598	chrII	1753526	1753551	3500074815	23		1753526	1753551	8421504	2	6,17	0,8	g	350007481500000106	21-44						Post-transcriptional gene regulation in Drosophila: an investigation into the roles of RNA silencing and the DEAD-box helicase Belle	uni-heidelberg.de	0	0		
598	chrII	1776334	1776364	3500395481	25		1776334	1776364	8421504	2	16,9	0,21	c	350039548100000018	20-47						Apparatus and method for detecting and identifying infectious agents - Patent # 6649356 - PatentGenius	.patentgenius.com	0	0		
598	chrII	1807799	1807826	3500057471	24		1807799	1807826	8421504	2	12,12	0,15	c	350005747100000051	3-28						Bacteriophage RM 378 of a thermophilic host organism	Hjorleifsdottir	2000	0		
598	chrII	1817767	1817792	3500072483	23		1817767	1817792	8421504	2	8,15	0,10	g	350007248300000596	3-26						Method of Producing Transgenic Graminaceous Cells and Plants - Patent application	www.faqs.org	0	0		
599	chrII	1887929	1887964	3500306261	28		1887929	1887964	8421504	3	6,7,15	0,9,20	c	350030626100000225	0-28						<Html><Title> Complet list of 2b6p hssp file Complet list of	cnptia.embrapa.br	0	0		
599	chrII	1887930	1887964	3500164555	26		1887930	1887964	8421504	3	5,6,15	0,8,19	c	350016455500000477	12-38						<Html><Title> Complet list of 1ptu hssp file Complet list of	cnptia.embrapa.br	0	0		
599	chrII	1887938	1887969	3500228395	26		1887938	1887969	8421504	2	6,20	0,11	c	350022839500000194,350022839500000082,350022839500000188	0-19,3-29,0-19						<Html><Title> Complet list of 1hxt hssp file Complet list of	cnptia.embrapa.br	0	0		
599	chrII	1887938	1887967	3500036675	25		1887938	1887967	8421504	2	7,18	0,11	c	350003667500000376	9-34						<Html><Title> Complet list of 1gpd hssp file Complet list of	cnptia.embrapa.br	0	0		
599	chrII	1887942	1887967	3500280784	23		1887942	1887967	8421504	2	5,18	0,7	c	350028078400000319	0-23						<Html><Title> Complet list of 1od8 hssp file Complet list of	cnptia.embrapa.br	0	0		
599	chrII	1890405	1890431	3500241875	23		1890405	1890431	8421504	3	14,4,5	0,15,21	c	350024187500000460	16-39					Patent	Enhancement of influenza gene expression (Patent US:8227188)	Fougerolles	2012	0		
599	chrII	1902649	1902672	3500214776	23		1902649	1902672	8421504	1	23	0	c	350021477600000006	7-30						Supporting Information	www.pnas.org	0	0		
599	chrII	1918380	1939944	3500243691	41		1918380	1939944	8421504	4	6,15,6,14	0,8,21543,21550	g	350024369100003142,350024369100000303	8-29,19-42						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
599	chrII	1923955	1923982	3500245494	24		1923955	1923982	8421504	3	13,4,7	0,14,20	g	350024549400000226	19-43						<Html><Title> Complet list of 2x2w hssp file Complet list of	cnptia.embrapa.br	0	0		
599	chrII	1956802	1956828	3500284394	23		1956802	1956828	8421504	3	14,4,5	0,15,21	c	350028439400000460	16-39						RNAi INHIBITION OF INFLUENZA VIRUS REPLICATION	Fougerolles	2011	0		
599	chrII	1956802	1956828	3500253796	23		1956802	1956828	8421504	3	14,4,5	0,15,21	c	350025379600000460	16-39					Patent	Enhancement of influenza gene expression (Patent US:8227188)	Fougerolles	2012	0		
599	chrII	1956802	1956828	3500068199	23		1956802	1956828	8421504	3	14,4,5	0,15,21	c	350006819900000460	16-39						RNAi INHIBITION OF INFLUENZA VIRUS REPLICATION - Patent application	www.faqs.org	0	0		
600	chrII	1996675	1996702	3500427561	27		1996675	1996702	8421504	1	27	0	g	350042756100000039,350042756100000109	31-56,10-37						<!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.0 Transitional//EN"> <HTML><HEAD><TITLE>aao!a$?(c)ae(c)ae31/2</	www.tiandz.com	0	0		
600	chrII	1997593	1997619	3500070088	23		1997593	1997619	8421504	3	5,4,14	0,7,12	c	350007008800000460	16-39						RNAI INHIBITION OF INFLUENZA VIRUS REPLICATION	Fougerolles	2006	0		
600	chrII	1997593	1997619	3500019915	23		1997593	1997619	8421504	3	5,4,14	0,7,12	c	350001991500000460	16-39						Rnai Inhibition Of Influenza Virus Replication 	.freshpatents.com	0	0		
600	chrII	2043181	2043205	3500297500	23		2043181	2043205	8421504	2	4,19	0,5	c	350029750000000745	1-24						Marshfield Set 12 Screening	www.cstl.nist.gov	0	0		
600	chrII	2043181	2043205	3500171190	23		2043181	2043205	8421504	2	4,19	0,5	c	350017119000000170	1-24							shfieldclinic.org	0	0		
600	chrII	2051630	2051659	3500447003	25		2051630	2051659	8421504	3	15,4,6	0,16,23	c	350044700300000047	14-39						SSR	itrus.pw.usda.gov	0	0		
600	chrII	2085944	2085968	3500432414	23		2085944	2085968	8421504	2	5,18	0,6	g	350043241400000043	4-34						OVINE IDENTIFICATION METHOD	Mcewan	2008	0		
601	chrII	2136684	2136710	3500465430	26		2136684	2136710	8421504	1	26	0	g	350046543000000002	0-26						CiteULike: Large-Scale Sequencing Reveals 21U-RNAs and Additional MicroRNAs and Endogenous siRNAs in C. elegans	www.citeulike.org	0	0		
601	chrII	2136684	2136710	3500419856	26		2136684	2136710	8421504	1	26	0	g	350041985600000084	0-26						Large-Scale Sequencing Reveals 21U-RNAs and Additional MicroRNAs and Endogenous siRNAs in C. elegans	tellab.wi.mit.edu	0	0		
601	chrII	2136684	2136710	3500375579	26		2136684	2136710	8421504	1	26	0	g	350037557900000084	0-26						Large-Scale Sequencing Reveals 21U-RNAs and Additional MicroRNAs and Endogenous siRNAs in C. elegans	tellab.wi.mit.edu	0	0		
601	chrII	2173143	2173167	3500054618	23		2173143	2173167	8421504	2	16,7	0,17	g	350005461800000661	0-23						SOYBEAN PLANTS HAVING SUPERIOR AGRONOMIC PERFORMANCE AND METHODS FOR THEIR PRODUCTION - Patent application	www.faqs.org	0	0		
601	chrII	2179660	2179687	3500165371	25		2179660	2179687	8421504	3	5,14,6	0,6,21	c	350016537100000143	16-41						NOVEL ATP:CITRATE LYASE GENES - Patent application	www.faqs.org	0	0		
601	chrII	2184272	2184297	3500127292	23		2184272	2184297	8421504	2	6,17	0,8	c	350012729200000007	2-25			10.1042/BJ20041107		Biochemical Journal	The BIR domain of IAP-like protein 2 is conformationally unstable: implications for caspase inhibition	Hwain	2005	0		
601	chrII	2199682	2199708	3500245946	24		2199682	2199708	8421504	2	18,6	0,20	c	350024594600000033	12-37						 キサンタンリアーゼ活性を有する蛋白質、それをコードする遺伝子お̈	www.fa-navi.jp	0	0		
601	chrII	2215542	2215568	3500373188	24		2215542	2215568	8421504	2	19,5	0,21	g	350037318800000119	9-35						Microsatellites database	insilico.ehu.es	0	0		
601	chrII	2218103	2218131	3500148414	25		2218103	2218131	8421504	2	5,20	0,8	c,g	350014841400000251,350014841400000251	5-31,5-31						Development of novel anti-microbial agents based on bacteriophage genomics	Pelletier	1999	0		
601	chrII	2218166	2218190	3500163088	23		2218166	2218190	8421504	2	4,19	0,5	c	350016308800000004,350016308800000005	2-26,7-31						An Enantioselective Artificial Metallo-Hydratase Supporting info Jeffrey Bos, Ana García-Herraiz and Gerard Roelfes*	h.eldoc.ub.rug.nl	0	0		
602	chrII	2338032	2355290	3500004951	41		2338032	2355290	8421504	4	16,6,6,13	0,19,17238,17245	g	350000495100000577,350000495100000343	8-30,4-23						Transcriptional Regulator 	.freshpatents.com	0	0		
603	chrII	2383444	2427038	3500352303	40		2383444	2427038	8421504	5	4,4,12,6,14	0,5,10,43570,43580	c,g	350035230300000594,350035230300000221	3-23,8-29						Anti-bacterial methods and materials	Holden	2000	0		
603	chrII	2385570	2385595	3500397262	24		2385570	2385595	8421504	2	4,20	0,5	g	350039726200001031	4-28						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
603	chrII	2420024	2458907	3500395481	40		2420024	2458907	8421504	4	7,13,7,13	0,10,38859,38870	c	350039548100000103,350039548100000157	15-35,8-28						Apparatus and method for detecting and identifying infectious agents - Patent # 6649356 - PatentGenius	.patentgenius.com	0	0		
603	chrII	2424695	2424719	3500075272	23		2424695	2424719	8421504	2	4,19	0,5	c,g	350007527200000068,350007527200000068	24-48,24-48					Patent	核苷－5’－ 磷酸酯的制造方法 (Patent CN:1105778)	San Yuan Kang Bo 	2003	0		
603	chrII	2452858	2452881	3500350956	23		2452858	2452881	8421504	1	23	0	g	350035095600000028,350035095600000027	0-23,0-21		24037191	10.1590/0074-0276108062013005	0074-0276	Memórias do Instituto Oswaldo Cruz	Memórias do Instituto Oswaldo Cruz - Identification and characterisation of microRNAs in young adults of Angiostrongylus cantonensis via a deep-sequencing approach	Chang	2013	2		
603	chrII	2452858	2452881	3500114937	23		2452858	2452881	8421504	1	23	0	g	350011493700000009	0-23		22096484	10.1371/journal.pone.0026448		PLoS ONE	Transcriptome of Small Regulatory RNAs in the Development of the Zoonotic Parasite Trichinella spiralis	Xiaolei	2011	0		
603	chrII	2452858	2452881	3500019132	23		2452858	2452881	8421504	1	23	0	g	350001913200000028,350001913200000027	0-23,0-21		24037191	10.1590/0074-0276108062013005	0074-0276	Memórias do Instituto Oswaldo Cruz	Memórias do Instituto Oswaldo Cruz - Identification and characterisation of microRNAs in young adults of Angiostrongylus cantonensis via a deep-sequencing approach	Chang	2013	2		
603	chrII	2467963	2467990	3500110550	23		2467963	2467990	8421504	2	9,14	0,13	c	350011055000000267	21-44						NUCLEOTIDE AND AMINO ACID SEQUENCES RELATING TO RESPIRATORY DISEASES AND OBESITY	Keith	2007	0		
603	chrII	2467963	2467990	3500031022	23		2467963	2467990	8421504	2	9,14	0,13	c	350003102200000267	21-44						NUCLEOTIDE AND AMINO ACID SEQUENCES RELATING TO RESPIRATORY DISEASES AND OBESITY - Patent application	www.faqs.org	0	0		
604	chrII	2531149	2531175	3500459812	24		2531149	2531175	8421504	2	5,19	0,7	c,g	350045981200000054,350045981200000054	13-38,13-38							www.nature.com	0	0		
604	chrII	2540563	2540586	3500344389	23		2540563	2540586	8421504	1	23	0	c	350034438900000951	18-41						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
604	chrII	2555824	2555847	3500352612	23		2555824	2555847	8421504	1	23	0	c	350035261200000233	15-38						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
604	chrII	2574032	2574427	3500454450	36		2574032	2574427	8421504	3	13,15,8	0,264,387	g	350045445000000005	24-60						01 Stryer 7ed 2+2 (CK) 24 pa 1 pliego	www.reverte.com	0	0		
604	chrII	2574032	2574427	3500237179	36		2574032	2574427	8421504	3	13,15,8	0,264,387	g	350023717900000005	24-60						01 Stryer 7ed 2+2 (CK) 24 pa 1 pliego	www.reverte.com	0	0		
604	chrII	2581079	2588133	3500126415	38		2581079	2588133	8421504	3	19,6,13	0,7031,7041	c,g	350012641500000067,350012641500000067,350012641500000091	13-32,13-32,4-23						M aap pppaggggiioo nffiinnee add ii suun nQQTTLL prriinnccippaallee ppeerr lla rreesaa iin gr raanneell llaa dssuul rccrroommo osoommaa 33BB dii ffruummeenntto dduuroo	rato.cib.unibo.it	0	0		
604	chrII	2619671	2619698	3500384344	24		2619671	2619698	8421504	2	12,12	0,15	c	350038434400000033	14-38						Methods and means to modulate programmed cell death in eukaryotic cells	Babiychuk	2001	0		
604	chrII	2619671	2619698	3500218028	24		2619671	2619698	8421504	2	12,12	0,15	c	350021802800000058	14-38					Patent	Methods and means to modulate programmed cell death in eukaryotic cells (Patent CN:1289680)	E*Ba Bi Chu Ke 	2006	0		
605	chrII	2622690	2622723	3500096011	26		2622690	2622723	8421504	3	13,6,7	0,17,26	c	350009601100000086	0-27						<Html><Title> Complet list of 2vex hssp file Complet list of	cnptia.embrapa.br	0	0		
605	chrII	2622690	2622718	3500193112	23		2622690	2622718	8421504	2	12,11	0,17	c	350019311200000316	8-31						<Html><Title> Complet list of 1z16 hssp file Complet list of	cnptia.embrapa.br	0	0		
605	chrII	2626034	2640777	3500428906	43		2626034	2640777	8421504	5	7,13,11,7,5	0,8,14716,14728,14738	c,g	350042890600000120,350042890600000113	12-32,22-47						<HTML><HEAD><meta http-equiv="Content-Type" content="text/html; charset=ISO-8859-1"><LINK REL="SHORT	.economie.fgov.be	0	0		
605	chrII	2631688	2631715	3500299309	23		2631688	2631715	8421504	3	13,5,5	0,16,22	g	350029930900000111	0-23						Methods For Increasing The Resistance In Plants To Biotropic Fungi 	.freshpatents.com	0	0		
605	chrII	2664060	2664149	3500437151	45		2664060	2664149	8421504	2	21,24	0,65	p	350043715100015156	0-45						NATRIURETIC PEPTIDE RELATED FRAGMENT IN CARDIOVASCULAR DISEASE - Patent application	www.faqs.org	0	0		
605	chrII	2664060	2664149	3500318004	45		2664060	2664149	8421504	2	21,24	0,65	p	350031800400015156	0-45						NATRIURETIC PEPTIDE RELATED FRAGMENT IN CARDIOVASCULAR DISEASE - Patent application	www.faqs.org	0	0		
605	chrII	2684806	2686858	3500448517	63		2684806	2686858	8421504	3	22,21,20	0,1041,2032	c,g	350044851700000001,350044851700000002,350044851700000002,350044851700000003	0-22,0-21,0-21,0-20		23363597	10.1091/mbc.E12-11-0841	1059-1524	Molecular Biology of the Cell	akirin is required for diakinesis bivalent structure and synaptonemal complex disassembly at meiotic prophase I	Clemons	2013	5		
605	chrII	2698169	2698201	3500062263	28		2698169	2698201	8421504	2	6,22	0,10	g	350006226300002638	37-65						@cluster_1 CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCACCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCACCCAAACCCCA + A@@@@@@@@@	www.ebi.ac.uk	0	0		
605	chrII	2736280	2736362	3500022877	72		2736280	2736362	8421504	2	42,30	0,52	c	350002287700000001,350002287700000000	0-42,0-30						Searching for uncommon sequences on STN	-international.de	0	0		
605	chrII	2736287	2736357	3500386452	41		2736287	2736357	8421504	3	21,9,11	0,45,59	c	350038645200000464	5-77						NEUROPROTECTIVE MOLECULES AND METHODS OF TREATING NEUROLOGICAL DISORDERS AND INDUCING STRESS GRANULES	Anderson	2011	0		
606	chrII	2811098	2811840	3500072943	24		2811098	2811840	8421504	3	9,13,2	0,10,740	c	350007294300000025	1-25						PRIMER NOTE Microsatellite markers for Fragaria from ‘Strawberry Festival’ expressed sequence tags	ddr.nal.usda.gov	0	0		
606	chrII	2822858	2822886	3500428968	25		2822858	2822886	8421504	2	5,20	0,8	g	350042896800000003	1-31		17021164	10.1523/JNEUROSCI.0819-06.2006	0270-6474	The Journal of Neuroscience	Starvation Induces cAMP Response Element-Binding Protein-Dependent Gene Expression through Octopamine–Gq Signaling in Caenorhabditis elegans	Suo	2006	7		
606	chrII	2861560	2861911	3500415441	48		2861560	2861911	8421504	3	21,22,5	0,49,346	g	350041544100000117,350041544100000388,350041544100000112	0-78,0-78,0-78						Genomic tRNA Database: Caenorhabditis brenneri (WUGSC 4.0 Jan 2007)	gtrnadb.ucsc.edu	0	0		
606	chrII	2881064	2881088	3500141011	23		2881064	2881088	8421504	2	12,11	0,13	g	350014101100000053,350014101100000052	0-23,19-42						UNIVERSIDADE DE SÃO PAULO	www.teses.usp.br	0	0		
607	chrII	2889107	2894584	3500160947	1990		2889107	2894584	8421504	21	44,58,94,443,347,48,55,56,55,55,56,54,56,54,56,55,55,177,57,55,60	0,46,106,1980,3886,4407,4457,4517,4577,4637,4697,4758,4817,4877,4936,4997,5057,5117,5297,5357,5417	c,g	350016094700000059,350016094700000058,350016094700000057,350016094700000082,350016094700000014	0-1049,149-3993,0-995,5-25,5-25						US Patent # 7,442,501. SQV nucleic acids and polypeptides - Patents.com	www.patents.com	0	0		
607	chrII	2889289	2897100	3500089920	161		2889289	2897100	8421504	7	18,8,26,26,28,27,28	0,1798,1911,3992,4977,7494,7783	c,g	350008992000000011,350008992000000010,350008992000000010,350008992000000005,350008992000000002,350008992000000002,350008992000000008,350008992000000008,350008992000000004,350008992000000004	0-26,0-26,0-26,18-44,4-32,4-32,0-27,0-27,0-28,0-28			10.1091/mbc.E05-05-0472		Molecular Biology of the Cell	The Terminal Phase of Cytokinesis in the Caenorhabditis elegans Early Embryo Requires Protein Glycosylation	Huan	2005	0		
607	chrII	2891200	2897100	3500029287	135		2891200	2897100	8421504	5	26,26,28,27,28	0,2081,3066,5583,5872	c,g	350002928700000010,350002928700000010,350002928700000005,350002928700000005,350002928700000002,350002928700000002,350002928700000008,350002928700000008,350002928700000004,350002928700000004	0-26,0-26,18-44,18-44,4-32,4-32,0-27,0-27,0-28,0-28		15987734	10.1091/mbc.E05-05-0472	1059-1524	Molecular Biology of the Cell	The Terminal Phase of Cytokinesis in the Caenorhabditis elegans Early Embryo Requires Protein Glycosylation	Wang	2005	5		
607	chrII	2900946	2942121	3500196959	41		2900946	2942121	8421504	3	9,11,21	0,10,41154	c	350019695900000252,350019695900000253,350019695900001833	23-43,21-41,1-22						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
607	chrII	2904619	2904643	3500029989	23		2904619	2904643	8421504	2	19,4	0,20	g	350002998900000168,350002998900000167	3-26,16-39						ACID-CLEVABLE LINKERS EXHIBITING ALTERED RATES OF ACID HYDROLYSIS - Patent application	www.faqs.org	0	0		
607	chrII	2930988	2931015	3500200895	25		2930988	2931015	8421504	2	5,20	0,7	g	350020089500000070	6-42						 Chemoreceptors In Plant Parasitic Nematodes 	www.docstoc.com	0	0		
607	chrII	2935334	2935358	3500312991	24		2935334	2935358	8421504	1	24	0	c	350031299100000000	0-24						<HTML> <HEAD> <TITLE>CSM cDNA CHM634   
Homology CHM634 vs DNA
 
 Q	iol.tsukuba.ac.jp	0	0		
607	chrII	2957514	2957546	3500040919	27		2957514	2957546	8421504	3	11,4,12	0,15,20	g	350004091900000975	21-48						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
607	chrII	2990820	2990849	3500266829	24		2990820	2990849	8421504	3	12,6,6	0,16,23	g	350026682900000376	6-34						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
608	chrII	3034953	3054599	3500354353	41		3034953	3054599	8421504	4	6,16,13,6	0,7,19625,19640	g	350035435300000084,350035435300000090	1-25,0-19						 BLAST Search Results  SAMTools -> IGV - SEQanswers	seqanswers.com	0	0		
610	chrII	3301030	3301057	3500083706	23		3301030	3301057	8421504	2	13,10	0,17	g	350008370600000478	0-26						Preparation of alpha-ketopimelic acid	Raedemakers-Franken	2011	0		
610	chrII	3306154	3307507	3500101197	747		3306154	3307507	8421504	3	353,298,96	0,486,1257	c,g	350010119700000004,350010119700000003,350010119700000020,350010119700000020	0-747,464-718,0-24,0-24						RNATargetsandSpecificityofStaufen,aDouble-stranded RNA-bindingProteinin Caenorhabditiselegans S	.biochem.wisc.edu	0	0		
610	chrII	3313581	3323291	3500096485	43		3313581	3323291	8421504	2	23,20	0,9690	g	350009648500000564,350009648500000230	6-38,1-24						METHODS OF MODULATING AND IDENTIFYING AGENTS THAT MODULATE INTRACELLULAR CALCIUM - Patent application	www.faqs.org	0	0		
610	chrII	3331546	3331573	3500017185	25		3331546	3331573	8421504	2	9,16	0,11	c	350001718500000043	0-25							cropwiki.irri.org	0	0		
610	chrII	3367524	3367895	3500359712	26		3367524	3367895	8421504	3	7,3,16	0,11,355	c	350035971200001085	18-47						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
610	chrII	3383351	3383374	3500352303	23		3383351	3383374	8421504	1	23	0	c	350035230300000642	11-34						Anti-bacterial methods and materials	Holden	2000	0		
610	chrII	3383351	3383374	3500003185	23		3383351	3383374	8421504	1	23	0	c	350000318500000660	11-34						Anti-bacterial methods and materials	Holden	2000	0		
610	chrII	3391522	3391548	3500120987	25		3391522	3391548	8421504	2	9,16	0,10	c,g	350012098700000223,350012098700000223	0-28,0-28						MOLECULAR ANALYSIS OF VIBRIO VULNIFICUS PHASE VARIANTS AND CHARACTERIZATION OF A NEW BIOFILM-PROFICIENT RUGOSE PHENOTYPE	etd.lsu.edu	0	0		
610	chrII	3393500	3393526	3500295844	23		3393500	3393526	8421504	2	16,7	0,19	g	350029584400002045	8-39						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
610	chrII	3394986	3395025	3500228395	32		3394986	3395025	8421504	3	7,5,20	0,12,19	c	350022839500000018	0-32						 Complet list of 1hxt hssp file Complet list of	cnptia.embrapa.br	0	0		
611	chrII	3440621	3461776	3500057006	40		3440621	3461776	8421504	3	21,4,15	0,21135,21140	g	350005700600000377,350005700600000971	2-23,1-20						<HTML><HEAD><meta http-equiv="Content-Type" content="text/html; charset=ISO-8859-1"><LINK REL="SHORT	.economie.fgov.be	0	0		
611	chrII	3457610	3457637	3500364681	23		3457610	3457637	8421504	3	11,7,5	0,13,22	g	350036468100000010	8-31		18953406	10.1371/journal.pone.0003521	1932-6203	PLOS ONE	PLOS ONE: OsLIC, a Novel CCCH-Type Zinc Finger Protein with Transcription Activation, Mediates Rice Architecture via Brassinosteroids Signaling	Wang	2008	4		
611	chrII	3457610	3457637	3500117929	23		3457610	3457637	8421504	3	11,7,5	0,13,22	g	350011792900000010	8-31		18953406	10.1371/journal.pone.0003521		PLoS ONE	OsLIC, a Novel CCCH-Type Zinc Finger Protein with Transcription Activation, Mediates Rice Architecture via Brassinosteroids Signaling	Lei	2008	0		
76	chrII	3463450	3546842	3500241785	180		3463450	3546842	8421504	8	20,20,23,24,27,23,22,21	0,798,17201,24985,27659,36964,38384,83371	c,g	350024178500000008,350024178500000009,350024178500000009,350024178500000010,350024178500000012,350024178500000012,350024178500000011,350024178500000006,350024178500000006,350024178500000007,350024178500000007,350024178500000005	0-20,0-20,0-20,0-23,0-24,0-24,0-28,0-23,0-23,0-22,0-22,0-21		15254247	10.1128/MCB.24.15.6811-6823.2004	0270-7306	Molecular and Cellular Biology	SMU-2 and SMU-1, Caenorhabditis elegans Homologs of Mammalian Spliceosome-Associated Proteins RED and fSAP57, Work Together To Affect Splice Site Choice	Spartz	2004	6		
611	chrII	3501907	3501933	3500063158	23		3501907	3501933	8421504	2	9,14	0,12	g	350006315800000101	1-24						Method for Producing Polyunsaturated C20 and C22 Fatty Acids with at Least Four Double Bonds in Transgenic Plants - Patent application	www.faqs.org	0	0		
611	chrII	3515451	3515475	3500344389	23		3515451	3515475	8421504	2	4,19	0,5	c	350034438900001263	13-36						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
611	chrII	3515451	3515475	3500190843	23		3515451	3515475	8421504	2	4,19	0,5	c	350019084300001235	13-36						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
612	chrII	3553838	3554547	3500335243	42		3553838	3554547	8421504	2	20,22	0,687	c,g	350033524300000000,350033524300000000,350033524300000003,350033524300000001	20-40,20-40,27-49,20-42		20964796	10.1111/j.1365-2443.2010.01451.x	1365-2443	Genes to Cells	Caenorhabditis elegans ortholog of the p24/p22 subunit, DNC-3, is essential for the formation of the dynactin complex by bridging DNC-1/p150Glued and DNC-2/dynamitin - Terasawa - 2010 - Genes to Cells - Wiley Online Library	Terasawa	2010	0		
612	chrII	3553838	3554547	3500191007	42		3553838	3554547	8421504	2	20,22	0,687	c,g	350019100700000000,350019100700000000,350019100700000001,350019100700000003	20-40,20-40,20-42,27-49						Caenorhabditis elegans ortholog of the p24/p22 subunit, DNC-3, is essential for the formation of the dynactin complex by bridging DNC-1/p150(Glued) and DNC-2/dynamitin.	.biomedsearch.com	0	0		
612	chrII	3614995	3615019	3500297988	23		3614995	3615019	8421504	2	19,4	0,20	g	350029798800001764	1-26						Plate Row Column ID Name Opt1 Opt2 1 A 1 b0014 dnaK GGGTAAAATAATTGGTATCGACCTGGGTACTACCAACTCTTGTGTAG	ology.ualberta.ca	0	0		
612	chrII	3614995	3615019	3500148667	23		3614995	3615019	8421504	2	19,4	0,20	g	350014866700006012	1-26						b0416_E100000408_80_PC 1 1 1 b0416_E100000408_80_PC nusB_b0416_PC GGATTCCGCAGTACGAACTGACTACACGTAGCCA	.bio.davidson.edu	0	0		
612	chrII	3626632	3626664	3500395012	28		3626632	3626664	8421504	2	14,14	0,18	c	350039501200000232	1-32							.biomedsearch.com	0	0		
612	chrII	3626632	3626664	3500261713	28		3626632	3626664	8421504	2	14,14	0,18	c	350026171300000000	1-32						Peanut (Arachis hypogaea) : marker : list	rker.kazusa.or.jp	0	0		
612	chrII	3630746	3630773	3500430545	23		3630746	3630773	8421504	3	13,6,4	0,16,23	c	350043054500000000	7-30		10837348			American Journal of Physiology - Cell Physiolog	An electrogenic Na+- cotransporter (NBC) with a novel COOH-terminus, cloned from rat brain	Bevensee	2000	0		
613	chrII	3672330	3672356	3500241719	23		3672330	3672356	8421504	3	12,4,7	0,14,19	g	350024171900000041	9-32						RNAI FOR THE CONTROL OF INSECTS AND ARACHNIDS - Patent application	www.faqs.org	0	0		
613	chrII	3682437	3682462	3500342384	23		3682437	3682462	8421504	2	15,8	0,17	g	350034238400000316,350034238400000317,350034238400000315,350034238400000318	8-32,8-32,8-32,8-32						Compositions and methods for inhibiting expression of a gene from the JC virus	Tan	2007	0		
613	chrII	3682437	3682462	3500323036	23		3682437	3682462	8421504	2	15,8	0,17	g	350032303600000317,350032303600000316,350032303600000315,350032303600000314	8-32,8-32,8-32,8-32						COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF A GENE FROM THE JC VIRUS - Patent application	www.faqs.org	0	0		
613	chrII	3689674	3689700	3500109093	25		3689674	3689700	8421504	2	21,4	0,22	c	350010909300000313	5-30						Entwicklung und Evaluierung eines Resistenz- Microarrays für die Detektion von Resistenzdeterminanten in Bakterien aus Kläranlagen	www.lanuv.nrw.de	0	0		
614	chrII	3812838	3826341	3500449315	40		3812838	3826341	8421504	4	14,5,14,7	0,15,13481,13496	c,g	350044931500000471,350044931500000412	14-33,14-42						US Patent # 7,491,698. Mixing and matching TC proteins for pest control - Patents.com	www.patents.com	0	0		
614	chrII	3812952	3812978	3500271831	23		3812952	3812978	8421504	2	9,14	0,12	c,g	350027183100000001,350027183100000001	2-25,2-25						Perfil farmacogenético en los pacientes con cáncer colorrectal avanzado tratados con quimioterapia FOLFOX-4 de primera línea	jco.ascopubs.org	0	0		
614	chrII	3827492	3827515	3500359288	23		3827492	3827515	8421504	1	23	0	c	350035928800000050	9-32						US Patent # 6,943,235. Transmembrane protein expressed in prostate cancer - Patents.com	www.patents.com	0	0		
614	chrII	3835328	3874671	3500196072	40		3835328	3874671	8421504	5	4,13,2,15,6	0,5,65,39318,39337	c	350019607200001157,350019607200001366	21-40,24-45						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
614	chrII	3854882	3903502	3500454148	41		3854882	3903502	8421504	4	8,14,13,6	0,11,48596,48614	g	350045414800002120,350045414800002230	1-24,10-29						Rank Transcription unit Names NtcA site Downstream of ntcA site Position of ntcA site Score -10 like	coitweb.uncc.edu	0	0		
614	chrII	3867392	3867415	3500023023	23		3867392	3867415	8421504	1	23	0	c,g	350002302300000028,350002302300000028	5-33,5-33						Methods for producing polypeptide-tagged collections and capture systems containing the tagged polypeptides	Ault-riche	2003	0		
614	chrII	3893525	3893555	3500443095	24		3893525	3893555	8421504	3	11,6,7	0,13,23	g	350044309500000000	0-25						Repressor-mediated tissue-specific gene expression in plants - Patent # 7491811 - PatentGenius	.patentgenius.com	0	0		
614	chrII	3909967	3910370	3500424753	40		3909967	3910370	8421504	2	20,20	0,383	c,g	350042475300000015,350042475300000015,350042475300000014,350042475300000014	0-20,0-20,0-20,0-20			10.1016/j.ydbio.2006.10.013		Developmental biology	The 14-3-3 protein FTT-2 regulates DAF-16 in Caenorhabditis elegans	Ji	2007	0		
615	chrII	3950132	3950159	3500096011	23		3950132	3950159	8421504	2	7,16	0,11	c	350009601100000181	0-23						<Html><Title> Complet list of 2vex hssp file Complet list of	cnptia.embrapa.br	0	0		
615	chrII	3965189	3965215	3500194706	25		3965189	3965215	8421504	2	13,12	0,14	c	350019470600000004	0-25						SITE-SPECIFIC ATTACHMENT OF NANOPARTICLES TO DNA TEMPLATES	www.ornl.gov	0	0		
615	chrII	3967409	3967434	3500295352	23		3967409	3967434	8421504	2	8,15	0,10	c	350029535200000012	4-33						Resistin-Like Molecule β Is Abundantly Expressed in Foam Cells and Is Involved in Arterioscler Thromb Vasc Biol.€2013;33:1986-1993; originally published online May 23, 2013;	ww3.med.unipmn.it	0	0		
615	chrII	3968008	3968042	3500223858	32		3968008	3968042	8421504	3	22,5,5	0,23,29	g	350022385800000513	3-35							biomedcentral.com	0	0		
615	chrII	3982321	3982345	3500447355	24		3982321	3982345	8421504	1	24	0	g	350044735500000000	0-24						Two Pleiotropic Classes of daf-2 Mutation Affect Larval Arrest, Adult Behavior, Reproduction and Longevity in Caenorhabditis elegans	www.genetics.org	0	0		
615	chrII	3983890	3986089	3500272094	69		3983890	3986089	8421504	2	66,3	0,2196	p	350027209400015035	0-69						DNA-binding properties andsecondary structural model hepatocyte nuclearfactor 3/fork domain	www.pnas.org	0	0		
615	chrII	3998504	3998540	3500131692	27		3998504	3998540	8421504	3	6,4,17	0,11,19	g	350013169200000003	1-28						BMC Genomics BioMed Central	biomedcentral.com	0	0		
615	chrII	4006792	4006822	3500091488	26		4006792	4006822	8421504	3	7,7,12	0,9,18	g	350009148800000259	4-31						US Patent # 6,376,210. Methods and compositions for assaying analytes - Patents.com	www.patents.com	0	0		
615	chrII	4006792	4006822	3500085562	26		4006792	4006822	8421504	3	7,7,12	0,9,18	g	350008556200000267	4-31						Methods and compositions for assaying analytes	Yuan	1999	0		
616	chrII	4112566	4120355	3500053221	137		4112566	4120355	8421504	2	41,96	0,7693	g	350005322100000000	0-137		22363657	10.1371/journal.pone.0031499		PLoS ONE	RHGF-2 Is an Essential Rho-1 Specific RhoGEF that binds to the Multi-PDZ Domain Scaffold Protein MPZ-1 in Caenorhabditis elegans	Li	2012	0		
616	chrII	4134692	4134718	3500366782	26		4134692	4134718	8421504	1	26	0	c	350036678200000126	16-42						US Patent # 7,446,239. SCA2 knockout animal and methods of use - Patents.com	www.patents.com	0	0		
617	chrII	4197073	4197100	3500131108	23		4197073	4197100	8421504	2	12,11	0,16	c	350013110800000486	4-27						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
617	chrII	4218789	4218817	3500306261	24		4218789	4218817	8421504	2	15,9	0,19	g	350030626100000246	16-40						<Html><Title> Complet list of 2b6p hssp file Complet list of	cnptia.embrapa.br	0	0		
617	chrII	4241296	4241341	3500234236	33		4241296	4241341	8421504	4	8,5,14,6	0,13,23,39	g	350023423600000198,350023423600000248,350023423600000242,350023423600000188	8-41,2-35,14-47,16-49						<!DOCTYPE HTML PUBLIC "-//IETF//DTD HTML//EN"> <HTML><HEAD><TITLE>BLAST results for CNE CRCNEAC00044	or.nimr.mrc.ac.uk	0	0		
617	chrII	4264228	4264255	3500266829	24		4264228	4264255	8421504	2	13,11	0,16	g	350026682900002556	2-41						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
617	chrII	4320786	4320809	3500178220	23		4320786	4320809	8421504	1	23	0	g	350017822000000764	19-42						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
617	chrII	4321780	4321805	3500005213	23		4321780	4321805	8421504	2	7,16	0,9	c	350000521300000292	7-30						<Html><Title> Complet list of 1a5c hssp file Complet list of	cnptia.embrapa.br	0	0		
618	chrII	4417861	4418575	3500428045	40		4417861	4418575	8421504	2	20,20	0,694	c,g	350042804500000004,350042804500000004,350042804500000005,350042804500000005	0-20,0-20,0-20,0-20						PHOSPHORYLATION OF α-SYNUCLEIN AT SER129 REDUCES NEURONAL DYSFUNCTION BY LOWERING ITS MEMBRANE-BINDING PROPERTY IN CAENORHABDITIS ELEGANS	www.jbc.org	0	0		
618	chrII	4426123	4426151	3500266829	25		4426123	4426151	8421504	2	13,12	0,16	c	350026682900002138	9-34						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
618	chrII	4426123	4426151	3500141365	25		4426123	4426151	8421504	2	13,12	0,16	c	350014136500000644	10-35						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
618	chrII	4438999	4439073	3500241381	24		4438999	4439073	8421504	3	7,2,15	0,56,59	c	350024138100002459	12-36						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
619	chrII	4487200	4487223	3500241875	23		4487200	4487223	8421504	1	23	0	g	350024187500000401,350024187500000396	10-42,15-35					Patent	Enhancement of influenza gene expression (Patent US:8227188)	Fougerolles	2012	0		
619	chrII	4487200	4487223	3500070088	23		4487200	4487223	8421504	1	23	0	g	350007008800000401,350007008800000396	10-42,15-35						RNAI INHIBITION OF INFLUENZA VIRUS REPLICATION	Fougerolles	2006	0		
619	chrII	4516031	4516055	3500005682	24		4516031	4516055	8421504	1	24	0	g	350000568200000004	0-24						PDF receptor signaling in Caenorhabditis elegans modulates locomotion and egg-laying. - ResearchGate	.researchgate.net	0	0		
619	chrII	4521207	4522368	3500455810	41		4521207	4522368	8421504	4	16,3,2,20	0,68,822,1141	c	350045581000000008,350045581000000009	0-19,0-22						Direct in vivo cellular reprogramming involves transition through discrete, non-pluripotent steps	ev.biologists.org	0	0		
619	chrII	4521207	4522368	3500122254	41		4521207	4522368	8421504	4	16,3,2,20	0,68,822,1141	c	350012225400000008,350012225400000009	0-19,0-22		21389048	10.1242/dev.063115	0950-1991	Development	Direct in vivo cellular reprogramming involves transition through discrete, non-pluripotent steps	Richard	2011	7		
619	chrII	4521665	4521693	3500141880	28		4521665	4521693	8421504	1	28	0	c,g	350014188000000059,350014188000000059	53-81,53-81						Caenorhabditis elegans: Molecular Genetics and Development	www.scribd.com	0	0		
619	chrII	4540181	4540208	3500353690	24		4540181	4540208	8421504	2	5,19	0,8	c	350035369000000019	5-29						An Optimized Set of Human Telomere Clones for Studying Telomere Integrity and Architecture	enetics.emory.edu	0	0		
619	chrII	4540181	4540208	3500171190	24		4540181	4540208	8421504	2	5,19	0,8	c	350017119000000084	5-29							shfieldclinic.org	0	0		
619	chrII	4558090	4558160	3500148414	24		4558090	4558160	8421504	3	16,5,3	0,18,67	c	350014841400000791	0-24						Development of novel anti-microbial agents based on bacteriophage genomics	Pelletier	1999	0		
619	chrII	4565022	4565084	3500415441	62		4565022	4565084	8421504	1	62	0	g	350041544100000000	0-62						Genomic tRNA Database: Caenorhabditis brenneri (WUGSC 4.0 Jan 2007)	gtrnadb.ucsc.edu	0	0		
619	chrII	4565060	4565084	3500235647	24		4565060	4565084	8421504	1	24	0	g	350023564700000019,350023564700000020,350023564700000012,350023564700000010	0-24,0-24,0-23,0-22						NEUROPROTECTIVE MOLECULES AND METHODS OF TREATING NEUROLOGICAL DISORDERS AND INDUCING STRESS GRANULES - Patent application	www.faqs.org	0	0		
77	chrII	4581421	4589387	3500241788	47		4581421	4589387	8421504	4	5,22,8,12	0,6,7944,7954	g	350024178800004225,350024178800002884	16-43,21-41						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
619	chrII	4582807	4583018	3500199761	46		4582807	4583018	8421504	2	21,25	0,186	g	350019976100000005,350019976100000003	0-21,0-25			10.1186/1471-2164-8-403	1471-2164	BMC Genomics	Poly-G/poly-C tracts in the genomes of Caenorhabditis	Zhao	2007	4		
77	chrII	4587189	4590509	3500282684	67		4587189	4590509	8421504	2	25,42	0,3278	c,g	350028268400000008,350028268400000008,350028268400000004,350028268400000004,350028268400000003,350028268400000003,350028268400000009	11-36,11-36,0-45,0-45,0-45,0-45,10-37						MATURATION IN CAENORHABDITIS ELEGANS	ry.vanderbilt.edu	0	0		
620	chrII	4590812	4590839	3500113587	24		4590812	4590839	8421504	2	17,7	0,20	g	350011358700000000	5-29						Dan Bingham Michael Schwartz	andgame.idaho.gov	0	0		
620	chrII	4595614	4629535	3500260606	39		4595614	4629535	8421504	4	14,6,6,13	0,15,33898,33908	c,g	350026060600003450,350026060600000737	21-41,0-19						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
620	chrII	4610957	4610982	3500030766	23		4610957	4610982	8421504	2	9,14	0,11	c	350003076600002956	19-42						>vs_0 TACCAACAGCTACTCCCATGCAAAGCACTTTCTTAAGCTGGAATTTGACCATAGCCTTAGT >vs_1 AGTAACCGCGATTCCAACACAAA	biomedcentral.com	0	0		
620	chrII	4653441	4653468	3500397262	23		4653441	4653468	8421504	2	15,8	0,19	c	350039726200000126	11-34						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
620	chrII	4692342	4692369	3500443211	23		4692342	4692369	8421504	2	10,13	0,14	c	350044321100001173	10-33						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
620	chrII	4699213	4700314	3500404771	41		4699213	4700314	8421504	2	19,22	0,1079	c,g	350040477100000007,350040477100000007,350040477100000008	0-19,0-19,0-22		15767665	10.1128/MCB.25.7.2583-2592.2005	0270-7306	Molecular and Cellular Biology	HCP-4/CENP-C Promotes the Prophase Timing of Centromere Resolution by Enabling the Centromere Association of HCP-6 in Caenorhabditis elegans	Moore	2005	6		
620	chrII	4702227	4702250	3500277233	23		4702227	4702250	8421504	1	23	0	c	350027723300000005	0-23		19233156			Developmental Biology	Functional redundancy of two C. elegans homologs of the histone chaperone Asf1 in germline DNA replication.	Grigsby	2009	0		
620	chrII	4710879	4710902	3500057948	23		4710879	4710902	8421504	1	23	0	c	350005794800000101	21-45						Nucleic Acid Molecules Encoding Fatty Acid Desaturase Genes from Plants and Methods of Use - Patent application	www.faqs.org	0	0		
621	chrII	4718749	4719177	3500126539	56		4718749	4719177	8421504	2	51,5	0,423	g	350012653900000000	0-56						ChIP-Seq data analysis workshop	cb.wikispaces.com	0	0		
621	chrII	4722283	4722309	3500118398	23		4722283	4722309	8421504	2	13,10	0,16	g	350011839800002434	22-45						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
621	chrII	4723165	4723192	3500049883	23		4723165	4723192	8421504	2	5,18	0,9	g	350004988300000005	0-23						cGMP signalling via CNP-Npr2-cGKI, and its role in axonal branching during embryonic development	diss.fu-berlin.de	0	0		
621	chrII	4738743	4738773	3500167682	24		4738743	4738773	8421504	3	5,12,7	0,6,23	g	350016768200000736	16-47						METHODS AND COMPOSITIONS FOR TARGETED POLYNUCLEOTIDE MODIFICATION - Patent application	www.faqs.org	0	0		
621	chrII	4739371	4739394	3500242592	23		4739371	4739394	8421504	1	23	0	c,g	350024259200000035,350024259200000035	0-23,0-23						Caenorhabditis elegansban - HOX kontroll?	teo.elte.hu	0	0		
621	chrII	4743713	4744068	3500461285	40		4743713	4744068	8421504	2	19,21	0,334	c,g	350046128500000015,350046128500000015,350046128500000016,350046128500000016	0-19,0-19,0-21,0-21						KRUPPEL-LIKE FACTORS AND FAT REGULATION - Patent application	www.faqs.org	0	0		
621	chrII	4769590	4769613	3500359166	23		4769590	4769613	8421504	1	23	0	g	350035916600000006	9-32			10.1111/j.1365-2958.2007.05842.x	1365-2958	Molecular Microbiology	In vitro transposition of ISY100, a bacterial insertion sequence belonging to the Tc1/mariner family - Feng - 2007 - Molecular Microbiology - Wiley Online Library	Feng	2007	0		
621	chrII	4799079	4799291	3500403618	23		4799079	4799291	8421504	3	5,7,11	0,191,201	c	350040361800000038	8-33						 <HTML> <HEAD><TITLE>aa?a(r)a<<a1aa1/4a1/4aa!aaaa1/4a(r)aeSSe eoa1/4a - c1ei1/4i1/4i1/4i1/4	www.j-tokkyo.com	0	0		
621	chrII	4802570	4802598	3500273193	23		4802570	4802598	8421504	2	10,13	0,15	g	350027319300000026	0-23			10.1128/JB.184.6.1722-1732.2002		Journal of Bacteriology	Rubredoxins Involved in Alkane Oxidation	Jan	2002	0		
621	chrII	4812595	4812619	3500069576	23		4812595	4812619	8421504	2	16,7	0,17	g	350006957600000174	3-27						Recombinant infectious bovine rhinotracheitis virus s-ibr-052 and uses thereof	Cochran	1995	0		
621	chrII	4815471	4815496	3500128449	23		4815471	4815496	8421504	2	6,17	0,8	c	350012844900000139	15-39						<Html><Title> Complet list of 1hak hssp file Complet list of	cnptia.embrapa.br	0	0		
621	chrII	4832553	4832584	3500133339	23		4832553	4832584	8421504	3	6,12,5	0,11,26	g	350013333900000039	4-27						Accession Sense primer Anti-sense primer CEBPA NM 004364 CTTGTGCCTTGGAAATGCAA GCTGTAGCCTCGGGAAGGA	biomedcentral.com	0	0		
622	chrII	4867938	4867964	3500321117	23		4867938	4867964	8421504	3	5,4,14	0,7,12	g	350032111700000257	10-33						<Html><Title> Complet list of 1pa1 hssp file Complet list of	cnptia.embrapa.br	0	0		
622	chrII	4883094	4883223	3500450866	129		4883094	4883223	8421504	1	129	0	p	350045086600015006	0-129						 算法设计与分析实验题目_震任风_百度空间	hi.baidu.com	0	0		
622	chrII	4883094	4883223	3500430676	129		4883094	4883223	8421504	1	129	0	p	350043067600015006	0-129						Pairwise sequence alignment	.uni-tuebingen.de	0	0		
622	chrII	4883094	4883223	3500019961	129		4883094	4883223	8421504	1	129	0	p	350001996100015008	0-129						PPT – Bioinformatics PowerPoint presentation | free to download 	www.powershow.com	0	0		
622	chrII	4890146	4890174	3500260606	24		4890146	4890174	8421504	2	12,12	0,16	c	350026060600002275	9-33						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
622	chrII	4892343	4893137	3500117548	64		4892343	4893137	8421504	3	21,21,22	0,157,772	c	350011754800000009,350011754800000008,350011754800000001	21-42,0-21,18-40						确定基因表达概况… (Translated to Chinese) | JoVE Video	www.jove.com	0	0		
622	chrII	4893115	4898929	3500089318	42		4893115	4898929	8421504	2	22,20	0,5794	g	350008931800000001,350008931800000007	18-40,20-40						La determinación de perfiles genéticos de expresión en C.… (Translated to Spanish) | JoVE Video	www.jove.com	0	0		
622	chrII	4903917	4903946	3500068680	24		4903917	4903946	8421504	2	13,11	0,18	g	350006868000000065	7-38						Neue gewebsspezifische calpaine, ihre herstellung und verwendung	Boehm	1999	0		
622	chrII	4908508	4908536	3500241381	23		4908508	4908536	8421504	3	5,7,11	0,7,17	g	350024138100003067	4-27						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
622	chrII	4909628	4910791	3500148659	654		4909628	4910791	8421504	3	360,243,51	0,540,1112	p	350014865900015058,350014865900015063,350014865900015070,350014865900015073	6-186,0-180,0-177,0-117						50 human secreted proteins	Komatsoulis	2002	0		
622	chrII	4909628	4910791	3500068672	654		4909628	4910791	8421504	3	360,243,51	0,540,1112	p	350006867200015058,350006867200015063,350006867200015070,350006867200015073	6-186,0-180,0-177,0-117						50 human secreted proteins	Komatsoulis	2000	0		
622	chrII	4912077	4912103	3500239846	23		4912077	4912103	8421504	3	5,12,6	0,6,20	c	350023984600000371	5-28					Patent	Manipulation of protoporphyrinogen oxidase enzyme activity in eukaryotic organisms (Patent CN:100432229)	E*R*Wa De 	2008	0		
622	chrII	4917924	4922264	3500249126	25		4917924	4922264	8421504	3	6,11,8	0,10,4332	c	350024912600000007,350024912600000005	0-25,0-25					Patent	Thermostable DNA polymerases (Patent US:5885813)	Cunniff	1999	0		
622	chrII	4931975	4932001	3500272104	24		4931975	4932001	8421504	2	17,7	0,19	c,g	350027210400000000,350027210400000000,350027210400000014,350027210400000014	0-28,0-28,0-27,0-27						Inducible adeno -associated virus vector mediated transgene ablation system	Wilson	2013	0		
622	chrII	4943255	4943281	3500213845	24		4943255	4943281	8421504	2	6,18	0,8	c	350021384500000024	0-24					Patent	Construct capable of release in closed circular form from a larger nucleotide sequence permitting site specific expression and/or developmentally regulated expression of selected genetic sequences (Patent US:7863430)	Becker	2011	0		
622	chrII	4943255	4943281	3500132904	24		4943255	4943281	8421504	2	6,18	0,8	c	350013290400000104,350013290400000010	0-24,0-24						Construct capable of release in closed circular form from larger nucleotide sequence permitting site specific expression and/or developmentally regulated expression of genetic sequences	R*M*Ha Ding 	2003	0		
622	chrII	4943255	4943281	3500132398	24		4943255	4943281	8421504	2	6,18	0,8	c	350013239800000092,350013239800000024	0-24,0-24					Patent	A construct capable of release in closed circular form from a larger nucleotide sequence permitting site specific expression and/or developmentally regulated expression of selected genetic sequences (Patent EP:1282697)	Becker	2007	0		
622	chrII	4943255	4943281	3500096554	24		4943255	4943281	8421504	2	6,18	0,8	c	350009655400000006	0-24						A construct capable of release in closed circular form from a larger nucleotide sequence permitting site specific expression and/or developmentally regulated expression of selected genetic sequences	Becker	2003	0		
622	chrII	4943255	4943281	3500043705	24		4943255	4943281	8421504	2	6,18	0,8	c	350004370500000006	0-24						A construct capable of release in closed circular form from a larger nucleotide sequence permitting site specific expression and/or developmentally regulated expression of selected genetic sequences	Becker	2004	0		
622	chrII	4950044	4951245	3500246027	41		4950044	4951245	8421504	2	21,20	0,1181	g	350024602700000012,350024602700000013	18-39,19-39						Use of eukaryotic genes affecting spindle formation or microtubule function during cell division for diagnosis and treatment of proliferative diseases	Echeverri	2007	0		
622	chrII	4950044	4951245	3500052757	41		4950044	4951245	8421504	2	21,20	0,1181	g	350005275700000012,350005275700000013	18-39,19-39					Patent	Use of eukaryotic genes affecting spindle formation or microtubule function during cell division for diagnosis and treatment of proliferative diseases (Patent US:7479369)	Echeverri	2009	0		
623	chrII	4983876	4983901	3500289629	23		4983876	4983901	8421504	2	7,16	0,9	g	350028962900000003,350028962900000106	11-34,11-34						METHOD OF IDENTIFYING TRANSMEMBRANE PROTEIN-INTERACTING COMPOUNDS - Patent application	www.faqs.org	0	0		
623	chrII	4989732	4994699	3500090880	115		4989732	4994699	8421504	4	23,22,47,23	0,1334,1642,4944	c,g	350009088000000001,350009088000000014,350009088000000014,350009088000000012,350009088000000012,350009088000000010,350009088000000010,350009088000000008,350009088000000008,350009088000000006,350009088000000006,350009088000000004,350009088000000000,350009088000000000	0-23,10-32,10-32,10-38,10-38,13-41,13-41,12-40,12-40,12-43,12-43,0-23,0-23,0-23		20855569	10.1534/genetics.110.121541		Genetics	The Role of eIF1 in Translation Initiation Codon Selection in Caenorhabditis elegans	Lisa	2010	0		
623	chrII	4994369	4994740	3500384752	261		4994369	4994740	8421504	3	54,126,81	0,97,290	p	350038475200015004,350038475200015006	0-180,0-81						48 human secreted proteins	Komatsoulis	2002	0		
623	chrII	4994369	4994740	3500375425	261		4994369	4994740	8421504	3	54,126,81	0,97,290	p	350037542500015004,350037542500015006	0-180,0-81						48 human secreted proteins	Komatsoulis	2000	0		
623	chrII	4997278	4997303	3500435156	24		4997278	4997303	8421504	2	4,20	0,5	c,g	350043515600000015,350043515600000015	9-43,9-43						Subtilin variant of enhanced stability and activity	Hansen	1992	0		
623	chrII	4999516	5002236	3500063443	38		4999516	5002236	8421504	2	19,19	0,2701	c,g	350006344300000002,350006344300000003,350006344300000003	19-38,19-38,19-38				0021-9533	Journal of Cell Science	Rho-binding kinase (LET-502) and myosin phosphatase (MEL-11) regulate cytokinesis in the early Caenorhabditis elegans embryo	Piekny	2002	6		
623	chrII	5022360	5022389	3500287953	25		5022360	5022389	8421504	3	5,14,6	0,8,23	g	350028795300000900	7-32						Method For Increasing Pathogen Resistance In Transgenic Plants - Patent application	www.faqs.org	0	0		
623	chrII	5025795	5026911	3500052759	41		5025795	5026911	8421504	2	21,20	0,1096	g	350005275900000002,350005275900000003	22-43,23-43						1 Regulation of anoxic death in Caenorhabditis elegans	www.genetics.org	0	0		
623	chrII	5031473	5031532	3500153376	59		5031473	5031532	8421504	1	59	0	c	350015337600000000	38-97						cDNA Sequence 1	home.sandiego.edu	0	0		
623	chrII	5032074	5032100	3500453932	23		5032074	5032100	8421504	2	8,15	0,11	g	350045393200000000	3-26						Methods for identifying small molecules that modulate premature translation termination and nonsense mediated mRNA decay - US Patent 7927791 Description	ww.patentstorm.us	0	0		
623	chrII	5032074	5032100	3500375014	23		5032074	5032100	8421504	2	8,15	0,11	g	350037501400000000	3-26						Methods for identifying small molecules that modulate premature translation termination and nonsense mediated mrna decay	Welch	2003	0		
623	chrII	5046909	5046939	3500403677	25		5046909	5046939	8421504	3	4,6,15	0,5,15	g	350040367700000011	5-30						ScienceDirect.com - Neuron - Identification of Maxillary Factor, a Maxillary Process–Derived Chemoattractant for Developing Trigeminal Sensory Axons	sciencedirect.com	0	0		
9	chrII	5050638	5492467	3500415780	181		5050638	5492467	8421504	3	61,60,60	0,441276,441769	g	350041578000000000	297-478							home.sandiego.edu	0	0		
623	chrII	5051113	5051597	3500294513	26		5051113	5051597	8421504	3	12,7,7	0,467,477	c	350029451300000021	11-37						NOVEL DEATH DOMAIN PROTEINS - Patent application	www.faqs.org	0	0		
623	chrII	5052338	5052361	3500153555	23		5052338	5052361	8421504	1	23	0	g	350015355500000003	12-35						Method to detect Dirofilaria immitis infection - Patent # 6391569 - PatentGenius	.patentgenius.com	0	0		
623	chrII	5057481	5057505	3500116713	23		5057481	5057505	8421504	2	10,13	0,11	c	350011671300000008	7-30						piRNA	nabank.ibab.ac.in	0	0		
623	chrII	5057907	5070642	3500241788	45		5057907	5070642	8421504	5	11,12,6,11,5	0,14,12709,12718,12730	c,g	350024178800003949,350024178800001402	0-23,4-26						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
623	chrII	5087693	5087720	3500358504	24		5087693	5087720	8421504	2	16,8	0,19	g	350035850400000183	9-34						Inducible herbicide resistance	Ryals	1997	0		
623	chrII	5103385	5103414	3500322237	24		5103385	5103414	8421504	2	14,10	0,19	c	350032223700000261	5-29						<Html><Title> Complet list of 1rz1 hssp file Complet list of	cnptia.embrapa.br	0	0		
623	chrII	5105149	5105222	3500288532	73		5105149	5105222	8421504	1	73	0	c,g	350028853200000015,350028853200000015	0-73,0-73						ScienceDirect.com - Genomics - A combined computational and experimental analysis of two families of snoRNA genes from Caenorhabditis elegans, revealing the expression and evolution pattern of snoRNAs in nematodes	sciencedirect.com	0	0		
624	chrII	5143862	5143890	3500079365	24		5143862	5143890	8421504	2	6,18	0,10	c	350007936500000151	9-33					Patent	嘌呤类物质产生菌及嘌呤类物质的制备方法 (Patent CN:1831115)	Song Ye Ji 	2012	0		
624	chrII	5156783	5194545	3500361188	77		5156783	5194545	8421504	3	22,28,27	0,2046,37735	c	350036118800000010,350036118800000012,350036118800000011	0-22,24-52,27-54						Genetik İfade Profilleri Belirlenmesi C. elegans… (Translated to Turkish) | JoVE Video	www.jove.com	0	0		
624	chrII	5156783	5194545	3500117548	77		5156783	5194545	8421504	3	22,28,27	0,2046,37735	c	350011754800000010,350011754800000012,350011754800000011	0-22,24-52,27-54						确定基因表达概况… (Translated to Chinese) | JoVE Video	www.jove.com	0	0		
624	chrII	5158829	5194545	3500089318	55		5158829	5194545	8421504	2	28,27	0,35689	c	350008931800000012,350008931800000011	24-52,27-54						La determinación de perfiles genéticos de expresión en C.… (Translated to Spanish) | JoVE Video	www.jove.com	0	0		
624	chrII	5179125	5181078	3500404064	588		5179125	5181078	8421504	10	73,63,44,41,12,25,38,7,10,275	0,74,140,185,228,1401,1427,1466,1474,1678	g	350040406400000001,350040406400000000	0-234,2-357						<head> <title> tag sequences of clone 67a10    Complet list of	cnptia.embrapa.br	0	0		
626	chrII	5443219	5445746	3500343569	44		5443219	5445746	8421504	2	23,21	0,2506	c,g	350034356900000005,350034356900000005,350034356900000004,350034356900000004	0-23,0-23,0-21,0-21		20105303	10.1186/1471-2156-11-7		BMC Genetics	Calcineurin and Protein kinase G regulate C. elegans behavioral quiescence during locomotion in liquid	Rajarshi	2010	0		
626	chrII	5443219	5445746	3500018319	44		5443219	5445746	8421504	2	23,21	0,2506	c,g	350001831900000005,350001831900000005,350001831900000004,350001831900000004	0-23,0-23,0-21,0-21		20105303	10.1186/1471-2156-11-7	1471-2156	BMC Genetics	Calcineurin and Protein kinase G regulate C. elegans behavioral quiescence during locomotion in liquid	Ghosh	2010	2		
626	chrII	5446587	5447769	3500176312	52		5446587	5447769	8421504	2	28,24	0,1158	c,g	350017631200000003,350017631200000002,350017631200000002	12-40,8-32,8-32						Combinatorial expression of split caspase molecules	Chelur	2006	0		
626	chrII	5446587	5446617	3500413169	30		5446587	5446617	8421504	1	30	0	g	350041316900000001	44-74						Supporting Information 	www.pnas.org	0	0		
626	chrII	5455385	5459625	3500280763	163		5455385	5459625	8421504	8	20,20,30,29,1,23,20,20	0,136,1624,2031,2517,2599,3538,4220	c,g	350028076300000004,350028076300000004,350028076300000006,350028076300000006,350028076300000003,350028076300000003,350028076300000002,350028076300000002,350028076300000000,350028076300000007,350028076300000005	0-20,0-20,0-20,0-20,0-30,0-30,0-29,0-29,0-24,0-20,0-20						Caenorhabditis elegans homologue of the human azoospermia factor DAZis required for oogenesis but not for spermatogenesis	ev.biologists.org	0	0		
626	chrII	5457875	5457901	3500352612	23		5457875	5457901	8421504	2	8,15	0,11	c	350035261200001401	2-25						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
626	chrII	5494121	5494160	3500149397	39		5494121	5494160	8421504	1	39	0	c	350014939700000022	4-43						Functional tests of enhancer conservation between distantly related species	ev.biologists.org	0	0		
626	chrII	5500414	5500441	3500011383	23		5500414	5500441	8421504	3	12,5,6	0,15,21	c	350001138300000000	0-23						Cloning and mapping multiple S-locus F-box genes in European pear (Pyrus communis L.) - ResearchGate	.researchgate.net	0	0		
627	chrII	5506439	5506470	3500178126	25		5506439	5506470	8421504	3	4,14,7	0,5,24	c,g	350017812600000035,350017812600000035	5-30,5-30						Mosquito Transposable Elements and piwi Genes	cholar.lib.vt.edu	0	0		
627	chrII	5544891	5545257	3500461285	39		5544891	5545257	8421504	3	20,10,9	0,296,357	c,g	350046128500000052,350046128500000138,350046128500000053	0-20,0-19,0-19						KRUPPEL-LIKE FACTORS AND FAT REGULATION - Patent application	www.faqs.org	0	0		
627	chrII	5580701	5582401	3500261543	1700		5580701	5582401	8421504	1	1700	0	g	350026154300000001,350026154300000000	0-1700,0-1627						T25E4.2 | T25E4.2 | genotype ID: 23207655 @ PhenomicDB	www.phenomicdb.de	0	0		
627	chrII	5586090	5586118	3500004951	23		5586090	5586118	8421504	3	12,5,6	0,13,22	g	350000495100000273	1-25						Transcriptional Regulator 	.freshpatents.com	0	0		TSHZ3
627	chrII	5586215	5586373	3500318754	41		5586215	5586373	8421504	2	21,20	0,138	c,g	350031875400000024,350031875400000024,350031875400000025,350031875400000025	0-21,0-21,0-20,0-20						Protist-Type Lysozymes of the Nematode Caenorhabditis elegansContribute to Resistance against Pathogenic Bacillus thuringiensis	s-labs.bham.ac.uk	0	0		
627	chrII	5587775	5588030	3500309883	255		5587775	5588030	8421504	1	255	0	p	350030988300015148	0-255						THAP1, UN REGULATEUR CLE DE LA PROLIFERATION DES CELLULES ENDOTHELIALES : RELATIONS STRUCTURE/FONCTION ET GENES CIBLES	esups.ups-tlse.fr	0	0		
627	chrII	5600261	5600286	3500122798	23		5600261	5600286	8421504	2	7,16	0,9	c	350012279800000096	12-35						<Html><Title> Complet list of 1ebe hssp file Complet list of	cnptia.embrapa.br	0	0		
627	chrII	5605674	5605704	3500026001	24		5605674	5605704	8421504	3	7,12,5	0,11,25	c	350002600100000337	2-27						US Patent # 6,887,988. Plant reproduction polynucleotides and methods of use - Patents.com	www.patents.com	0	0		
628	chrII	5645142	5645168	3500329235	24		5645142	5645168	8421504	2	14,10	0,16	c	350032923500001916	21-45						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
628	chrII	5646538	5646561	3500327405	23		5646538	5646561	8421504	1	23	0	c	350032740500000188	0-23						<Html><Title> Complet list of 1o8q hssp file Complet list of	cnptia.embrapa.br	0	0		
628	chrII	5648192	5649425	3500061532	41		5648192	5649425	8421504	2	20,21	0,1212	c,g	350006153200000002,350006153200000003	19-39,18-39					Patent	Use of eukaryotic genes affecting cell cycle control or cell cycle progression for diagnosis and treatment of proliferative diseases (Patent US:7648827)	Echeverri	2010	0		
628	chrII	5648192	5649425	3500061021	41		5648192	5649425	8421504	2	20,21	0,1212	c,g	350006102100000002,350006102100000002,350006102100000003	19-39,19-39,18-39						Use of eukaryotic genes affecting cell cycle control or cell cycle progression for diagnosis and treatment of proliferative diseases	Echeverri	2007	0		
628	chrII	5649870	5650684	3500467106	46		5649870	5650684	8421504	2	21,25	0,789	c,g	350046710600000000,350046710600000000,350046710600000001,350046710600000001	8-29,8-29,8-33,8-33			10.1534/genetics.107.071803		Genetics	Suppressors of zyg-1 Define Regulators of Centrosome Duplication and Nuclear Association in Caenorhabditis elegans	Catherine	2007	0		
628	chrII	5667624	5667750	3500288532	125		5667624	5667750	8421504	2	68,57	0,69	g	350028853200000016	0-125						ScienceDirect.com - Genomics - A combined computational and experimental analysis of two families of snoRNA genes from Caenorhabditis elegans, revealing the expression and evolution pattern of snoRNAs in nematodes	sciencedirect.com	0	0		
628	chrII	5681871	5682318	3500197656	69		5681871	5682318	8421504	2	65,4	0,443	p	350019765600015223	0-69						Karakterisatie van neuromedine U-, tachykinine- en GnRH-verwante receptoren	w.scriptiebank.be	0	0		
628	chrII	5686262	5686289	3500227308	24		5686262	5686289	8421504	2	19,5	0,22	g	350022730800000089	20-44						Modified Promoter - Patent application	www.faqs.org	0	0		
628	chrII	5687289	5687316	3500144391	26		5687289	5687316	8421504	2	9,17	0,10	c	350014439100001080	12-38						SPIDER SILK DRAGLINE POLYNUCLEOTIDES, POLYPEPTIDES AND METHODS OF USE THEREOF - Patent application	www.faqs.org	0	0		
628	chrII	5689170	5689196	3500189284	25		5689170	5689196	8421504	2	21,4	0,22	g	350018928400000120	2-28						IDENTIFICATION OF A NEW CLASS OF EPSP SYNTHASES - Patent application	www.faqs.org	0	0		
628	chrII	5701658	5701706	3500447544	48		5701658	5701706	8421504	1	48	0	c	350044754400000005	0-48						Non-coding RNA Annotation of the Genome of Trichoplax adhaerens	www.santafe.edu	0	0		
628	chrII	5701658	5701706	3500252582	48		5701658	5701706	8421504	1	48	0	c	350025258200000009	0-48						Non-coding RNA annotation of the genome Trichoplax adhaerens	www.ecolevol.de	0	0		
628	chrII	5717598	5717622	3500384712	23		5717598	5717622	8421504	2	19,4	0,20	c	350038471200000002	5-28		19129220	10.1093/nar/gkn1052		Nucleic Acids Research	Oxidation of a single active site suffices for the functional inactivation of the dimeric Bacillus subtilis OhrR repressor in vitro	Warawan	2009	0		
628	chrII	5717602	5717835	3500050631	72		5717602	5717835	8421504	2	18,54	0,179	p	350005063100015015	18-192						Evolutionary Conservation of the Human Nucleolar Protein Fibrillarin and its Functional Expression in Yeast	jcb.rupress.org	0	0		
628	chrII	5722303	5724711	3500285271	43		5722303	5724711	8421504	2	21,22	0,2386	c,g	350028527100000014,350028527100000014,350028527100000015,350028527100000015	10-31,10-31,9-31,9-31		16571673	10.1091/mbc.E05-12-1170	1059-1524	Molecular Biology of the Cell	Regulation of Synaptic Transmission by RAB-3 and RAB-27 in Caenorhabditis elegans	Mahoney	2006	5		
628	chrII	5724708	5726067	3500372678	70		5724708	5726067	8421504	3	24,22,24	0,1189,1335	g	350037267800000003,350037267800000005,350037267800000002	0-24,0-22,0-24						ScienceDirect.com - Developmental Biology - Overexpression of PPK-1, the Caenorhabditis elegans Type I PIP kinase, inhibits growth cone collapse in the developing nervous system and causes axonal degeneration in adults	sciencedirect.com	0	0		
628	chrII	5724708	5725919	3500045200	46		5724708	5725919	8421504	2	24,22	0,1189	g	350004520000000003,350004520000000005	0-24,0-22			10.1016/j.ydbio.2007.10.029		Developmental biology	Overexpression of PPK-1, the C. elegans Type 1 PIP kinase, inhibits growth cone collapse in the developing nervous system and causes axonal degeneration in adults	David	2008	0		
628	chrII	5736548	5746333	3500422846	264		5736548	5746333	8421504	12	20,20,27,24,19,20,24,24,25,20,20,21	0,440,1367,1570,1678,1805,2186,2323,2380,5667,5865,9764	c,g	350042284600000000,350042284600000000,350042284600000002,350042284600000015,350042284600000013,350042284600000013,350042284600000009,350042284600000009,350042284600000006,350042284600000007,350042284600000008,350042284600000010,350042284600000010,350042284600000011,350042284600000011,350042284600000003,350042284600000001,350042284600000012	0-20,0-20,0-20,10-36,10-34,10-34,0-24,0-24,0-19,0-20,0-24,0-24,0-24,0-25,0-25,0-20,0-20,10-31		14627726	10.1242/dev.00894	0950-1991	Development	HLH-14 is a C. elegans Achaete-Scute protein that promotes neurogenesis through asymmetric cell division	Frank	2003	7		
78	chrII	5761314	5768845	3500070165	40		5761314	5768845	8421504	3	14,7,19	0,18,7512	g	350007016500000140,350007016500000067	2-26,0-19						US Patent # 7,309,597. Alanine 2,3-Aminomutase - Patents.com	www.patents.com	0	0		
628	chrII	5766349	5766374	3500097234	24		5766349	5766374	8421504	2	16,8	0,17	g	350009723400000006	0-29						MICROSATELLITE VARIABILITY IN FOUR CONTEMPORARY RHINOCEROS SPECIES: IMPLICATIONS FOR CONSERVATION	esourcecenter.com	0	0		
629	chrII	5770729	5770753	3500137909	23		5770729	5770753	8421504	2	4,19	0,5	c	350013790900000069	17-40							biomedcentral.com	0	0		
629	chrII	5772901	5772974	3500386452	61		5772901	5772974	8421504	2	20,41	0,32	c	350038645200000484,350038645200000486	5-77,5-77						NEUROPROTECTIVE MOLECULES AND METHODS OF TREATING NEUROLOGICAL DISORDERS AND INDUCING STRESS GRANULES	Anderson	2011	0		
629	chrII	5772901	5772974	3500235647	61		5772901	5772974	8421504	2	20,41	0,32	c	350023564700001277,350023564700001279,350023564700000484,350023564700000486	5-77,5-77,5-77,5-77						NEUROPROTECTIVE MOLECULES AND METHODS OF TREATING NEUROLOGICAL DISORDERS AND INDUCING STRESS GRANULES - Patent application	www.faqs.org	0	0		
629	chrII	5772945	5772968	3500232181	23		5772945	5772968	8421504	1	23	0	c	350023218100000001,350023218100000000	0-23,0-23		22102571	10.1093/nar/gkr1017		Nucleic Acids Research	Pseudouridine synthase 1: a site-specific synthase without strict sequence recognition requirements	Bryan	2012	0		
629	chrII	5784418	5784443	3500040519	23		5784418	5784443	8421504	2	7,16	0,9	g	350004051900000000	0-23		15917329	10.1073/pnas.0407210102	0027-8424	Proceedings of the National Academy of Sciences of the United States of America	Holliday junction dynamics and branch migration: Single-molecule analysis	Karymov	2005	10		
629	chrII	5795688	5796081	3500461285	39		5795688	5796081	8421504	2	19,20	0,373	c,g	350046128500000071,350046128500000071,350046128500000070,350046128500000070	0-19,0-19,0-20,0-20						KRUPPEL-LIKE FACTORS AND FAT REGULATION - Patent application	www.faqs.org	0	0		
629	chrII	5833518	5836179	3500232650	47		5833518	5836179	8421504	2	22,25	0,2636	c,g	350023265000000012,350023265000000012,350023265000000011	15-37,15-37,30-55						PhD Thesis	uni-goettingen.de	0	0		
629	chrII	5835722	5835863	3500059542	90		5835722	5835863	8421504	2	45,45	0,96	p	350005954200015013,350005954200015011	0-45,0-45						Methods of detecting Charcot-Marie Tooth disease type 2A - Patent # 7727717 - PatentGenius	.patentgenius.com	0	0		
629	chrII	5838486	5838511	3500168684	24		5838486	5838511	8421504	2	17,7	0,18	c	350016868400001740	22-46						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
629	chrII	5849175	5849202	3500038735	24		5849175	5849202	8421504	2	19,5	0,22	c	350003873500001124	1-26						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
629	chrII	5868220	5868246	3500190843	23		5868220	5868246	8421504	3	4,7,12	0,5,14	c	350019084300001390	0-23						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
630	chrII	5899109	5899132	3500135285	23		5899109	5899132	8421504	1	23	0	g	350013528500000364	14-37						<Html><Title> Complet list of 1t4j hssp file Complet list of	cnptia.embrapa.br	0	0		
630	chrII	5901820	5902314	3500449374	131		5901820	5902314	8421504	3	22,19,90	0,165,404	c,g	350044937400000005,350044937400000005,350044937400000006,350044937400000006,350044937400000014,350044937400000007,350044937400000015,350044937400000015,350044937400000017,350044937400000017,350044937400000016,350044937400000016,350044937400000021,350044937400000008,350044937400000008	0-22,0-22,0-19,0-19,0-69,0-19,0-33,0-33,0-30,0-30,14-64,14-64,0-40,0-20,0-20						The C. elegans Heterochronic Gene lin-4 Encodes Small RNAs with Antisense Complementarity to &II-14	quantification.de	0	0		
630	chrII	5901820	5902314	3500317663	122		5901820	5902314	8421504	3	22,19,81	0,165,413	c,g	350031766300000005,350031766300000005,350031766300000006,350031766300000006,350031766300000014,350031766300000007,350031766300000017,350031766300000017,350031766300000015,350031766300000015,350031766300000016,350031766300000016,350031766300000021,350031766300000008,350031766300000008	0-22,0-22,0-19,0-19,0-52,0-19,0-30,0-30,0-33,0-33,14-64,14-64,0-40,0-20,0-20						The C. elegans Heterochronic Gene lin-4 Encodes Small RNAs with Antisense Complementarity to &II-14	.microbio.uab.edu	0	0		
630	chrII	5901820	5902314	3500218021	122		5901820	5902314	8421504	3	22,19,81	0,165,413	c,g	350021802100000005,350021802100000005,350021802100000006,350021802100000006,350021802100000014,350021802100000007,350021802100000015,350021802100000015,350021802100000017,350021802100000017,350021802100000016,350021802100000016,350021802100000021,350021802100000008,350021802100000008	0-22,0-22,0-19,0-19,0-52,0-19,0-33,0-33,0-30,0-30,14-64,14-64,0-40,0-20,0-20						The C. elegans Heterochronic Gene lin-4 Encodes Small RNAs with Antisense Complementarity to &II-14	www.qpcrupdate.eu	0	0		
630	chrII	5902215	5902245	3500196545	30		5902215	5902245	8421504	1	30	0	c,g	350019654500000005,350019654500000005	0-30,0-30		20700435	10.1371/journal.pgen.1001054		PLoS Genetics	A Developmental Timing Switch Promotes Axon Outgrowth Independent of Known Guidance Receptors	Katherine	2010	0		
630	chrII	5902230	5902324	3500103054	94		5902230	5902324	8421504	1	94	0	c,g	350010305400000001,350010305400000001	0-94,0-94						The UNIX and Linux Forums - Searching and extracting records	www.unix.com	0	0		
630	chrII	5902230	5902324	3500014743	94		5902230	5902324	8421504	1	94	0	c,g	350001474300000001,350001474300000001	0-94,0-94						 Searching and extracting records - The UNIX and Linux Forums	www.unix.com	0	0		
630	chrII	5902240	5902271	3500103774	31		5902240	5902271	8421504	1	31	0	c,g	350010377400000014,350010377400000014	0-31,0-31		18824511	10.1261/rna.1139508		RNA	A novel biochemical method to identify target genes of individual microRNAs: Identification of a new Caenorhabditis elegans let-7 target	Yoshiki	2008	0		
630	chrII	5902240	5902271	3500025389	31		5902240	5902271	8421504	1	31	0	c,g	350002538900000014,350002538900000014	0-31,0-31		18824511	10.1261/rna.1139508	1355-8382	RNA	A novel biochemical method to identify target genes of individual microRNAs: Identification of a new Caenorhabditis elegans let-7 target	Andachi	2008	5		
630	chrII	5903409	5903432	3500121076	23		5903409	5903432	8421504	1	23	0	c	350012107600000196	9-32						<Html><Title> Complet list of 3od6 hssp file Complet list of	cnptia.embrapa.br	0	0		
630	chrII	5919806	5920280	3500249133	100		5919806	5920280	8421504	2	50,50	0,424	g	350024913300000003,350024913300000004	0-50,0-50							roarrays.ucsd.edu	0	0		
630	chrII	5933515	5940204	3500154339	153		5933515	5940204	8421504	3	50,50,53	0,2904,6636	c,g	350015433900000064,350015433900000053,350015433900000065	50-100,50-100,0-53							biomedcentral.com	0	0		
630	chrII	5942870	5942896	3500186062	25		5942870	5942896	8421504	2	6,19	0,7	g	350018606200000256	17-42						<Html><Title> Complet list of 1a2f hssp file Complet list of	cnptia.embrapa.br	0	0		
630	chrII	5972250	5972277	3500150959	23		5972250	5972277	8421504	2	12,11	0,16	g	350015095900000016	0-23						Supplementary Text and Figures: Simulation (cosi) parameters	es.convdocs.org	0	0		
630	chrII	5989319	6001029	3500319561	71		5989319	6001029	8421504	3	30,19,22	0,7518,11688	g	350031956100000001,350031956100000002,350031956100000003	29-59,22-41,22-44						daf-28 encodesa C. elegans insulin superfamilymemberthatisregulated byenvironmentalcuesandacts intheDAF-2signalingpathway	enesdev.cshlp.org	0	0		
630	chrII	5998808	5998836	3500439611	23		5998808	5998836	8421504	2	10,13	0,15	g	350043961100000001	0-24						MINICELLS EXPRESSING ANTIBODIES OR DERIVATIVES THEREOF AND COMPRISING BIOLOGICALLY ACTIVE COMPOUNDS	Sabbadini	2007	0		
630	chrII	5998808	5998836	3500365768	23		5998808	5998836	8421504	2	10,13	0,15	g	350036576800000001	0-24						Minicell compositions and methods	Berkley	2011	0		
630	chrII	5998808	5998836	3500186807	23		5998808	5998836	8421504	2	10,13	0,15	g	350018680700000001	0-24						Methods of making pharmaceutical compositions with minicells	Sabbadini	2002	0		
630	chrII	6010993	6011185	3500464597	44		6010993	6011185	8421504	2	21,23	0,169	c,g	350046459700000004,350046459700000004,350046459700000005,350046459700000005	0-21,0-21,0-23,0-23		21858156	10.1371/journal.pone.0023527	1932-6203	PLOS ONE	PLOS ONE: Lifespan-Extending Effects of Royal Jelly and Its Related Substances on the Nematode Caenorhabditis elegans	Honda	2011	4		
630	chrII	6022364	6022523	3500223858	44		6022364	6022523	8421504	3	12,14,18	0,111,141	c	350022385800000129	180-252							biomedcentral.com	0	0		
630	chrII	6022385	6022412	3500144391	24		6022385	6022412	8421504	2	11,13	0,14	c	350014439100000425	0-24						SPIDER SILK DRAGLINE POLYNUCLEOTIDES, POLYPEPTIDES AND METHODS OF USE THEREOF - Patent application	www.faqs.org	0	0		
631	chrII	6051185	6053339	3500016692	138		6051185	6053339	8421504	3	45,45,48	0,749,2106	p	350001669200015031,350001669200015057,350001669200015105	3-48,3-48,0-48						Glycine Decarboxylase Complex As A Herbicidal Target 	.freshpatents.com	0	0		
631	chrII	6078181	6081410	3500432243	44		6078181	6081410	8421504	2	21,23	0,3206	c,g	350043224300000000,350043224300000000,350043224300000002	0-21,0-21,0-23						A conserved RNA-binding protein controls germline stem cells in Caenorhabditis elegans	www.zo.utexas.edu	0	0		
631	chrII	6078795	6078827	3500306154	26		6078795	6078827	8421504	3	13,6,7	0,16,25	g	350030615400000018	3-30						Nucleotide Polymorphism and Within-Gene Recombination in Daphnia magna and D. pulex, Two Cyclical Parthenogens	.biology.ed.ac.uk	0	0		
631	chrII	6088716	6088739	3500455115	23		6088716	6088739	8421504	1	23	0	g	350045511500000039	7-30						Final Report 1996-2001	www.icac.org	0	0		
631	chrII	6139403	6145910	3500284394	38		6139403	6145910	8421504	4	13,6,11,8	0,14,6487,6499	g	350028439400000233,350028439400000521	8-27,21-40						RNAi INHIBITION OF INFLUENZA VIRUS REPLICATION	Fougerolles	2011	0		
631	chrII	6139403	6145910	3500253796	38		6139403	6145910	8421504	4	13,6,11,8	0,14,6487,6499	g	350025379600000233,350025379600000521	8-27,21-40					Patent	Enhancement of influenza gene expression (Patent US:8227188)	Fougerolles	2012	0		
631	chrII	6139403	6145910	3500241875	38		6139403	6145910	8421504	4	13,6,11,8	0,14,6487,6499	g	350024187500000233,350024187500000521	8-27,21-40					Patent	Enhancement of influenza gene expression (Patent US:8227188)	Fougerolles	2012	0		
631	chrII	6139403	6145910	3500019915	38		6139403	6145910	8421504	4	13,6,11,8	0,14,6487,6499	g	350001991500000233,350001991500000521	8-27,21-40						Rnai Inhibition Of Influenza Virus Replication 	.freshpatents.com	0	0		
631	chrII	6154544	6154569	3500077317	24		6154544	6154569	8421504	2	6,18	0,7	c	350007731700002303	0-24						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
631	chrII	6159111	6159136	3500196959	23		6159111	6159136	8421504	3	4,4,15	0,5,10	c	350019695900000926	7-30						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
632	chrII	6196025	6196752	3500455810	53		6196025	6196752	8421504	3	25,3,25	0,652,702	c,g	350045581000000005,350045581000000005,350045581000000004	0-25,0-25,0-28						Direct in vivo cellular reprogramming involves transition through discrete, non-pluripotent steps	ev.biologists.org	0	0		
632	chrII	6196025	6196752	3500122254	53		6196025	6196752	8421504	3	25,3,25	0,652,702	c,g	350012225400000005,350012225400000005,350012225400000004	0-25,0-25,0-28		21389048	10.1242/dev.063115	0950-1991	Development	Direct in vivo cellular reprogramming involves transition through discrete, non-pluripotent steps	Richard	2011	7		
632	chrII	6200617	6200644	3500397262	26		6200617	6200644	8421504	2	22,4	0,23	g	350039726200000466	2-28						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
632	chrII	6219123	6219153	3500352303	27		6219123	6219153	8421504	2	20,7	0,23	c,g	350035230300000553,350035230300000553	17-45,17-45						Anti-bacterial methods and materials	Holden	2000	0		
632	chrII	6219123	6219153	3500003185	27		6219123	6219153	8421504	2	20,7	0,23	c,g	350000318500000571,350000318500000571	17-45,17-45						Anti-bacterial methods and materials	Holden	2000	0		
632	chrII	6219669	6219692	3500163125	23		6219669	6219692	8421504	1	23	0	c,g	350016312500000004,350016312500000004	0-23,0-23						ScienceDirect.com - The American Journal of Human Genetics - TMEM237 Is Mutated in Individuals with a Joubert Syndrome Related Disorder and Expands the Role of the TMEM Family at the Ciliary Transition Zone	sciencedirect.com	0	0		
632	chrII	6227280	6227306	3500176877	23		6227280	6227306	8421504	2	12,11	0,15	c	350017687700000058	3-26						Wnt/ β-Catenin-Zielgene in der Maus-Entwicklung	k.uni-freiburg.de	0	0		
632	chrII	6237001	6244202	3500197871	705		6237001	6244202	8421504	12	63,52,155,111,48,45,39,18,27,24,4,119	0,2018,2117,4276,4396,4474,4525,4925,5496,6675,6702,7082	p	350019787100015137,350019787100015068,350019787100015062,350019787100015061,350019787100015055,350019787100015045,350019787100015005	0-63,0-207,0-111,0-48,0-84,6-51,0-147						Supporting Online Material for	ww.sciencemag.org	0	0		
632	chrII	6237001	6244202	3500114832	705		6237001	6244202	8421504	12	63,52,155,111,48,45,39,18,27,24,4,119	0,2018,2117,4276,4396,4474,4525,4925,5496,6675,6702,7082	p	350011483200015137,350011483200015068,350011483200015062,350011483200015061,350011483200015055,350011483200015045,350011483200015005	0-63,0-207,0-111,0-48,0-84,6-51,0-147						Role of C. elegans TAT-1 Protein in Maintaining Plasma Membrane Phosphatidylserine Asymmetry Monica Darland-Ransom, www.sciencemag.org (this information is current as of April 24, 2008 )	mcdb.colorado.edu	0	0		
632	chrII	6250558	6253115	3500034134	40		6250558	6253115	8421504	2	20,20	0,2537	c,g	350003413400000010,350003413400000010,350003413400000002,350003413400000002,350003413400000011,350003413400000011	0-20,0-20,7-27,7-27,0-20,0-20						Prohibitin couples diapause signalling to mitochondrial metabolism during ageing in C. elegans	ans.imbb.forth.gr	0	0		
632	chrII	6250955	6252939	3500062085	85		6250955	6252939	8421504	4	22,21,21,21	0,608,1480,1963	c,g	350006208500000000,350006208500000008,350006208500000008,350006208500000009,350006208500000009,350006208500000001	0-22,0-21,0-21,0-21,0-21,0-21		12794069	10.1074/jbc.M304877200	0021-9258	Journal of Biological Chemistry	The Mitochondrial Prohibitin Complex Is Essential for Embryonic Viability and Germline Function in Caenorhabditis elegans	Sanz	2003	5		
633	chrII	6306663	6306689	3500066811	25		6306663	6306689	8421504	2	21,4	0,22	g	350006681100000009,350006681100000039	8-33,8-33						AGENTS FOR PRE-SYMPTOMATIC DETECTION AND THERAPEUTIC TARGETING OF ALZHEIMER'S DISEASE AND DOWN SYNDROME IN HUMANS - Patent application	www.faqs.org	0	0		
633	chrII	6324455	6327539	3500173960	78		6324455	6327539	8421504	3	29,26,23	0,3034,3061	c,g	350017396000000021,350017396000000022,350017396000000022,350017396000000024,350017396000000023	0-29,0-28,0-28,0-26,0-23						Supplementary Figure 1	.ciml.univ-mrs.fr	0	0		
633	chrII	6324456	6324483	3500147922	27		6324456	6324483	8421504	1	27	0	c,g	350014792200000009,350014792200000009	11-38,11-38						BMC Developmental Biology BioMed Central	biomedcentral.com	0	0		
633	chrII	6324456	6324483	3500043668	27		6324456	6324483	8421504	1	27	0	c,g	350004366800000009,350004366800000009	11-38,11-38			10.1186/1471-213X-5-8		BMC Developmental Biology	C. elegans serine-threonine kinase KIN-29 modulates TGFβ signaling and regulates body size formation	Lisa	2005	0		
633	chrII	6325450	6325524	3500155916	27		6325450	6325524	8421504	4	6,1,8,12	0,8,51,62	c	350015591600000049	13-47						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
633	chrII	6328684	6328724	3500219292	40		6328684	6328724	8421504	1	40	0	c,g	350021929200000004,350021929200000004	0-40,0-40						Active turnover modulates mature microRNA activity in Caenorhabditis elegans	rnajc.ucsf.edu	0	0		
633	chrII	6328684	6328707	3500350956	23		6328684	6328707	8421504	1	23	0	c,g	350035095600000036,350035095600000036	0-23,0-23		24037191	10.1590/0074-0276108062013005	0074-0276	Memórias do Instituto Oswaldo Cruz	Memórias do Instituto Oswaldo Cruz - Identification and characterisation of microRNAs in young adults of Angiostrongylus cantonensis via a deep-sequencing approach	Chang	2013	2		
633	chrII	6328684	6328707	3500019132	23		6328684	6328707	8421504	1	23	0	c,g	350001913200000036,350001913200000036	0-23,0-23		24037191	10.1590/0074-0276108062013005	0074-0276	Memórias do Instituto Oswaldo Cruz	Memórias do Instituto Oswaldo Cruz - Identification and characterisation of microRNAs in young adults of Angiostrongylus cantonensis via a deep-sequencing approach	Chang	2013	2		
633	chrII	6330440	6331074	3500130526	40		6330440	6331074	8421504	2	20,20	0,614	c,g	350013052600000010,350013052600000010,350013052600000011,350013052600000011	0-20,0-20,0-20,0-20		23028348	10.1371/journal.pgen.1002933	1553-7404	PLOS Genetics	PLOS Genetics: H4K20me1 Contributes to Downregulation of X-Linked Genes for C. elegans Dosage Compensation	Vielle	2012	0		
633	chrII	6343236	6343665	3500405815	384		6343236	6343665	8421504	2	106,278	0,151	p	350040581500015023,350040581500015022,350040581500015021,350040581500015020,350040581500015019,350040581500015018,350040581500015017,350040581500015016	0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48						Tryparedoxin, expression plasmid, process of production, method of use, test kit, and pharmaceutical composition - US Patent 6432671 Description	ww.patentstorm.us	0	0		
633	chrII	6343529	6343558	3500436940	25		6343529	6343558	8421504	2	12,13	0,16	c	350043694000000086	9-38						Synthetic DNA sequence having enhanced activity in maize	Koziel	1995	0		
633	chrII	6343529	6343558	3500203326	25		6343529	6343558	8421504	2	12,13	0,16	c	350020332600000108	9-38						Synthetic DNA sequence having enhanced insecticidal activity in maize	Koziel	1995	0		
633	chrII	6343529	6343558	3500111307	25		6343529	6343558	8421504	2	12,13	0,16	c	350011130700000097	9-38					Patent	Method for producing a plant-optimized nucleic acid coding sequence (Patent US:6121014)	Desai	2000	0		
633	chrII	6346933	6349558	3500212106	62		6346933	6349558	8421504	3	20,22,20	0,697,2605	c,g	350021210600000003,350021210600000021,350021210600000021,350021210600000018,350021210600000018,350021210600000020	0-20,7-28,7-28,0-21,0-21,10-30						Supplementary Information	ans.imbb.forth.gr	0	0		
633	chrII	6346933	6347652	3500449628	42		6346933	6347652	8421504	2	20,22	0,697	c,g	350044962800000002,350044962800000004,350044962800000004,350044962800000001,350044962800000001	0-20,7-28,7-28,0-21,0-21			10.1038/sj.emboj.7601689	ERROR! NO ISSN	The EMBO Journal	Functional and physical interaction between Bcl-XL and a BH3-like domain in Beclin-1	Maiuri	2007	0		
633	chrII	6356735	6356760	3500334577	23		6356735	6356760	8421504	2	15,8	0,17	g	350033457700000045	7-36		21689391	10.1186/1759-8753-2-9	1759-8753	Mobile DNA	DNA binding activities of the Herves transposase from the mosquito Anopheles gambiae	Kahlon	2011	0		
633	chrII	6373115	6373195	3500004218	42		6373115	6373195	8421504	2	19,23	0,57	c,g	350000421800000038,350000421800000038,350000421800000039	0-19,0-19,0-23		21691303	10.1038/cr.2011.102	1001-0602	Cell Research	mir-35 is involved in intestine cell G1/S transition and germ cell proliferation in C. elegans	Liu	2011	8		
633	chrII	6406143	6414031	3500105817	42		6406143	6414031	8421504	4	5,14,9,14	0,6,7861,7874	g	350010581700000229,350010581700000044	2-21,0-23							www.ars.usda.gov	0	0		
634	chrII	6442794	6442824	3500179812	27		6442794	6442824	8421504	3	5,10,12	0,7,18	c	350017981200000184	8-35						水稻常用SSR分子标记_稻田统计爱好者_新浪博客	blog.sina.com.cn	0	0		
634	chrII	6475177	6475205	3500257805	24		6475177	6475205	8421504	3	5,8,11	0,8,17	g	350025780500000304	1-25						<Html><Title> Complet list of 1v0l hssp file Complet list of	cnptia.embrapa.br	0	0		
634	chrII	6489237	6489262	3500169765	25		6489237	6489262	8421504	1	25	0	c,g	350016976500000004,350016976500000004	0-25,0-25						ScienceDirect.com - Mechanisms of Development - Unique and redundant functions of SR proteins, a conserved family of splicing factors, in Caenorhabditiselegans development	sciencedirect.com	0	0		
79	chrII	6489452	6556469	3500336276	63		6489452	6556469	8421504	6	14,6,7,15,6,15	0,18,22474,22482,66995,67002	c,g	350033627600002029,350033627600001201,350033627600001319	24-45,7-29,21-48						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
634	chrII	6491005	6491180	3500136159	40		6491005	6491180	8421504	2	20,20	0,155	c,g	350013615900000000,350013615900000000,350013615900000001,350013615900000001	0-20,0-20,0-20,0-20						Supporting Information	www.pnas.org	0	0		
79	chrII	6511926	6556469	3500209433	43		6511926	6556469	8421504	4	7,15,6,15	0,8,44521,44528	c	350020943300001220,350020943300001337	7-29,21-48						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
634	chrII	6524405	6524439	3500243691	25		6524405	6524439	8421504	3	6,11,8	0,10,26	g	350024369100003983	13-39						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
634	chrII	6548575	6548602	3500221356	23		6548575	6548602	8421504	2	14,9	0,18	g	350022135600000153	15-39						APPENDIX 1. List of the Passiflora species studied classified by subgenus, with details about their geog raphical origin, and GenBank accesion number.	passionflow.co.uk	0	0		
635	chrII	6554944	6555799	3500311967	86		6554944	6555799	8421504	4	22,19,22,23	0,711,796,832	c,g	350031196700000003,350031196700000005,350031196700000005,350031196700000002,350031196700000002,350031196700000000,350031196700000000	9-31,6-25,6-25,0-22,0-22,0-23,0-23		15115755	10.1242/dev.01136	0950-1991	Development	A Werner syndrome protein homolog affects C. elegans development, growth rate, life span and sensitivity to DNA damage by acting at a DNA damage checkpoint	Lee	2004	7		
635	chrII	6554944	6555799	3500050398	86		6554944	6555799	8421504	4	22,19,22,23	0,711,796,832	c,g	350005039800000003,350005039800000005,350005039800000005,350005039800000002,350005039800000002,350005039800000000,350005039800000000	9-31,6-25,6-25,0-22,0-22,0-23,0-23						A Werner syndrome protein homolog affects C. elegans development, growth rate, life span and sensitivity to DNA damage by acting at a DNA damage checkpoint	ev.biologists.org	0	0		
635	chrII	6554944	6555799	3500026986	86		6554944	6555799	8421504	4	22,19,22,23	0,711,796,832	c,g	350002698600000003,350002698600000003,350002698600000005,350002698600000005,350002698600000002,350002698600000002,350002698600000000,350002698600000000	9-31,9-31,6-25,6-25,0-22,0-22,0-23,0-23		15115755	10.1242/dev.01136	0950-1991	Development	A Werner syndrome protein homolog affects C. elegans development, growth rate, life span and sensitivity to DNA damage by acting at a DNA damage checkpoint	Lee	2004	7		
635	chrII	6564717	6564742	3500099146	23		6564717	6564742	8421504	2	9,14	0,11	g	350009914600000069	13-36						Compositions And Methods for Inhibiting Expression Of A Gene From the Ebola Virus - Patent application	www.faqs.org	0	0		
635	chrII	6565374	6565402	3500359127	24		6565374	6565402	8421504	2	7,17	0,11	c	350035912700000508	10-34						<Html><Title> Complet list of 1c7j hssp file Complet list of	cnptia.embrapa.br	0	0		
635	chrII	6587937	6588459	3500164379	372		6587937	6588459	8421504	5	56,13,110,109,84	0,105,124,283,438	p	350016437900015103,350016437900015102	69-138,180-663						SEINE AVAL 2 : L’ANALYSE ET LA GESTION DES RISQUES	ne-aval.crihan.fr	0	0		
635	chrII	6589754	6590695	3500246027	40		6589754	6590695	8421504	2	20,20	0,921	c,g	350024602700000014,350024602700000014,350024602700000015,350024602700000015	19-39,19-39,19-39,19-39						Use of eukaryotic genes affecting spindle formation or microtubule function during cell division for diagnosis and treatment of proliferative diseases	Echeverri	2007	0		
635	chrII	6601291	6603347	3500028288	133		6601291	6603347	8421504	7	21,21,20,25,7,14,25	0,342,1129,1188,1886,1941,2031	c,g	350002828800000006,350002828800000006,350002828800000010,350002828800000010,350002828800000011,350002828800000011,350002828800000012,350002828800000013,350002828800000007	0-21,0-21,0-21,0-21,0-20,0-20,5-30,0-21,6-31		19109425	10.1091/mbc.E08-07-0728	1059-1524	Molecular Biology of the Cell	SPE-39 Family Proteins Interact with the HOPS Complex and Function in Lysosomal Delivery	Zhu	2009	5		
635	chrII	6614955	6614980	3500141365	25		6614955	6614980	8421504	1	25	0	g	350014136500003064	4-46						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
635	chrII	6618248	6621886	3500154339	154		6618248	6621886	8421504	3	54,50,50	0,1107,3588	c,g	350015433900000133,350015433900000118,350015433900000118,350015433900000124	46-100,50-100,50-100,0-50							biomedcentral.com	0	0		
635	chrII	6626836	6626864	3500391481	23		6626836	6626864	8421504	2	8,15	0,13	c	350039148100000016	7-45						Generating genotypic variations in plant genomes by gamete infection	Vainstein	2012	0		
635	chrII	6638563	6638595	3500364414	25		6638563	6638595	8421504	3	5,8,12	0,8,20	c	350036441400000011	0-31						绿色荧光蛋白的核酸序列_百度知道	zhidao.baidu.com	0	0		
635	chrII	6679842	6680714	3500273253	528		6679842	6680714	8421504	5	69,77,95,182,105	0,123,253,427,767	p	350027325300015001,350027325300015007,350027325300015012	0-180,0-180,0-168						Supplementary Materials for	ww.sciencemag.org	0	0		
636	chrII	6708819	6712551	3500126086	186		6708819	6712551	8421504	2	70,116	0,3616	g	350012608600000014,350012608600000015	0-70,0-116						Mutator phenotype of C. elegans DNA damage checkpoint mutants	labs.bio.unc.edu	0	0		
636	chrII	6710165	6711288	3500355450	85		6710165	6711288	8421504	3	20,21,44	0,898,1079	c,g	350035545000000004,350035545000000003,350035545000000003,350035545000000007	7-27,0-21,0-21,3-47						Splicing in Caenorhabditis Does NotRequire AG at 3' Splice	brary.caltech.edu	0	0		
636	chrII	6710542	6711245	3500437886	703		6710542	6711245	8421504	1	703	0	c,g	350043788600000000,350043788600000000,350043788600000002,350043788600000002,350043788600000001	0-703,0-703,0-22,0-22,0-22						LC-Molecular - PCR of Target Gene	ar.wikispaces.com	0	0		
636	chrII	6711080	6714812	3500044377	122		6711080	6714812	8421504	4	27,43,25,27	0,309,3426,3705	c,g	350004437700000018,350004437700000019,350004437700000019,350004437700000006,350004437700000006,350004437700000010,350004437700000010,350004437700000011	0-27,0-27,0-27,0-20,0-20,0-25,0-25,0-27			10.1091/mbc.E02-08-0479		Molecular Biology of the Cell	Two Sets of Interacting Collagens Form Functionally Distinct Substructures within a Caenorhabditis elegans Extracellular Matrix	Laura	2003	0		
636	chrII	6737254	6737277	3500198552	23		6737254	6737277	8421504	1	23	0	c	350019855200000003	9-32						NPHP nucleic acids and proteins	Hildebrandt	2005	0		
636	chrII	6744359	6744388	3500340920	25		6744359	6744388	8421504	3	6,8,11	0,9,18	c	350034092000000003	1-26						ISOLAMENTO E CARACTERIZAÇÃO DE PROMOTORES PROJECT CONSORTIUM)	ibb.unesp.br	0	0		
636	chrII	6748468	6748496	3500402168	24		6748468	6748496	8421504	2	14,10	0,18	c	350040216800000003	9-33							w.pseudomonas.com	0	0		
636	chrII	6749960	6749986	3500006289	23		6749960	6749986	8421504	2	17,6	0,20	c	350000628900000070	24-47						Yeast silencing genes proteins and methods - Patent # 5989897 - PatentGenius	.patentgenius.com	0	0		
636	chrII	6755820	6755844	3500232650	24		6755820	6755844	8421504	1	24	0	c	350023265000000010	15-39						PhD Thesis	uni-goettingen.de	0	0		
636	chrII	6758339	6758365	3500041639	23		6758339	6758365	8421504	2	14,9	0,17	c	350004163900000083,350004163900000016	0-23,0-23						PLAICE DNA TRANSPOSON SYSTEM - Patent application	www.faqs.org	0	0		
636	chrII	6760800	6775046	3500355959	274		6760800	6775046	8421504	12	23,25,22,22,23,24,24,25,21,25,19,21	0,144,955,6443,7027,8293,9849,10646,10845,11026,14108,14225	c,g	350035595900000019,350035595900000018,350035595900000018,350035595900000005,350035595900000006,350035595900000006,350035595900000017,350035595900000017,350035595900000016,350035595900000016,350035595900000001,350035595900000001,350035595900000004,350035595900000003,350035595900000003,350035595900000011,350035595900000011,350035595900000000,350035595900000009,350035595900000002,350035595900000002	17-39,9-31,9-31,0-25,0-22,0-22,9-31,9-31,9-32,9-32,0-24,0-24,0-24,0-25,0-25,12-33,12-33,0-25,25-44,0-21,0-21						C. elegansAgrin Is Expressed in Pharynx, IL1 Neurons and Distal Tip Cells and Does Not Genetically Interact with Genes Involved in Synaptogenesis or Muscle Function	summit.sfu.ca	0	0		
636	chrII	6765591	6765702	3500197656	90		6765591	6765702	8421504	2	45,45	0,66	p	350019765600015234,350019765600015235	0-45,0-45						Karakterisatie van neuromedine U-, tachykinine- en GnRH-verwante receptoren	w.scriptiebank.be	0	0		
636	chrII	6770181	6775042	3500266997	127		6770181	6775042	8421504	6	24,21,19,16,24,23	0,1181,1674,1694,2607,4838	c,g	350026699700000029,350026699700000029,350026699700000031,350026699700000031,350026699700000012,350026699700000012,350026699700000032,350026699700000030	0-24,0-24,0-21,0-21,14-49,14-49,0-24,0-23						NPG.nature.vol.413.Issue.6851.Sep	www.scribd.com	0	0		
636	chrII	6799414	6799447	3500428906	25		6799414	6799447	8421504	3	10,9,6	0,14,27	c	350042890600000015	5-31						<HTML><HEAD><meta http-equiv="Content-Type" content="text/html; charset=ISO-8859-1"><LINK REL="SHORT	.economie.fgov.be	0	0		
636	chrII	6799414	6799447	3500057006	25		6799414	6799447	8421504	3	10,9,6	0,14,27	c	350005700600000033	5-31						<HTML><HEAD><meta http-equiv="Content-Type" content="text/html; charset=ISO-8859-1"><LINK REL="SHORT	.economie.fgov.be	0	0		
636	chrII	6806218	6806246	3500133216	24		6806218	6806246	8421504	3	7,3,14	0,9,14	c,g	350013321600000011,350013321600000011,350013321600000010,350013321600000010	11-35,11-35,9-33,9-33						Synapses are regulated by the cytoplasmic tyrosine kinase Fer in a pathway mediated by p120catenin, Fer, SHP-2, and -catenin	jcb.rupress.org	0	0		
636	chrII	6814828	6814873	3500257087	45		6814828	6814873	8421504	1	45	0	p	350025708700015176	0-45						Chimeric GFP-aequorin as bioluminescent Ca&plus &plus reporters at the single cell level	Baubet	2001	0		SYT1
79	chrII	6815575	6815893	3500181690	42		6815575	6815893	8421504	3	8,12,22	0,258,296	c,g	350018169000000016,350018169000000017	0-20,0-22						TaiLieu.VN: Báo cáo y học: "Identification of ciliated sensory neuron-expressed genes in Caenorhabditis elegans using targeted pull-down of poly(A) tails" 	tailieu.vn/doc/ba	0	0		
637	chrII	6818652	6818682	3500323108	30		6818652	6818682	8421504	1	30	0	c	350032310800000705	7-42						Plant genes and uses thereof	J*M*Sa Er Mi Long 	2002	0		
637	chrII	6846533	6846669	3500020624	40		6846533	6846669	8421504	3	17,6,17	0,32,119	c	350002062400000058	109-149						<!DOCTYPE HTML PUBLIC i3/4-//IETF//DTD HTML 3.0//ENi3/4> <!- SPECIFICATION OF LANGUAGE-> <HTML> 	wheat.pw.usda.gov	0	0		
637	chrII	6853160	6898221	3500415441	154		6853160	6898221	8421504	2	82,72	0,44989	c,g	350041544100000648,350041544100000648,350041544100000645,350041544100000379,350041544100000379,350041544100000119,350041544100000119,350041544100000375,350041544100000375,350041544100000367,350041544100000367,350041544100000335,350041544100000331	0-82,0-82,0-82,5-78,5-78,5-78,5-78,5-74,5-74,5-78,5-78,0-72,3-72						Genomic tRNA Database: Caenorhabditis brenneri (WUGSC 4.0 Jan 2007)	gtrnadb.ucsc.edu	0	0		
637	chrII	6894990	6895016	3500197929	24		6894990	6895016	8421504	3	6,6,12	0,7,14	c	350019792900001396	12-36						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
637	chrII	6911221	6912362	3500467061	40		6911221	6912362	8421504	2	20,20	0,1121	c,g	350046706100000000,350046706100000000,350046706100000001,350046706100000001	0-20,0-20,0-20,0-20		23049887	10.1371/journal.pone.0045890		PLoS ONE	ASM-3 Acid Sphingomyelinase Functions as a Positive Regulator of the DAF-2/AGE-1 Signaling Pathway and Serves as a Novel Anti-Aging Target	Yongsoon	2012	0		
637	chrII	6911221	6912362	3500339533	40		6911221	6912362	8421504	2	20,20	0,1121	c,g	350033953300000000,350033953300000000,350033953300000001,350033953300000001	0-20,0-20,0-20,0-20		23049887	10.1371/journal.pone.0045890	1932-6203	PLOS ONE	PLOS ONE: ASM-3 Acid Sphingomyelinase Functions as a Positive Regulator of the DAF-2/AGE-1 Signaling Pathway and Serves as a Novel Anti-Aging Target	Kim	2012	4		
637	chrII	6916179	6916203	3500352612	23		6916179	6916203	8421504	2	9,14	0,10	c	350035261200001703	18-43						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
638	chrII	6950651	6950677	3500149393	24		6950651	6950677	8421504	2	18,6	0,20	c	350014939300000004	15-41					Patent	Bacillus thuringiensis bacteria (Patent US:5854053)	Donovan	1998	0		
638	chrII	6955357	6967626	3500270920	104		6955357	6967626	8421504	4	23,27,28,26	0,44,191,12243	g	350027092000000006,350027092000000012,350027092000000011,350027092000000007,350027092000000005,350027092000000004	9-32,0-27,0-28,20-48,0-21,10-36						Somatic sex determination in Caenorhabditis elegans is modulated by SUP-26 repression of tra-2 translation	mcdb.colorado.edu	0	0		
638	chrII	6955371	6955578	3500153113	207		6955371	6955578	8421504	1	207	0	g	350015311300000003,350015311300000005,350015311300000000,350015311300000001,350015311300000008,350015311300000004,350015311300000007	0-40,0-58,0-84,0-78,0-59,0-69,0-60						J399 24e 802.	biology.duke.edu	0	0		
638	chrII	6955371	6955504	3500378242	105		6955371	6955504	8421504	2	21,84	0,49	g	350037824200000003,350037824200000001	12-33,0-84						THB COUNCIL FO~ TOBACCO RKSE.k~.CH - U.SoAo, INC SUPPOI~TING BIOMEDICAL INVESTIGATION 	accodocuments.org	0	0		
638	chrII	6955420	6955576	3500270705	105		6955420	6955576	8421504	2	84,21	0,135	g	350027070500000001,350027070500000002	0-84,15-36						A genetic pathway for regulation of tra-2translation	ev.biologists.org	0	0		
638	chrII	6955420	6955557	3500462299	137		6955420	6955557	8421504	1	137	0	g	350046229900000007,350046229900000006	0-78,0-83			10.1093/emboj/18.1.258	ERROR! NO ISSN	The EMBO Journal	The STAR protein, GLD-1, is a translational regulator of sexual identity in Caenorhabditis elegans	Jan	1999	0		
638	chrII	6972833	6973838	3500204591	44		6972833	6973838	8421504	2	20,24	0,981	c,g	350020459100000016,350020459100000016,350020459100000015	0-20,0-20,0-24						Four bait constructs, p32RAPH, p32M10A, p32M10B, and p32M10C were created for use in the yeast two-hybrid system all using the same bait vector, pDEST32™	www.wpi.edu	0	0		
638	chrII	6972869	6973275	3500064176	318		6972869	6973275	8421504	3	62,154,102	0,106,304	p	350006417600015030,350006417600015020	21-210,0-144						A cell-surface superoxide dismutase is a binding protein for peroxinectin, a cell-adhesive peroxidase in crayfish	cs.biologists.org	0	0		
638	chrII	6995894	6996532	3500184593	114		6995894	6996532	8421504	2	97,17	0,621	p	350018459300015008	3-117						Molecularcharacterization kinesin-related antigen Leishmania American	www.pnas.org	0	0		
638	chrII	7002998	7003022	3500235647	24		7002998	7003022	8421504	1	24	0	g	350023564700000145,350023564700000018	0-24,0-24						NEUROPROTECTIVE MOLECULES AND METHODS OF TREATING NEUROLOGICAL DISORDERS AND INDUCING STRESS GRANULES - Patent application	www.faqs.org	0	0		
638	chrII	7003687	7010164	3500391542	39		7003687	7010164	8421504	2	19,20	0,6457	c,g	350039154200000000,350039154200000000,350039154200000001	0-19,0-19,9-29		11356862		0270-6474	The Journal of Neuroscience	Direct Visualization of the Movement of the Monomeric Axonal Transport Motor UNC-104 along Neuronal Processes in LivingCaenorhabditis elegans	Zhou	2001	7		
638	chrII	7030152	7030175	3500421940	23		7030152	7030175	8421504	1	23	0	c,g	350042194000000010,350042194000000010	0-23,0-23						ThemicroRNAs of Caenorhabditis elegans	cseweb.ucsd.edu	0	0		
638	chrII	7038442	7061241	3500245053	39		7038442	7061241	8421504	3	20,13,6	0,22777,22793	c,g	350024505300001287,350024505300001287,350024505300001617	10-32,10-32,22-41						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
638	chrII	7047714	7047742	3500398690	23		7047714	7047742	8421504	2	12,11	0,17	c	350039869000000008	11-34						Biochemical Characterization of Arabidopsis Complexes Containing CONSTITUTIVELY PHOTOMORPHOGENIC1 and SUPPRESSOR OF PHYA Proteins in Light Control of Plant Development	www.plantcell.org	0	0		
638	chrII	7047714	7047742	3500268788	23		7047714	7047742	8421504	2	12,11	0,17	c	350026878800000007	11-34		18812498	10.1105/tpc.107.056580	1040-4651	The Plant Cell Online	Biochemical Characterization of Arabidopsis Complexes Containing CONSTITUTIVELY PHOTOMORPHOGENIC1 and SUPPRESSOR OF PHYA Proteins in Light Control of Plant Development	Zhu	2008	9		
638	chrII	7047714	7047742	3500260008	23		7047714	7047742	8421504	2	12,11	0,17	c	350026000800000008	11-34						Biochemical Characterization of Arabidopsis Complexes Containing CONSTITUTIVELY PHOTOMORPHOGENIC1 and SUPPRESSOR OF PHYA Proteins in Light Control of Plant Development	www.nibs.ac.cn	0	0		
638	chrII	7047714	7047742	3500097970	23		7047714	7047742	8421504	2	12,11	0,17	c	350009797000000006	11-34						B io c h e m ic a l C h a ra c te riza tio n o f A ra b id o p sis C o m p le xe s C o n ta in in g C O N S T IT U T IV E L Y P H O T O M O R P H O G E N IC 1 a n d S U P P R E S S O R O F P H Y A P ro te in s in L ig h t C o n tro l o f P la n t D e ve l	www.yale.edu	0	0		
638	chrII	7047929	7047953	3500381088	24		7047929	7047953	8421504	1	24	0	c	350038108800000013	3-27						Fig The effect of leptin on osteoblast differentiation in primary | Online Peptides Guide	protein-par-4.com	0	0		
638	chrII	7064556	7070678	3500447460	70		7064556	7070678	8421504	3	24,24,22	0,5365,6100	c,g	350044746000000000,350044746000000001,350044746000000004,350044746000000004	0-24,21-45,0-22,0-22						Chromatin and RNAi factors protect the C. elegans germline against repetitive sequences. - ResearchGate	.researchgate.net	0	0		
638	chrII	7064556	7070678	3500150707	70		7064556	7070678	8421504	3	24,24,22	0,5365,6100	c,g	350015070700000000,350015070700000000,350015070700000001,350015070700000004,350015070700000004	0-24,0-24,21-45,0-22,0-22			10.1101/gad.332305		Genes & Development	Chromatin and RNAi factors protect the C. elegans germline against repetitive sequences	Valerie	2005	0		
79	chrII	7073832	7082729	3500467453	1164		7073832	7082729	8421504	8	68,11,264,153,136,340,120,72	0,139,252,612,815,1000,1414,8825	c,g	350046745300000013,350046745300000015,350046745300000015,350046745300000014	33-101,0-1024,0-1024,23-95						MICROORGANISMS AND METHODS FOR THE BIOSYNTHESIS OF ADIPATE, HEXAMETHYLENEDIAMINE AND 6-AMINOCAPROIC ACID - Patent application	www.faqs.org	0	0		
638	chrII	7073832	7075366	3500424835	1163		7073832	7075366	8421504	6	150,264,153,136,340,120	0,252,612,815,1000,1414	c,g	350042483500000014,350042483500000015,350042483500000015	25-84,0-1136,0-1136						MICROORGANISMS AND METHODS FOR THE BIOSYNTHESIS OF ADIPATE, HEXAMETHYLENEDIAMINE AND 6-AMINOCAPROIC ACID - Patent application	www.faqs.org	0	0		
638	chrII	7073832	7075366	3500390856	1163		7073832	7075366	8421504	6	150,264,153,136,340,120	0,252,612,815,1000,1414	c,g	350039085600000015,350039085600000015,350039085600000016,350039085600000016	25-57,25-57,0-1163,0-1163						Semi-synthetic terephthalic acid via microorganisms that produce muconic acid	Burk	2011	0		
638	chrII	7073832	7075366	3500086959	1163		7073832	7075366	8421504	6	150,264,153,136,340,120	0,252,612,815,1000,1414	c,g	350008695900000015,350008695900000015,350008695900000016,350008695900000016	25-57,25-57,0-1163,0-1163						SureChem - Document - USPTO Applications - Publication No. 20110124911 - "SEMI-SYNTHETIC TEREPHTHALIC ACID VIA MICROORGANISMS THAT PRODUCE MUCONIC ACID" - Description	www.surechem.org	0	0		
638	chrII	7073832	7075366	3500047901	1163		7073832	7075366	8421504	6	150,264,153,136,340,120	0,252,612,815,1000,1414	c,g	350004790100000062,350004790100000062,350004790100000015,350004790100000015,350004790100000064,350004790100000064,350004790100000016,350004790100000016,350004790100000063	3-25,3-25,25-57,25-57,3-1166,3-1166,0-1163,0-1163,0-29						SEMI-SYNTHETIC TEREPHTHALIC ACID VIA MICROORGANISMS THAT PRODUCE MUCONIC ACID - Patent application	www.faqs.org	0	0		
639	chrII	7087934	7087960	3500272454	25		7087934	7087960	8421504	2	5,20	0,6	g	350027245400000055	1-26						Novel calpaines, production and use thereof	Boehm	1998	0		
639	chrII	7106220	7106272	3500004993	51		7106220	7106272	8421504	2	13,38	0,14	g	350000499300000007	0-51						SourceForge.net: SAM tools: samtools-help	sourceforge.net	0	0		
639	chrII	7123679	7123727	3500186487	48		7123679	7123727	8421504	1	48	0	p	350018648700015016	21-69						Method of isolating secretion signals in lactic acid bacteria and novel secretion signals isolated from Lactococcus lactis	Ravn	2003	0		ZNF492
639	chrII	7123679	7123727	3500128850	48		7123679	7123727	8421504	1	48	0	p	350012885000015018	21-69						Method of isolating secretion signals in lactic acid bacteria and novel secretion signals isolated from - US Patent 7186815 Description	ww.patentstorm.us	0	0		DLX6
639	chrII	7123681	7123728	3500291409	47		7123681	7123728	8421504	1	47	0	c	350029140900000024,350029140900000025	36-79,39-79						AB	tsienlab.ucsd.edu	0	0		
639	chrII	7123683	7123713	3500440196	30		7123683	7123713	8421504	1	30	0	c	350044019600000003	0-30						Modified chitin binding domain and uses thereof	Xu	2005	0		CD28
639	chrII	7123683	7123713	3500235454	30		7123683	7123713	8421504	1	30	0	c	350023545400000003	0-30						Modified chitin binding domain and uses thereof	Colussi	2003	0		CD28
639	chrII	7123683	7123713	3500050965	30		7123683	7123713	8421504	1	30	0	c	350005096500000003	0-30						Modified chitin binding domain and uses thereof	Xu	2003	0		GABRA4
639	chrII	7123683	7123713	3500026566	30		7123683	7123713	8421504	1	30	0	c	350002656600000003	0-30						Modified chitin binding domain and uses thereof	osdir.com/patents	0	0		ITGAV
639	chrII	7131204	7131233	3500041659	24		7131204	7131233	8421504	2	18,6	0,23	g	350004165900000041	11-35						Developmental & Comparative Immunology Archimer	chimer.ifremer.fr	0	0		
639	chrII	7158533	7158764	3500141880	77		7158533	7158764	8421504	3	28,21,28	0,30,203	c,g	350014188000000004,350014188000000005,350014188000000005,350014188000000007,350014188000000007	0-28,0-21,0-21,0-28,0-28						Caenorhabditis elegans: Molecular Genetics and Development	www.scribd.com	0	0		
639	chrII	7171866	7171893	3500110061	27		7171866	7171893	8421504	1	27	0	c	350011006100000103	28-55						5.8S-T-14 HBII-239 GCGATGGATCGGTTGCATCGAGTAT 5.8S-G-75 U96a,U96b AATTGCAGACGCTTAGAGTGGTGAA 18S-A-2	pbase.sysu.edu.cn	0	0		
639	chrII	7172314	7172511	3500442789	40		7172314	7172511	8421504	2	20,20	0,177	c,g	350044278900000007,350044278900000007,350044278900000006,350044278900000006	0-20,0-20,0-20,0-20		22768380	10.1038/srep00487	xxxx-xxxx	Scientific Reports	Genes down-regulated in spaceflight are involved in the control of longevity in Caenorhabditis elegans	Honda	2012	0		
639	chrII	7172314	7172511	3500149422	40		7172314	7172511	8421504	2	20,20	0,177	c,g	350014942200000007,350014942200000007,350014942200000006,350014942200000006	0-20,0-20,0-20,0-20		22768380	10.1038/srep00487	xxxx-xxxx	Scientific Reports	Genes down-regulated in spaceflight are involved in the control of longevity in Caenorhabditis elegans	Honda	2012	0		
639	chrII	7172314	7172511	3500062275	40		7172314	7172511	8421504	2	20,20	0,177	c,g	350006227500000007,350006227500000007,350006227500000006,350006227500000006	0-20,0-20,0-20,0-20		22768380	10.1038/srep00487		Scientific Reports	Genes down-regulated in spaceflight are involved in the control of longevity in Caenorhabditis elegans	Yoko	2012	0		
639	chrII	7192287	7192312	3500406415	23		7192287	7192312	8421504	2	8,15	0,10	c	350040641500000010	7-30		12835382	10.1242/dev.00588	0950-1991	Development	The Drosophila bZIP transcription factor Vrille is involved in hair and cell growth	Szuplewski	2003	7		
639	chrII	7192287	7192312	3500048050	23		7192287	7192312	8421504	2	8,15	0,10	c	350004805000000010	7-30						The Drosophila bZIP transcription factor Vrille is involved in hair and cell growth	ev.biologists.org	0	0		
639	chrII	7203551	7203575	3500323036	23		7203551	7203575	8421504	2	15,8	0,16	g	350032303600000052,350032303600001079,350032303600001077,350032303600001080	0-21,0-21,0-21,0-21						COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF A GENE FROM THE JC VIRUS - Patent application	www.faqs.org	0	0		
640	chrII	7218370	7220520	3500400569	65		7218370	7220520	8421504	3	21,20,24	0,303,2126	c,g	350040056900000003,350040056900000000,350040056900000000,350040056900000002,350040056900000002	0-21,0-20,0-20,0-24,0-24		16306126	10.1152/ajpcell.00423.2005		American Journal of Physiology - Cell Physiolog	Altered gating and regulation of a carboxy-terminal ClC channel mutant expressed in the Caenorhabditis elegans oocyte	Denton	2006	0		
640	chrII	7221344	7221369	3500295681	24		7221344	7221369	8421504	2	19,5	0,20	g	350029568100000996	10-35						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
640	chrII	7226307	7226334	3500388601	27		7226307	7226334	8421504	1	27	0	g	350038860100000005	0-27		11078724			American Journal of Physiology - Cell Physiolog	 Into Ion Channel and Transporter Function. Caenorhabditis elegans ClC-type chloride channels: novel variants and functional expression	Nehrke	2000	0		
640	chrII	7226307	7226334	3500126049	27		7226307	7226334	8421504	1	27	0	g	350012604900000005	0-27		11078724			American Journal of Physiology - Cell Physiolog	 Into Ion Channel and Transporter Function. Caenorhabditis elegans ClC-type chloride channels: novel variants and functional expression	Nehrke	2000	0		
640	chrII	7226307	7226334	3500022228	27		7226307	7226334	8421504	1	27	0	g	350002222800000005	0-27		11078724			American Journal of Physiology - Cell Physiolog	 Into Ion Channel and Transporter Function. Caenorhabditis elegans ClC-type chloride channels: novel variants and functional expression	Nehrke	2000	0		
640	chrII	7229210	7229255	3500288049	45		7229210	7229255	8421504	1	45	0	p,c,g	350028804900015105,350028804900000076,350028804900000076	3-48,6-26,6-26						<HTML><HEAD><meta http-equiv="Content-Type" content="text/html; charset=ISO-8859-1"><LINK REL="SHORT	.economie.fgov.be	0	0		
640	chrII	7229210	7229255	3500132606	45		7229210	7229255	8421504	1	45	0	p	350013260600015107	0-45						 Ostertagia Vaccine 	www.docstoc.com	0	0		
640	chrII	7235933	7236133	3500228289	42		7235933	7236133	8421504	3	22,1,19	0,133,181	c,g	350022828900000019,350022828900000019,350022828900000018	0-22,0-22,0-20							digital.csic.es	0	0		
640	chrII	7258610	7267492	3500028050	46		7258610	7267492	8421504	4	15,11,14,6	0,20,8858,8876	c,g	350002805000000488,350002805000000401	16-42,9-29						Stress response and virulence in Salmonella Typhimurium: a genomics approach	edepot.wur.nl	0	0		
640	chrII	7263238	7304568	3500352303	40		7263238	7304568	8421504	3	8,12,20	0,12,41310	c,g	350035230300000350,350035230300000803	4-24,1-21						Anti-bacterial methods and materials	Holden	2000	0		
640	chrII	7263238	7304568	3500003185	40		7263238	7304568	8421504	3	8,12,20	0,12,41310	c,g	350000318500000368,350000318500000821	4-24,1-21						Anti-bacterial methods and materials	Holden	2000	0		
640	chrII	7295913	7298443	3500174897	1823		7295913	7298443	8421504	11	20,184,71,130,31,867,94,10,273,123,20	0,165,352,472,605,680,1593,1733,1746,2152,2510	p,c,g	350017489700000017,350017489700000017,350017489700000033,350017489700000000,350017489700000020,350017489700015009,350017489700015008,350017489700000013,350017489700000013,350017489700000002,350017489700000002,350017489700000012,350017489700000012,350017489700000019,350017489700000019,350017489700000018,350017489700000018,350017489700000006,350017489700000006,350017489700000003,350017489700000003,350017489700000007,350017489700000007,350017489700000034,350017489700000034,350017489700000005,350017489700000005,350017489700000004,350017489700000004,350017489700015007,350017489700015006,350017489700000035,350017489700000035,350017489700000001	0-20,0-20,0-184,0-21,27-54,0-1599,0-48,0-20,0-20,0-21,0-21,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20,10-29,10-29,0-20,0-20,0-20,0-20,0-48,0-54,10-29,10-29,0-20						puf-8’s role as a negative regulator of proliferation in the C. elegans	space.ucalgary.ca	0	0		
640	chrII	7301224	7301673	3500424604	449		7301224	7301673	8421504	1	449	0	g	350042460400000012	0-449						SourceForge.net: Genomic Unified Schema Development: gusdev-gusdev	sourceforge.net	0	0		
640	chrII	7302824	7303464	3500383377	40		7302824	7303464	8421504	2	20,20	0,620	c,g	350038337700000015,350038337700000015,350038337700000016,350038337700000016	0-20,0-20,0-20,0-20		23352664	10.1016/j.celrep.2012.12.018	2211-1247	Cell Reports	Cell Reports - A Fasting-Responsive Signaling Pathway that Extends Life Span in C. elegans	Uno	2013	0		
641	chrII	7350219	7352399	3500364041	60		7350219	7352399	8421504	2	30,30	0,2150	c,g	350036404100000005,350036404100000004,350036404100000004	0-30,0-30,0-30		19822669	10.1083/jcb.200903024	0021-9525	The Journal of Cell Biology	Ubiquilin and p97/VCP bind erasin, forming a complex involved in ERAD	Lim	2009	10		
641	chrII	7350219	7352399	3500238090	60		7350219	7352399	8421504	2	30,30	0,2150	c,g	350023809000000005,350023809000000004,350023809000000004	0-30,0-30,0-30		19822669	10.1083/jcb.200903024		The Journal of Cell Biology	Ubiquilin and p97/VCP bind erasin, forming a complex involved in ERAD	Precious	2009	0		
641	chrII	7350633	7350718	3500387183	48		7350633	7350718	8421504	2	24,24	0,61	c,g	350038718300000001,350038718300000001,350038718300000000	0-24,0-24,0-24		20733002	10.1128/MCB.00922-10	0270-7306	Molecular and Cellular Biology	Protein Misfolding Induces Hypoxic Preconditioning via a Subset of the Unfolded Protein Response Machinery	Mao	2010	6		
641	chrII	7351033	7352281	3500281888	96		7351033	7352281	8421504	4	41,7,20,28	0,87,1152,1220	p	350028188800015146,350028188800015125	0-48,0-48						Compositions And Methods Of Use Of Targeting Peptides For Diagnosis And Therapy Of Human Cancer 	.freshpatents.com	0	0		
641	chrII	7351617	7351662	3500173676	45		7351617	7351662	8421504	1	45	0	p	350017367600015001,350017367600015038	3-48,3-48						Molecular cloning and characterization of two hsp 70 homolo- gous genes from the dimorphic fungus Paracoccidioides brasiliensis	istabiomedica.org	0	0		HSPA5
641	chrII	7351623	7351671	3500333802	48		7351623	7351671	8421504	1	48	0	p	350033380200015023	9-57						ANTI-CANCER DNA VACCINE EMPLOYING PLASMIDS ENCODING SIGNAL SEQUENCE, MUTANT ONCOPROTEIN ANTIGEN, AND HEAT SHOCK PROTEIN - Patent application	www.faqs.org	0	0		HSPA5
641	chrII	7351623	7351671	3500286885	48		7351623	7351671	8421504	1	48	0	p	350028688500015062	6-54						Dna Vaccine Enhancement With Mhc Class Ii Activators 	.freshpatents.com	0	0		HSPA5
641	chrII	7352668	7352694	3500068944	26		7352668	7352694	8421504	1	26	0	g	350006894400000043	0-26						Novel Genes, Compositions, and Methods for Modulating the Unfolded Protein Response - Patent application	www.faqs.org	0	0		
641	chrII	7363235	7365393	3500121085	64		7363235	7365393	8421504	3	22,21,21	0,755,2137	c,g	350012108500000012,350012108500000012,350012108500000004,350012108500000001	1-23,1-23,0-21,0-21		19747232	10.1111/j.1474-9726.2009.00521.x	1474-9726	Aging Cell	Methionine sulfoxide reductase A expression is regulated by the DAF-16/FOXO pathway in Caenorhabditis elegans - Minniti - 2009 - Aging Cell - Wiley Online Library	Minniti	2009	0		
641	chrII	7363236	7363990	3500077558	621		7363236	7363990	8421504	2	372,249	0,505	p,c,g	350007755800015026,350007755800000000,350007755800000000,350007755800000004,350007755800000004,350007755800015025,350007755800015012,350007755800015009,350007755800015015,350007755800015024,350007755800015013,350007755800015007,350007755800000003,350007755800000005,350007755800000001,350007755800000001	0-183,9-30,9-30,9-30,9-30,0-219,0-69,0-105,0-72,0-219,0-141,0-120,14-35,10-38,9-29,9-29						ESTUDIO DE LA DISTRIBUCIÓN SUBCELULAR DE LA ENZIMA METIONINA SULFÓXIDO REDUCTASA DE	w.tesis.uchile.cl	0	0		
641	chrII	7366720	7366749	3500397262	23		7366720	7366749	8421504	3	13,3,7	0,14,22	g	350039726200000536	26-49						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
641	chrII	7390495	7390521	3500088374	25		7390495	7390521	8421504	2	11,14	0,12	g	350008837400000129	14-39						Method For Producing Multiple Unsaturated Fatty Acids In Plants 	.freshpatents.com	0	0		
641	chrII	7405628	7405652	3500243451	23		7405628	7405652	8421504	2	18,5	0,19	g	350024345100000004	11-35			10.1091/mbc.E04-06-0483		Molecular Biology of the Cell	Glycoprotein gp130 of Dictyostelium discoideum Influences Macropinocytosis and Adhesion	Catherine	June	0		
641	chrII	7413495	7413518	3500399634	23		7413495	7413518	8421504	1	23	0	g	350039963400000225	13-48						Recombinant vesiculoviruses and their uses	Rose	1998	0		
641	chrII	7413495	7413518	3500278645	23		7413495	7413518	8421504	1	23	0	g	350027864500000225	13-48						Recombinant vesiculoviruses and their uses		1997	0		
641	chrII	7413495	7413518	3500193093	23		7413495	7413518	8421504	1	23	0	g	350019309300000224	13-48						 Recombinant Vesiculoviruses And Their Uses 	www.docstoc.com	0	0		
641	chrII	7430334	7430362	3500401199	24		7430334	7430362	8421504	2	15,9	0,19	g	350040119900000247	0-24						<Html><Title> Complet list of 1i1n hssp file Complet list of	cnptia.embrapa.br	0	0		
641	chrII	7434680	7434709	3500055326	25		7434680	7434709	8421504	2	15,10	0,19	g	350005532600000029	0-25						Caracterização de populações da variedade crioula Boca de moça de feijão-fava utilizando caracteres agromorfológicos e marcadores moleculares	www.ufpi.br	0	0		
642	chrII	7477632	7477686	3500446950	54		7477632	7477686	8421504	1	54	0	p	350044695000015039,350044695000015125	0-54,0-45						Antibody-Based Depletion of Antigen-Presenting Cells and Dendritic Cells - Patent application	www.faqs.org	0	0		
642	chrII	7477632	7477686	3500430125	54		7477632	7477686	8421504	1	54	0	p	350043012500015034	0-54						Anti-Mucin Antibodies for Early Detection and Treatment of Pancreatic Cancer	Gold	2012	0		
642	chrII	7477632	7477686	3500427070	54		7477632	7477686	8421504	1	54	0	p	350042707000015098	0-54						Combination therapy with anti-CD74 antibodies provides enhanced toxicity to malignancies, Autoimmune disease and other diseases	Chang	2011	0		
642	chrII	7477632	7477686	3500382936	54		7477632	7477686	8421504	1	54	0	p	350038293600015038	0-54						Detection of Early-Stage Pancreatic Adenocarcinoma - Patent application	www.faqs.org	0	0		
642	chrII	7477632	7477686	3500377644	54		7477632	7477686	8421504	1	54	0	p	350037764400015056	0-54						Enhanced cytotoxicity of anti-cd74 and anti-hla-dr antibodies with interferon-gamma	Burton	2012	0		
642	chrII	7477632	7477686	3500304681	54		7477632	7477686	8421504	1	54	0	p	350030468100015039	0-54						Anti-Mucin Antibodies for Early Detection and Treatment of Pancreatic Cancer - Patent application	www.faqs.org	0	0		
642	chrII	7477632	7477686	3500289124	54		7477632	7477686	8421504	1	54	0	p	350028912400015026	0-54						Antibody-Based Depletion of Antigen-Presenting Cells and Dendritic Cells	Chang	2011	0		
642	chrII	7477632	7477686	3500249189	54		7477632	7477686	8421504	1	54	0	p	350024918900015034	0-54						Compositions and Methods of Use of Immunotoxins Comprising Ranpirnase (Rap) Show Potent Cytotoxic Activity - Patent application	www.faqs.org	0	0		
642	chrII	7477632	7477686	3500221336	54		7477632	7477686	8421504	1	54	0	p	350022133600015089	0-54						COMBINATION THERAPY WITH ANTI-CD74 ANTIBODIES PROVIDES ENHANCED TOXICITY TO MALIGNANCIES, AUTOIMMUNE DISEASE AND OTHER DISEASES - IMMUNOMEDICS, INC.	www.sumobrain.com	0	0		
642	chrII	7477632	7477686	3500196739	54		7477632	7477686	8421504	1	54	0	p	350019673900015034	0-54						Anti-HLA-DR Antibodies Suppress Allogeneic and Xenogeneic Immune Responses to Organ Transplants	Sawada	2012	0		
642	chrII	7477632	7477686	3500165028	54		7477632	7477686	8421504	1	54	0	p	350016502800015020	0-54						Delivery System for Cytotoxic Drugs by Bispecific Antibody Pretargeting	Mcbride	2012	0		
642	chrII	7477632	7477686	3500147691	54		7477632	7477686	8421504	1	54	0	p	350014769100015089	0-54						Combination Therapy With Anti-CD74 Antibodies Provides Enhanced Toxicity to Malignancies, Autoimmune Disease and Other Diseases	Chang	2011	0		
642	chrII	7477632	7477686	3500111111	54		7477632	7477686	8421504	1	54	0	p	350011111100015039	0-54						Compositions and methods of use of immunotoxins comprising ranpirnase (rap) show potent cytotoxic activity	Chang	2012	0		
642	chrII	7477632	7477686	3500100255	54		7477632	7477686	8421504	1	54	0	p	350010025500015026	0-54						Dock-and-lock (dnl) complexes for delivery of interference rna	Chang	2012	0		
642	chrII	7477632	7477686	3500096413	54		7477632	7477686	8421504	1	54	0	p	350009641300015026,350009641300015136	0-54,0-48						Delivery System for Cytotoxic Drugs by Bispecific Antibody Pretargeting - Patent application	www.faqs.org	0	0		
642	chrII	7477632	7477686	3500089169	54		7477632	7477686	8421504	1	54	0	p	350008916900015039	0-54						Antibody-Based Depletion of Antigen-Presenting Cells and Dendritic Cells - Patent application	www.faqs.org	0	0		
642	chrII	7477632	7477686	3500080236	54		7477632	7477686	8421504	1	54	0	p	350008023600015089	0-54						Combination Therapy With Anti-CD74 Antibodies Provides Enhanced Toxicity to Malignancies, Autoimmune Disease and Other Diseases	Chang	2011	0		
642	chrII	7477632	7477686	3500036974	54		7477632	7477686	8421504	1	54	0	p	350003697400015026	0-54						Delivery System for Cytotoxic Drugs by Bispecific Antibody Pretargeting - Patent application	www.faqs.org	0	0		
642	chrII	7481140	7483046	3500418219	810		7481140	7483046	8421504	10	132,87,47,67,177,123,93,41,16,27	0,186,294,692,801,1033,1219,1315,1860,1879	p	350041821900015188,350041821900015153,350041821900015152,350041821900015107,350041821900015106,350041821900015037	0-219,0-108,0-90,0-69,0-159,0-165						Avertissement	www.sb-roscoff.fr	0	0		
642	chrII	7481140	7483046	3500386488	810		7481140	7483046	8421504	10	132,87,47,67,177,123,93,41,16,27	0,186,294,692,801,1033,1219,1315,1860,1879	p	350038648800015188,350038648800015153,350038648800015152,350038648800015107,350038648800015106,350038648800015037	0-219,0-108,0-90,0-69,0-159,0-165						Avertissement	www.sb-roscoff.fr	0	0		
642	chrII	7489056	7489083	3500021688	26		7489056	7489083	8421504	2	5,21	0,6	c	350002168800000007	1-29			10.1101/gr.50823006		Genome Research	Genomic clusters, putative pathogen recognition molecules, and antimicrobial genes are induced by infection of C. elegans with M. nematophilum	Delia	2006	0		
642	chrII	7495993	7496022	3500004289	25		7495993	7496022	8421504	3	5,5,15	0,6,14	g	350000428900000008	9-34						Glutamine-rich maize seed protein and promoter	Si Ke Te *Bei Ci 	2007	0		
642	chrII	7497110	7497137	3500403017	23		7497110	7497137	8421504	3	5,6,12	0,7,15	c	350040301700000573	9-33						US Patent # 6,943,281. Expression of Cry3B insecticidal protein in plants - Patents.com	www.patents.com	0	0		
642	chrII	7497110	7497137	3500354932	23		7497110	7497137	8421504	3	5,6,12	0,7,15	c	350035493200000582,350035493200000539	9-33,3-27						<HTML><HEAD><meta http-equiv="Content-Type" content="text/html; charset=ISO-8859-1"><LINK REL="SHORT	.economie.fgov.be	0	0		
642	chrII	7497110	7497137	3500077533	23		7497110	7497137	8421504	3	5,6,12	0,7,15	c	350007753300000573	9-33						Expression of Cry3B insecticidal protein in plants - Patent # 6943281 - PatentGenius	.patentgenius.com	0	0		
642	chrII	7497903	7497930	3500274224	24		7497903	7497930	8421504	3	5,13,6	0,6,21	c	350027422400000022	1-25						Rho GTPasen der RhoBTB Familie: Charakterisierung und Rolle in der Tumorentstehung	www.uni-koeln.de	0	0		
642	chrII	7527976	7531134	3500147967	42		7527976	7531134	8421504	2	21,21	0,3137	c,g	350014796700000017,350014796700000017,350014796700000018	0-21,0-21,0-21		15084461	10.1242/dev.01068	0950-1991	Development	Hormonal signals produced by DAF-9/cytochrome P450 regulate C. elegans dauer diapause in response to environmental cues	Gerisch	2004	7		
642	chrII	7527976	7531134	3500139598	42		7527976	7531134	8421504	2	21,21	0,3137	c,g	350013959800000017,350013959800000017,350013959800000018	0-21,0-21,0-21		15084461	10.1242/dev.01068	0950-1991	Development	Hormonal signals produced by DAF-9/cytochrome P450 regulate C. elegans dauer diapause in response to environmental cues	Gerisch	2004	7		
642	chrII	7550207	7550232	3500268769	23		7550207	7550232	8421504	3	4,6,13	0,5,12	g	350026876900000002	1-24						Kinolon Dirençli Escherichia coli ve Klebsiella spp. Sularında Direnç Genlerinin Aratırılması	ww.tmc-online.org	0	0		
642	chrII	7550349	7550377	3500140825	28		7550349	7550377	8421504	1	28	0	c	350014082500000013	37-65		16291940	10.1523/JNEUROSCI.3399-05.2005	0270-6474	The Journal of Neuroscience	The G-Protein-Coupled Serotonin Receptor SER-1 Regulates Egg Laying and Male Mating Behaviors in Caenorhabditis elegans	Carnell	2005	7		
643	chrII	7614275	7614331	3500021139	47		7614275	7614331	8421504	2	23,24	0,32	c,g	350002113900000000,350002113900000000,350002113900000001,350002113900000001	0-23,0-23,0-24,0-24		20686701	10.1371/journal.pone.0011885		PLoS ONE	sel-11 and cdc-42, Two Negative Modulators of LIN-12/Notch Activity in C. elegans	Min	2010	0		
643	chrII	7616408	7617434	3500003937	42		7616408	7617434	8421504	2	19,23	0,1003	c,g	350000393700000018,350000393700000018,350000393700000019	0-19,0-19,6-29		22615577	10.1371/journal.pgen.1002663	1553-7404	PLOS Genetics	PLOS Genetics: Integrin α PAT-2/CDC-42 Signaling Is Required for Muscle-Mediated Clearance of Apoptotic Cells in Caenorhabditis elegans	Hsieh	2012	0		
643	chrII	7616408	7616440	3500457479	32		7616408	7616440	8421504	1	32	0	c	350045747900000002	0-32		23390595	10.1534/g3.112.004416		G3: Genes|Genomes|Genetics	Redundant Canonical and Noncanonical Caenorhabditis elegans p21-Activated Kinase Signaling Governs Distal Tip Cell Migrations	Eldon	2013	0		
643	chrII	7616411	7616456	3500009992	45		7616411	7616456	8421504	1	45	0	p	350000999200015106	0-45						Assays and reagents for identifying anti-fungal agents, and uses related thereto	Berlin	1998	0		CDC42
643	chrII	7616695	7616939	3500463133	48		7616695	7616939	8421504	2	24,24	0,220	c,g	350046313300000027,350046313300000027,350046313300000028,350046313300000028	0-24,0-24,0-24,0-24						RNA Helicase 1 interacts with an ABC Transporter: Genetic Interactions with haf-6	holarworks.ku.edu	0	0		
643	chrII	7616977	7617352	3500115158	24		7616977	7617352	8421504	3	8,7,9	0,13,366	c	350011515800000205,350011515800000155	13-37,19-43						 Modulation Of Apolipoprotein (a) Expression 	www.docstoc.com	0	0		
643	chrII	7616977	7617352	3500034199	24		7616977	7617352	8421504	3	8,7,9	0,13,366	c	350003419900000101	22-46						MODULATION OF APOLIPOPROTEIN (a) EXPRESSION - Patent application	www.faqs.org	0	0		
643	chrII	7620014	7620041	3500074991	26		7620014	7620041	8421504	2	6,20	0,7	c,g	350007499100005610,350007499100005610	13-39,13-39							www.dartmouth.edu	0	0		
643	chrII	7624175	7624200	3500312037	23		7624175	7624200	8421504	2	15,8	0,17	g	350031203700000364	0-23						TARGETED WHOLE GENOME AMPLIFICATION METHOD FOR IDENTIFICATION OF PATHOGENS - Patent application	www.faqs.org	0	0		
643	chrII	7624564	7635468	3500196959	38		7624564	7635468	8421504	3	19,5,14	0,10884,10890	g	350019695900001414,350019695900001288	21-40,17-36						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
643	chrII	7628018	7642021	3500368335	63		7628018	7642021	8421504	2	27,36	0,13967	c,g	350036833500000003,350036833500000002,350036833500000002	37-64,21-57,21-57		20647544	10.1128/MCB.01193-09	0270-7306	Molecular and Cellular Biology	Evolutionarily Conserved Role of Calcineurin in Phosphodegron-Dependent Degradation of Phosphodiesterase 4D	Zhu	2010	6		
643	chrII	7628018	7642021	3500128516	63		7628018	7642021	8421504	2	27,36	0,13967	c,g	350012851600000003,350012851600000002,350012851600000002	37-64,21-57,21-57		20647544	10.1128/MCB.01193-09		Molecular and Cellular Biology	Evolutionarily Conserved Role of Calcineurin in Phosphodegron-Dependent Degradation of Phosphodiesterase 4D 	Hong	2010	0		
643	chrII	7633087	7633118	3500369079	25		7633087	7633118	8421504	3	11,6,8	0,15,23	c	350036907900000446	7-32						<Html><Title> Complet list of 1omo hssp file Complet list of	cnptia.embrapa.br	0	0		LTBP1
643	chrII	7635329	7635354	3500367838	25		7635329	7635354	8421504	1	25	0	g	350036783800000315	0-25						 <HTML> <HEAD><TITLE>Show BLAST File 
 
  
 aooa*Y=aa(c)a3a1aa3/4a3ac"aaeoa1/4aaC/a1ae1ae3 - c1ea13i1/4i1/4	www.j-tokkyo.com	0	0		
644	chrII	7752763	7754516	3500088138	85		7752763	7754516	8421504	4	21,21,21,22	0,652,703,1731	c,g	350008813800000002,350008813800000002,350008813800000008,350008813800000000,350008813800000000,350008813800000007,350008813800000001,350008813800000001,350008813800000003	0-21,0-21,13-34,0-21,0-21,9-30,0-20,0-20,8-30						ScienceDirect.com - FEBS Letters - Lifespan decrease in a Caenorhabditis elegans mutant lacking TRX-1, a thioredoxin expressed in ASJ sensory neurons	sciencedirect.com	0	0		
644	chrII	7752763	7754515	3500242365	44		7752763	7754515	8421504	2	23,21	0,1731	c,g	350024236500000003,350024236500000007,350024236500000002	7-30,10-32,9-30		21533086	10.1371/journal.pone.0018766	1932-6203	PLOS ONE	PLOS ONE: Optogenetic Long-Term Manipulation of Behavior and Animal Development	Schultheis	2011	4		
644	chrII	7752766	7753391	3500020470	300		7752766	7753391	8421504	3	66,72,162	0,120,463	p	350002047000015019	45-345						peer-00479227, version 1 - 30 Apr 2010 Accepted Manuscript	peer.ccsd.cnrs.fr	0	0		
644	chrII	7756954	7774767	3500253796	45		7756954	7774767	8421504	5	14,5,4,14,8	0,15,17784,17789,17805	c,g	350025379600000643,350025379600000583	11-30,0-26					Patent	Enhancement of influenza gene expression (Patent US:8227188)	Fougerolles	2012	0		
644	chrII	7756954	7774767	3500241875	45		7756954	7774767	8421504	5	14,5,4,14,8	0,15,17784,17789,17805	c,g	350024187500000643,350024187500000583	11-30,0-26					Patent	Enhancement of influenza gene expression (Patent US:8227188)	Fougerolles	2012	0		
644	chrII	7756954	7774767	3500070088	45		7756954	7774767	8421504	5	14,5,4,14,8	0,15,17784,17789,17805	c,g	350007008800000643,350007008800000583	11-30,0-26						RNAI INHIBITION OF INFLUENZA VIRUS REPLICATION	Fougerolles	2006	0		
644	chrII	7774660	7774700	3500432696	31		7774660	7774700	8421504	3	6,13,12	0,11,28	c	350043269600000011	9-40						in Cancer Cells1,2	www.neoplasia.com	0	0		
644	chrII	7774738	7774767	3500284394	26		7774738	7774767	8421504	3	4,14,8	0,5,21	c	350028439400000583	0-26						RNAi INHIBITION OF INFLUENZA VIRUS REPLICATION	Fougerolles	2011	0		
644	chrII	7774738	7774767	3500068199	26		7774738	7774767	8421504	3	4,14,8	0,5,21	c	350006819900000583	0-26						RNAi INHIBITION OF INFLUENZA VIRUS REPLICATION - Patent application	www.faqs.org	0	0		
644	chrII	7774738	7774767	3500019915	26		7774738	7774767	8421504	3	4,14,8	0,5,21	c	350001991500000583	0-26						Rnai Inhibition Of Influenza Virus Replication 	.freshpatents.com	0	0		
644	chrII	7807200	7807225	3500023731	23		7807200	7807225	8421504	2	16,7	0,18	g	350002373100000024	0-30						Cinnamic Acid 4-hydroxylase 	.freshpatents.com	0	0		
644	chrII	7811183	7820723	3500141348	176		7811183	7820723	8421504	8	24,4,19,28,26,22,25,28	0,25,617,1097,1451,5473,9225,9512	c,g	350014134800000006,350014134800000011,350014134800000011,350014134800000002,350014134800000001,350014134800000001,350014134800000008,350014134800000012,350014134800000012,350014134800000003,350014134800000013,350014134800000013	4-32,8-27,8-27,0-28,4-25,4-25,9-29,9-31,9-31,0-25,8-36,8-36						ScienceDirect.com - Developmental Biology - Essential embryonic roles of the CKI-1 cyclin-dependent kinase inhibitor in cell-cycle exit and morphogenesis in C. elegans	sciencedirect.com	0	0		
644	chrII	7811207	7811812	3500375557	46		7811207	7811812	8421504	2	22,24	0,581	c,g	350037555700000008,350037555700000009,350037555700000009	15-37,16-40,16-40		16236764	10.1242/dev.02102	0950-1991	Development	mab-2 encodes RNT-1, a C. elegans Runx homologue essential for controlling cell proliferation in a stem cell-like developmental lineage	Nimmo	2005	7		
644	chrII	7811220	7811797	3500004218	40		7811220	7811797	8421504	2	20,20	0,557	c,g	350000421800000022,350000421800000022,350000421800000023,350000421800000023	0-20,0-20,0-20,0-20		21691303	10.1038/cr.2011.102	1001-0602	Cell Research	mir-35 is involved in intestine cell G1/S transition and germ cell proliferation in C. elegans	Liu	2011	8		
644	chrII	7827361	7827390	3500419821	27		7827361	7827390	8421504	2	21,6	0,23	g	350041982100000004	5-32						Transcription factor: SigX	dbtbs.hgc.jp	0	0		
644	chrII	7860255	7860283	3500196959	25		7860255	7860283	8421504	2	18,7	0,21	g	350019695900001360	9-39						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
645	chrII	7881767	7881791	3500459839	23		7881767	7881791	8421504	2	14,9	0,15	c,g	350045983900000001,350045983900000001	20-43,20-43						An investigation into flavonoid pathway regulation in sweet cherry (Prunus avium L.) fruit	y.adelaide.edu.au	0	0		
645	chrII	7891904	7891929	3500317546	24		7891904	7891929	8421504	2	4,20	0,5	g	350031754600000001	5-29						Extensive apoptosis and abnormal morphogenesis in pro-caspase-3 transgenic zebrafish during development	eb.biologists.org	0	0		
645	chrII	7895664	7899205	3500003632	106		7895664	7899205	8421504	5	21,19,21,24,21	0,103,1092,2760,3520	c,g	350000363200000002,350000363200000002,350000363200000004,350000363200000004,350000363200000000,350000363200000000,350000363200000001,350000363200000001,350000363200000003	0-21,0-21,0-19,0-19,0-21,0-21,0-24,0-24,0-21		10921907	10.1101/gad.14.15.1933	0890-9369	Genes & Development	A C. elegans patched gene, ptc-1, functions in germ-line cytokinesis	Kuwabara	2000	12		
645	chrII	7942416	7942439	3500393909	23		7942416	7942439	8421504	1	23	0	c	350039390900000848	1-24						rec_num ORF_name deletion_alias gene_names UPTAG_sequence	ence.stanford.edu	0	0		
645	chrII	7942416	7942439	3500216944	23		7942416	7942439	8421504	1	23	0	c	350021694400000848	1-24						rec_num ORF_name deletion_alias gene_names UPTAG_sequence	ence.stanford.edu	0	0		
646	chrII	8018910	8018934	3500230330	24		8018910	8018934	8421504	1	24	0	c,g	350023033000000270,350023033000000270,350023033000000391	25-46,25-46,19-40						Method for obtaining the pathogenic resistance in plants	K-H*Ke Ge Er 	2005	0		
646	chrII	8021896	8021941	3500383925	45		8021896	8021941	8421504	1	45	0	p	350038392500015043	0-45						Repressing gene expression in plants	Wu	2000	0		
646	chrII	8038817	8039054	3500061028	180		8038817	8039054	8421504	4	45,45,45,45	0,96,144,192	p	350006102800015102,350006102800015100,350006102800015099,350006102800015098	0-45,0-45,0-45,0-45						COMPOSITIONS AND METHODS FOR DETECTING CANCER METASTASIS - Patent application	www.faqs.org	0	0		
646	chrII	8062699	8065891	3500433273	46		8062699	8065891	8421504	2	22,24	0,3168	c,g	350043327300000000,350043327300000000,350043327300000001	0-22,0-22,0-24			10.1038/ncb1586	1465-7392	Nature Cell Biology	Addenda		2007	19		
646	chrII	8066429	8067753	3500276765	1002		8066429	8067753	8421504	7	192,96,149,91,192,198,84	0,240,384,612,751,991,1240	c,g	350027676500000615,350027676500000616,350027676500000616,350027676500000617,350027676500000618,350027676500000618,350027676500000620,350027676500000620,350027676500000621,350027676500000621,350027676500000623,350027676500000624,350027676500000625,350027676500000626,350027676500000627,350027676500000627,350027676500000629,350027676500000629,350027676500000630,350027676500000630,350027676500000631,350027676500000631,350027676500000632,350027676500000632,350027676500000634,350027676500000634,350027676500000635,350027676500000636,350027676500000637,350027676500000638,350027676500000639,350027676500000639	0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-42,0-42						Products and Methods Related to Mono-Methyl Branched-Chain Fatty Acids - Patent application	www.faqs.org	0	0		
646	chrII	8091656	8091729	3500288532	73		8091656	8091729	8421504	1	73	0	c,g	350028853200000001,350028853200000001	0-73,0-73						ScienceDirect.com - Genomics - A combined computational and experimental analysis of two families of snoRNA genes from Caenorhabditis elegans, revealing the expression and evolution pattern of snoRNAs in nematodes	sciencedirect.com	0	0		
646	chrII	8092268	8092292	3500120416	23		8092268	8092292	8421504	2	18,5	0,19	c	350012041600000004	6-29						<HTML> <HEAD> <TITLE>CSM_Contig cDNA Contig-U03272-1   
Homology Contig-U03	iol.tsukuba.ac.jp	0	0		
646	chrII	8095850	8095877	3500156527	25		8095850	8095877	8421504	2	13,12	0,15	g	350015652700000000	5-30						2013 OPEN ACCESS sensors	www.mdpi.com	0	0		
646	chrII	8113325	8113570	3500387183	50		8113325	8113570	8421504	2	24,26	0,219	c,g	350038718300000002,350038718300000002,350038718300000003,350038718300000003	0-24,0-24,0-26,0-26		20733002	10.1128/MCB.00922-10	0270-7306	Molecular and Cellular Biology	Protein Misfolding Induces Hypoxic Preconditioning via a Subset of the Unfolded Protein Response Machinery	Mao	2010	6		
646	chrII	8124022	8125035	3500460501	72		8124022	8125035	8421504	3	24,25,23	0,533,990	c,g	350046050100000037,350046050100000037,350046050100000038,350046050100000039	0-24,0-24,0-25,4-27						Mechanismus der Neuroserpin-Demenz an einem Caenorhabditis elegans-Modell (Maupas, 1900) Dougherty, 1953	ub.uni-hamburg.de	0	0		
647	chrII	8132224	8132249	3500327571	24		8132224	8132249	8421504	2	19,5	0,20	g	350032757100000104	5-31						Method For Detecting Polypeptide Toxic to Diabrotica Insects - Patent application	www.faqs.org	0	0		
647	chrII	8134845	8134873	3500436341	23		8134845	8134873	8421504	3	12,6,5	0,14,23	c	350043634100000002	1-24						TABLE S2 Primer-pairs used in this study	www.docstoc.com	0	0		
647	chrII	8141532	8141562	3500294433	24		8141532	8141562	8421504	3	6,5,13	0,9,17	g	350029443300000149	22-46						Polypeptide compositions toxic to anthonomus insects, and methods of use	Isaac	2001	0		
647	chrII	8154617	8159991	3500274120	87		8154617	8159991	8421504	4	21,20,23,23	0,3090,5323,5351	c,g	350027412000000005,350027412000000004,350027412000000012,350027412000000012,350027412000000008	0-21,0-20,0-23,0-23,0-23						C. elegans tubby regulates life span and fat storage by two independent mechanisms 10.1016/j.cmet.2005.06.004 : Cell Metabolism | ScienceDirect.com	sciencedirect.com	0	0		
647	chrII	8154617	8159991	3500099218	109		8154617	8159991	8421504	5	21,22,20,23,23	0,104,3090,5323,5351	c,g	350009921800000005,350009921800000009,350009921800000009,350009921800000004,350009921800000004,350009921800000012,350009921800000012,350009921800000008,350009921800000008	0-21,24-46,24-46,0-20,0-20,0-23,0-23,0-23,0-23						CiteULike: regulates life span and fat storage by two independent mechanisms	www.citeulike.org	0	0		
647	chrII	8154750	8154920	3500249133	100		8154750	8154920	8421504	2	50,50	0,120	c,g	350024913300000008,350024913300000008,350024913300000009,350024913300000009	0-50,0-50,0-50,0-50							roarrays.ucsd.edu	0	0		
647	chrII	8162552	8162852	3500363503	42		8162552	8162852	8421504	2	21,21	0,279	c,g	350036350300000022,350036350300000022,350036350300000023,350036350300000023	0-21,0-21,0-21,0-21						The Society of Nematologists 2008. Effects of Ivermectin and Moxidectin on the Transcription of Genes Coding for Multidrug Resistance Associated Proteins and Behaviour in Caenorhabditis elegans	oneandoneshop.com	0	0		
647	chrII	8165554	8165704	3500237209	150		8165554	8165704	8421504	1	150	0	c,g	350023720900000070,350023720900000010,350023720900000071,350023720900000071,350023720900000011,350023720900000011	30-115,30-120,29-115,29-115,29-120,29-120						US Patent # 7,582,475. Vectors and methods for high throughput co-expression - Patents.com	www.patents.com	0	0		
647	chrII	8165554	8165704	3500108443	150		8165554	8165704	8421504	1	150	0	c,g	350010844300000010,350010844300000011,350010844300000011	30-120,29-120,29-120						Vectors and methods for high throughput co-expression	Horanyi	2006	0		
647	chrII	8165554	8165704	3500069311	150		8165554	8165704	8421504	1	150	0	c,g	350006931100000010,350006931100000053,350006931100000011,350006931100000011,350006931100000054,350006931100000054	30-120,30-120,29-120,29-120,29-120,29-120						VECTORS AND METHODS FOR HIGH THROUGHPUT CO-EXPRESSIONS - Patent application	www.faqs.org	0	0		
647	chrII	8165554	8165704	3500002349	150		8165554	8165704	8421504	1	150	0	c,g	350000234900000010,350000234900000011,350000234900000011	30-120,29-120,29-120						Vectors and methods for high throughput co-expression	Horanyi	2006	0		
647	chrII	8168463	8168496	3500166947	33		8168463	8168496	8421504	1	33	0	g	350016694700000002	0-33						Vectors and methods for providing cells with additional nucleic acid material integrated in the genome of said cells	Plasterk	1997	0		
647	chrII	8178829	8178856	3500178220	24		8178829	8178856	8421504	2	18,6	0,21	c	350017822000000194	5-29						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
647	chrII	8178874	8178903	3500068155	24		8178874	8178903	8421504	3	14,4,6	0,15,23	c	350006815500000184	0-24						AMPLIFICATION DYNAMICS OF PRIMATE RETROTRANSPOSONS	etd.lsu.edu	0	0		
647	chrII	8183388	8183415	3500080694	24		8183388	8183415	8421504	3	14,4,6	0,15,21	g	350008069400000255	8-35						MIXING AND MATCHING TC PROTEINS FOR PEST CONTROL - Patent application	www.faqs.org	0	0		
647	chrII	8185372	8185433	3500441662	43		8185372	8185433	8421504	2	24,19	0,42	c,g	350044166200000000,350044166200000001,350044166200000001	0-24,0-19,0-19					Aging (Albany NY)	cep-1/p53-dependent dysplastic pathology of the aging C. elegans gonad	Mathew	2012	0		
647	chrII	8185905	8185929	3500291156	23		8185905	8185929	8421504	2	9,14	0,10	c	350029115600000833	11-34						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
647	chrII	8185905	8185929	3500274310	23		8185905	8185929	8421504	2	9,14	0,10	c	350027431000000450	12-35						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
647	chrII	8185996	8186019	3500340975	23		8185996	8186019	8421504	1	23	0	g	350034097500000022	14-40						Synthetic insecticidal gene, plants of the genus oryza transformed with the gene, and production thereof	Fujimoto	1992	0		
647	chrII	8186626	8186725	3500401546	40		8186626	8186725	8421504	2	20,20	0,79	c,g	350040154600000002,350040154600000002,350040154600000003,350040154600000003	0-20,0-20,0-20,0-20			10.1111/j.1474-9726.2007.00273.x	1474-9726	Aging Cell	Dramatic age-related changes in nuclear and genome copy number in the nematode Caenorhabditis elegans - Golden - 2007 - Aging Cell - Wiley Online Library	Golden	2007	0		
647	chrII	8215443	8215727	3500252796	23		8215443	8215727	8421504	2	19,4	0,280	c	350025279600000027	10-37						METHODS AND COMPOSITIONS FOR PREVENTION OR TREATMENT OF RSV INFECTION	Vaishnaw	2008	0		
647	chrII	8215443	8215727	3500179508	23		8215443	8215727	8421504	2	19,4	0,280	c	350017950800000030	10-37						Methods and Compositions for Prevention or Treatment of RSV Infection Using Modified Duplex RNA Molecules - Patent application	www.faqs.org	0	0		
647	chrII	8215443	8215727	3500147965	23		8215443	8215727	8421504	2	19,4	0,280	c	350014796500000027	10-37						Methods and compositions for prevention or treatment of RSV infection (патент US № 8410073)	www.freepatent.ru	0	0		
647	chrII	8217203	8221370	3500095830	267		8217203	8221370	8421504	11	22,19,20,57,22,22,20,20,20,20,25	0,279,1077,1473,1648,1676,1979,2923,3588,3965,4142	c,g	350009583000000010,350009583000000010,350009583000000005,350009583000000005,350009583000000020,350009583000000020,350009583000000017,350009583000000017,350009583000000014,350009583000000014,350009583000000008,350009583000000007,350009583000000007,350009583000000011,350009583000000012,350009583000000021,350009583000000021,350009583000000018,350009583000000018,350009583000000009,350009583000000009,350009583000000013,350009583000000013,350009583000000016,350009583000000016,350009583000000019	0-22,0-22,9-31,9-31,0-22,0-22,0-19,0-19,0-20,0-20,0-57,0-24,0-24,0-21,0-21,0-22,0-22,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-25		21909434	10.1371/journal.pone.0024444		PLoS ONE	Cap-Independent Translation Promotes C. elegans Germ Cell Apoptosis through Apaf-1/CED-4 in a Caspase-Dependent Mechanism	Vince	2011	0		
647	chrII	8217447	8220811	3500337452	214		8217447	8220811	8421504	9	20,51,22,20,20,21,20,20,20	0,404,713,800,833,919,1300,1735,3344	p,c,g	350033745200000002,350033745200000002,350033745200015000,350033745200000003,350033745200000003,350033745200000000,350033745200000000,350033745200000008,350033745200000008,350033745200000009,350033745200000009,350033745200000004,350033745200000004,350033745200000005,350033745200000005,350033745200000001,350033745200000001	0-20,0-20,0-51,0-22,0-22,0-20,0-20,0-20,0-20,0-21,0-21,0-20,0-20,0-20,0-20,0-20,0-20		18451872	10.1038/cdd.2008.46	1350-9047	Cell Death & Differentiation	Depletion of the cap-associated isoform of translation factor eIF4G induces germline apoptosis in C. elegans	Contreras	2008	9		
647	chrII	8226911	8227348	3500408792	384		8226911	8227348	8421504	2	42,342	0,95	p	350040879200015271,350040879200015272,350040879200015273,350040879200015274,350040879200015275,350040879200015276,350040879200015277,350040879200015278	0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48						Engulfment gene and uses thereof	Liu	1998	0		
647	chrII	8240342	8240370	3500317663	28		8240342	8240370	8421504	1	28	0	g	350031766300000020	27-55						The C. elegans Heterochronic Gene lin-4 Encodes Small RNAs with Antisense Complementarity to &II-14	.microbio.uab.edu	0	0		
647	chrII	8242989	8243628	3500197656	105		8242989	8243628	8421504	2	57,48	0,591	p	350019765600015068,350019765600015070	0-57,0-48						Karakterisatie van neuromedine U-, tachykinine- en GnRH-verwante receptoren	w.scriptiebank.be	0	0		
648	chrII	8278374	8278546	3500294355	62		8278374	8278546	8421504	2	26,36	0,136	g	350029435500000008,350029435500000011	11-37,0-36		21156961	10.1261/rna.2447111	1355-8382	RNA	Identification of transcription start sites of trans-spliced genes: Uncovering unusual operon arrangements	Morton	2011	5		
648	chrII	8279458	8279488	3500243691	25		8279458	8279488	8421504	2	7,18	0,12	c,g	350024369100003339,350024369100003339	9-38,9-38						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
648	chrII	8279686	8362248	3500030766	62		8279686	8362248	8421504	5	5,16,20,8,13	0,6,44029,82538,82549	c,g	350003076600003727,350003076600003963,350003076600000905	16-37,7-28,0-23						>vs_0 TACCAACAGCTACTCCCATGCAAAGCACTTTCTTAAGCTGGAATTTGACCATAGCCTTAGT >vs_1 AGTAACCGCGATTCCAACACAAA	biomedcentral.com	0	0		
648	chrII	8281418	8282344	3500405797	41		8281418	8282344	8421504	2	20,21	0,905	c	350040579700000002,350040579700000000	20-40,19-40		18725931	10.1371/journal.pgen.1000181	1553-7404	PLOS Genetics	PLOS Genetics: C. elegans Nucleostemin Is Required for Larval Growth and Germline Stem Cell Division	Kudron	2008	0		
648	chrII	8327156	8327577	3500358534	38		8327156	8327577	8421504	2	19,19	0,402	c,g	350035853400000013,350035853400000013,350035853400000012,350035853400000012	0-19,0-19,0-19,0-19			10.1261/rna.5420503		RNA	The Ref/Aly proteins are dispensable for mRNA export and development in Caenorhabditis elegans	DASA	July	0		
648	chrII	8348975	8349006	3500075905	25		8348975	8349006	8421504	3	12,6,7	0,16,24	g	350007590500000035	0-25					Patent	转录因子 (Patent CN:100432099)	T*Ke Li Si Tan Sen 	2008	0		
648	chrII	8359963	8359992	3500105817	23		8359963	8359992	8421504	3	6,5,12	0,11,17	g	350010581700000661	0-24							www.ars.usda.gov	0	0		
648	chrII	8364228	8367753	3500078871	80		8364228	8367753	8421504	4	20,20,20,20	0,161,3257,3505	c,g	350007887100000000,350007887100000000,350007887100000002,350007887100000002,350007887100000003,350007887100000003,350007887100000001	0-20,0-20,0-20,0-20,0-20,0-20,0-20						Caenorhabditis Genetics Center | University of Minnesota	w.cgc.cbs.umn.edu	0	0		
649	chrII	8393515	8393595	3500195762	80		8393515	8393595	8421504	1	80	0	g	350019576200000007	0-80						Statistical Inference for Well-ordered Structures in Nucleotide Sequences	nces.computer.org	0	0		
649	chrII	8393565	8393589	3500425488	24		8393565	8393589	8421504	1	24	0	c	350042548800000003	0-24						Modulating XRN2 - NOVARTIS FORSCHUNGSSTIFTUNG, ZWEIGNIEDERLASSUNG, FRIEDRICH MIESCHER INSITITUTE FOR BIOMEDICAL RESEARCH	www.sumobrain.com	0	0		
649	chrII	8393565	8393589	3500219292	24		8393565	8393589	8421504	1	24	0	c,g	350021929200000003,350021929200000003	0-24,0-24						Active turnover modulates mature microRNA activity in Caenorhabditis elegans	rnajc.ucsf.edu	0	0		
649	chrII	8418469	8419657	3500166754	43		8418469	8419657	8421504	2	20,23	0,1165	c,g	350016675400000007,350016675400000007,350016675400000001	0-20,0-20,21-44						FAQ - C. elegans Mos1 techniques - Jorgensen Lab	sites.google.com	0	0		
649	chrII	8418748	8420629	3500353929	41		8418748	8420629	8421504	2	21,20	0,1861	c,g	350035392900000003,350035392900000003,350035392900000000	0-21,0-21,0-20						The neogenin/DCC homolog UNC-40 promotes BMP signaling via the RGM protein DRAG-1 in C. elegans	ev.biologists.org	0	0		
649	chrII	8419925	8420301	3500121931	40		8419925	8420301	8421504	2	20,20	0,356	g	350012193100000002,350012193100000003	0-20,0-20						Supporting Online Material for	mcb.berkeley.edu	0	0		
649	chrII	8443828	8445204	3500044932	98		8443828	8445204	8421504	4	26,32,20,20	0,427,1188,1356	c,g	350004493200000035,350004493200000035,350004493200000037,350004493200000037,350004493200000011,350004493200000011,350004493200000013,350004493200000013,350004493200000038,350004493200000012,350004493200000036	0-20,0-20,11-32,11-32,0-22,0-22,0-21,0-21,12-32,0-20,0-20						Functional genomic analysis of the ADP-ribosylation factor family of GTPases: phylogeny among diverse eukaryotes and function in C. elegans	biology.uiowa.edu	0	0		
649	chrII	8457794	8459466	3500462632	54		8457794	8459466	8421504	2	28,26	0,1646	c,g	350046263200000000,350046263200000000,350046263200000001,350046263200000001	3-31,3-31,2-28,2-28		16971515	10.1091/mbc.E06-02-0107	1059-1524	Molecular Biology of the Cell	LET-711, the Caenorhabditis elegans NOT1 Ortholog, Is Required for Spindle Positioning and Regulation of Microtubule Length in Embryos	DeBella	2006	5		
649	chrII	8458301	8458445	3500188994	144		8458301	8458445	8421504	1	144	0	p	350018899400015028	0-144						NPG.nature.vol.411.Issue.6837.May	www.scribd.com	0	0		
649	chrII	8458833	8458857	3500414022	24		8458833	8458857	8421504	1	24	0	c,g	350041402200000007,350041402200000007	22-46,22-46		15616189	10.1091/mbc.E04-08-0712	1059-1524	Molecular Biology of the Cell	A Spindle Checkpoint Functions during Mitosis in the Early Caenorhabditis elegans Embryo	Encalada	2005	5		
649	chrII	8506341	8506365	3500068176	23		8506341	8506365	8421504	2	18,5	0,19	g	350006817600000100	17-40						COMPOSITIONS AND METHODS FOR THE SUPPRESSION OF TARGET POLYNUCLEOTIDES FROM LEPIDOPTERA - Patent application	www.faqs.org	0	0		
650	chrII	8520880	8523383	3500402526	1860		8520880	8523383	8421504	9	42,90,108,98,375,70,549,361,167	0,357,487,653,792,1218,1339,1929,2336	p	350040252600015184,350040252600015096,350040252600015097,350040252600015100,350040252600015102,350040252600015105,350040252600015107,350040252600015109,350040252600015112,350040252600015147,350040252600015114,350040252600015148,350040252600015116,350040252600015152	36-1899,27-129,0-90,0-177,0-177,0-180,0-180,0-180,0-180,0-63,0-180,0-78,0-180,0-63						Identification moléculaire d’une chitinase CHT-1, sa localisation et son rôle chez le nématode Caenorhabditis elegans	doc.rero.ch	0	0		
650	chrII	8547156	8560716	3500288532	202		8547156	8560716	8421504	2	131,71	0,13489	c,g	350028853200000026,350028853200000000,350028853200000000	1-132,0-71,0-71						ScienceDirect.com - Genomics - A combined computational and experimental analysis of two families of snoRNA genes from Caenorhabditis elegans, revealing the expression and evolution pattern of snoRNAs in nematodes	sciencedirect.com	0	0		
650	chrII	8559880	8559905	3500038735	24		8559880	8559905	8421504	2	14,10	0,15	c	350003873500000849	8-32						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
650	chrII	8560144	8560793	3500013566	63		8560144	8560793	8421504	2	45,18	0,631	p	350001356600015024,350001356600015179	0-54,0-45						NEOEPITOPE DETECTION OF DISEASE USING PROTEIN ARRAYS - Patent application	www.faqs.org	0	0		
650	chrII	8560162	8560793	3500277788	45		8560162	8560793	8421504	2	27,18	0,613	p	350027778800015021	0-45						Nucleic acids, polypeptides, and methods for modulating apoptosis - US Patent 7217517 Description	ww.patentstorm.us	0	0		
650	chrII	8560162	8560793	3500252714	45		8560162	8560793	8421504	2	27,18	0,613	p	350025271400015100	3-48						Inhibition of Apoptosis-Specific eIF-5A(elF-5A1") with Antisense Oligonucleotides and siRNA as Anti-Inflammatory Therapeutics - Patent application	www.faqs.org	0	0		
650	chrII	8568921	8568944	3500375490	23		8568921	8568944	8421504	1	23	0	c	350037549000000553,350037549000000602	5-28,5-28						PHYLOGENETIC RELATIONSHIPS IN THE FAMILY AMARYLLIDACEAE	etd.uovs.ac.za	0	0		
650	chrII	8570020	8570172	3500354245	100		8570020	8570172	8421504	2	50,50	0,102	c,g	350035424500000010,350035424500000010	0-100,0-100						perl程序提取数字和相应内容_百度知道	zhidao.baidu.com	0	0		
650	chrII	8581334	8582597	3500044932	70		8581334	8582597	8421504	3	20,19,31	0,638,1232	c,g	350004493200000033,350004493200000009,350004493200000009,350004493200000010,350004493200000010,350004493200000008,350004493200000008	12-32,0-19,0-19,0-20,0-20,0-19,0-19						Functional genomic analysis of the ADP-ribosylation factor family of GTPases: phylogeny among diverse eukaryotes and function in C. elegans	biology.uiowa.edu	0	0		
650	chrII	8582000	8582133	3500051274	87		8582000	8582133	8421504	2	69,18	0,115	p	350005127400015001	3-90						The Arflike Gene Encodes an Essential GTP-Binding Protein in Drosophila	www.jstor.org	0	0		
650	chrII	8599239	8599264	3500098009	23		8599239	8599264	8421504	2	13,10	0,15	g	350009800900000067	3-26						PROSTATE-SPECIFIC POLYPEPTIDE PAMP AND ENCODING NUCLEIC ACID MOLECULES - Patent application	www.faqs.org	0	0		
650	chrII	8607154	8607427	3500372641	48		8607154	8607427	8421504	2	18,30	0,243	p	350037264100015013	0-48						Isolated Ptpmt1 Protein Which Mediates Insulin Production And Uses Thereof 	.freshpatents.com	0	0		
650	chrII	8625845	8627057	3500292820	159		8625845	8627057	8421504	3	29,99,31	0,998,1181	p	350029282000015075,350029282000015076	60-174,0-45						Lipopeptides for delivery of nucleic acids	Adami	2010	0		
650	chrII	8625845	8627057	3500100022	159		8625845	8627057	8421504	3	29,99,31	0,998,1181	p	350010002200015079	0-159						Peptide-dicer substrate rna conjugates as delivery vehicles for sirna	Ahmadian	2007	0		
650	chrII	8626853	8627057	3500208064	120		8626853	8627057	8421504	2	89,31	0,173	p	350020806400015033	0-120						COMPOSITIONS AND METHODS FOR LIPID AND POLYPEPTIDE BASED siRNA INTRACELLULAR DELIVERY	Cui	2007	0		
650	chrII	8636692	8636720	3500078842	24		8636692	8636720	8421504	2	6,18	0,10	g	350007884200000142	6-30						 Complet list of 3exb hssp file Complet list of	cnptia.embrapa.br	0	0		
651	chrII	8670354	8670380	3500168547	24		8670354	8670380	8421504	3	4,6,14	0,5,12	c	350016854700000567	0-24						Periphere CD4-positive T-Zellantworten bei	opus4.kobv.de	0	0		
651	chrII	8670539	8670621	3500046319	23		8670539	8670621	8421504	3	12,5,6	0,70,76	c	350004631900000001	0-23		22055502	10.1016/j.cmet.2011.09.012		Cell metabolism	Dissociation of the glucose and lipid regulatory functions of FoxO1 by targeted knock-in of acetylation-defective alleles in mice	Alexander	2011	0		
651	chrII	8670603	8670629	3500007448	23		8670603	8670629	8421504	2	8,15	0,11	g	350000744800000330	0-23						<HTML><HEAD><meta http-equiv="Content-Type" content="text/html; charset=ISO-8859-1"><LINK REL="SHORT	.economie.fgov.be	0	0		
651	chrII	8679383	8724808	3500245053	39		8679383	8724808	8421504	4	6,13,12,8	0,10,45401,45417	c,g	350024505300000943,350024505300002321,350024505300002321	14-33,0-20,0-20						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
651	chrII	8698732	8701379	3500370054	82		8698732	8701379	8421504	5	20,20,21,16,5	0,108,1998,2083,2642	c,g	350037005400000003,350037005400000003,350037005400000002,350037005400000002,350037005400000001,350037005400000001,350037005400000000	0-20,0-20,0-20,0-20,0-21,0-21,0-21						Methods for prolonging the health benefits triggered by a dietary restriction using a sphingosine kinase inhibitor	Aguilaniu	2010	0		
651	chrII	8699282	8701426	3500061014	1053		8699282	8701426	8421504	13	96,27,117,207,107,70,144,48,77,19,92,1,48	0,111,184,325,635,789,919,1066,1289,1417,1457,1636,2096	p	350006101400015206,350006101400015205,350006101400015193,350006101400015192,350006101400015191,350006101400015203,350006101400015202,350006101400015201,350006101400015190,350006101400015189,350006101400015188,350006101400015200,350006101400015199,350006101400015187,350006101400015186,350006101400015185,350006101400015197,350006101400015195,350006101400015194,350006101400015184,350006101400015183,350006101400015182	0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,3-48,0-48						Sphingosine kinase enzyme	Pitson	2002	0		
651	chrII	8700255	8700766	3500100361	270		8700255	8700766	8421504	7	45,45,45,45,26,19,45	0,48,96,319,367,444,466	p	350010036100015094,350010036100015093,350010036100015092,350010036100015090,350010036100015089,350010036100015088	0-45,0-45,0-45,0-45,0-45,0-45						Novel Therapeutic Molecular Variants And Uses Thereof - Patent application	www.faqs.org	0	0		
651	chrII	8722335	8722362	3500359127	26		8722335	8722362	8421504	2	21,5	0,22	g	350035912700000446	9-35						<Html><Title> Complet list of 1c7j hssp file Complet list of	cnptia.embrapa.br	0	0		
651	chrII	8732963	8732988	3500147922	25		8732963	8732988	8421504	1	25	0	g	350014792200000005	110-135						BMC Developmental Biology BioMed Central	biomedcentral.com	0	0		
651	chrII	8732963	8732988	3500043668	25		8732963	8732988	8421504	1	25	0	g	350004366800000005	110-135			10.1186/1471-213X-5-8		BMC Developmental Biology	C. elegans serine-threonine kinase KIN-29 modulates TGFβ signaling and regulates body size formation	Lisa	2005	0		
651	chrII	8733397	8733644	3500210237	247		8733397	8733644	8421504	1	247	0	c,g	350021023700000000,350021023700000001,350021023700000001,350021023700000002,350021023700000002	0-247,0-22,0-22,0-22,0-22						LC-Molecular - PCR of Target Gene!	ar.wikispaces.com	0	0		
651	chrII	8736945	8736972	3500144391	25		8736945	8736972	8421504	2	10,15	0,12	c	350014439100000995	9-42						SPIDER SILK DRAGLINE POLYNUCLEOTIDES, POLYPEPTIDES AND METHODS OF USE THEREOF - Patent application	www.faqs.org	0	0		
652	chrII	8788053	8788078	3500340026	23		8788053	8788078	8421504	2	18,5	0,20	g	350034002600000046	4-27						Flea serine protease inhibitor proteins	Silver	1996	0		
652	chrII	8788053	8788078	3500194063	23		8788053	8788078	8421504	2	18,5	0,20	g	350019406300000046	4-27						 Flea Serine Protease Inhibitor Proteins 	www.docstoc.com	0	0		
652	chrII	8792088	8792114	3500258514	23		8792088	8792114	8421504	2	16,7	0,19	c	350025851400000016	14-37						attract[1.0], download[1.0], databas[1.0], tropic[2.0], comput[1.0], jurass[2.0], context[1.0], avai	vm.googlecode.com	0	0		
652	chrII	8870976	8871003	3500060568	23		8870976	8871003	8421504	3	6,4,13	0,9,14	g	350006056800000126	1-24						FEMS MICROBIOLOGY LETTERS	005.pasteur.ac.ir	0	0		
652	chrII	8881265	8884213	3500463133	40		8881265	8884213	8421504	2	20,20	0,2928	c,g	350046313300000002,350046313300000002,350046313300000003,350046313300000003	0-20,0-20,0-20,0-20						RNA Helicase 1 interacts with an ABC Transporter: Genetic Interactions with haf-6	holarworks.ku.edu	0	0		
652	chrII	8891673	8891697	3500266829	23		8891673	8891697	8421504	2	11,12	0,12	g	350026682900001468	5-41						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
652	chrII	8893827	8908034	3500057292	275		8893827	8908034	8421504	9	30,34,38,30,27,31,31,30,24	0,1495,2960,5998,10375,11331,12795,13320,14183	c,g	350005729200000002,350005729200000002,350005729200000000,350005729200000003,350005729200000005,350005729200000005,350005729200000019,350005729200000019,350005729200000013,350005729200000011,350005729200000010,350005729200000009,350005729200000009,350005729200000007	6-36,6-36,4-38,6-44,6-35,6-35,6-36,6-36,9-36,6-37,6-37,6-36,6-36,12-36						Genetic Analysis of Latrophilin in the Toxicity of Combined Latrotoxins for C. elegans	.nottingham.ac.uk	0	0		
652	chrII	8896868	8906086	3500245888	1779		8896868	8906086	8421504	7	58,187,1,106,86,1253,88	0,2868,6564,6677,6914,7082,9130	p	350024588800015003,350024588800015007,350024588800015011,350024588800015015,350024588800015019,350024588800015023,350024588800015027,350024588800015031,350024588800015035,350024588800015039	0-180,0-171,6-180,0-180,0-180,0-180,0-177,0-177,0-180,0-180						Der Latrophilin-ähnliche Rezeptor HC110-R aus	ni-duesseldorf.de	0	0		
652	chrII	8901915	8901944	3500197891	24		8901915	8901944	8421504	2	17,7	0,22	c	350019789100000226	13-37						Index Seq ID Count Primer type Orientation Start Len tm GC% Any compl 3' compl Seq Prod size Seq len	openwetware.org	0	0		
652	chrII	8903867	8903979	3500388642	30		8903867	8903979	8421504	2	1,29	0,83	c	350038864200000000	0-30						Latrophilin is required for toxicity of black widow spider venom	www.docstoc.com	0	0		
653	chrII	8927640	8967909	3500361817	42		8927640	8967909	8421504	4	4,18,7,13	0,5,40244,40256	c,g	350036181700001088,350036181700000843	7-29,0-21						<HTML> <TITLE>BLAST Search Results  Complet list of 1sug hssp file Complet list of	cnptia.embrapa.br	0	0		
653	chrII	9037764	9038005	3500013050	68		9037764	9038005	8421504	4	16,8,20,24	0,85,154,217	c,g	350001305000000021,350001305000000022,350001305000000022,350001305000000020,350001305000000020	0-24,0-20,0-20,0-24,0-24						Journal of cell and Molecular Biology - Vol6 No2 | Nagehan Ersoy Tunalı - Academia.edu	www.academia.edu	0	0		
654	chrII	9044509	9044554	3500235660	45		9044509	9044554	8421504	1	45	0	p	350023566000015004	114-159						Characterization and Expression of Two cDNAs Encoding Carbonic Anhydrase in Arabidopsis thaliana	www.jstor.org	0	0		
654	chrII	9056600	9056815	3500346870	48		9056600	9056815	8421504	2	24,24	0,191	c,g	350034687000000003,350034687000000003,350034687000000002,350034687000000002	0-24,0-24,0-24,0-24						Supporting Online Material for	ww.sciencemag.org	0	0		
654	chrII	9059344	9075017	3500452501	41		9059344	9075017	8421504	3	21,15,5	0,15652,15668	g	350045250100000260,350045250100000665	19-41,1-21						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
654	chrII	9077373	9077396	3500292075	23		9077373	9077396	8421504	1	23	0	g	350029207500000922	8-40						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
654	chrII	9112803	9112827	3500167780	23		9112803	9112827	8421504	2	6,17	0,7	c	350016778000000592	0-23						Compositions and methods for inhibiting expression of the PCSK9 gene	Tan	2013	0		
654	chrII	9113231	9131851	3500154339	302		9113231	9131851	8421504	6	50,50,51,50,50,51	0,3385,14122,16121,17546,18569	c,g	350015433900000083,350015433900000083,350015433900000063,350015433900000078,350015433900000078,350015433900000070,350015433900000070,350015433900000058,350015433900000058,350015433900000043	50-100,50-100,50-100,49-100,49-100,50-100,50-100,50-100,50-100,49-100							biomedcentral.com	0	0		
654	chrII	9122258	9131798	3500383377	40		9122258	9131798	8421504	2	20,20	0,9520	c,g	350038337700000005,350038337700000006	6-26,6-26		23352664	10.1016/j.celrep.2012.12.018	2211-1247	Cell Reports	Cell Reports - A Fasting-Responsive Signaling Pathway that Extends Life Span in C. elegans	Uno	2013	0		
654	chrII	9129424	9129448	3500319208	23		9129424	9129448	8421504	2	16,7	0,17	c	350031920800000004	5-28						核酸リガンド （公開公報 2007195559）｜アスタミューゼ - astamuse	astamuse.com	0	0		
654	chrII	9129470	9129497	3500059076	24		9129470	9129497	8421504	2	11,13	0,14	c	350005907600000198	18-42						COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF Nav1.8 GENE	Frank-Kamenetsky	2009	0		
654	chrII	9129470	9129497	3500024490	24		9129470	9129497	8421504	2	11,13	0,14	c	350002449000000198	18-42						Compositions and methods for inhibiting expression of Nav1.8 gene	Sah	2006	0		
654	chrII	9148074	9165416	3500344389	44		9148074	9165416	8421504	4	12,13,4,15	0,14,17322,17327	c,g	350034438900001140,350034438900000171,350034438900000171	23-48,17-36,17-36						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
654	chrII	9158092	9158119	3500344275	27		9158092	9158119	8421504	1	27	0	c,g	350034427500000002,350034427500000002	0-27,0-27						HIF-1 antagonizes p53-mediated apoptosis through a secreted neuronal tyrosinase. - ResearchGate	.researchgate.net	0	0		
654	chrII	9159492	9163221	3500338227	72		9159492	9163221	8421504	3	24,22,26	0,1824,3703	c,g	350033822700000002,350033822700000003,350033822700000001,350033822700000001	4-28,9-31,9-35,9-35						Chuan Shen, Zhiyong Shao and Jo Anne Powell-Coffman Department of Genetics, Development, & Cell Biology, Iowa State University, Ames, Iowa, 50011-3260, USA	www.genetics.org	0	0		
654	chrII	9170105	9171000	3500004218	40		9170105	9171000	8421504	2	20,20	0,875	c,g	350000421800000026,350000421800000026,350000421800000027,350000421800000027	0-20,0-20,0-20,0-20		21691303	10.1038/cr.2011.102	1001-0602	Cell Research	mir-35 is involved in intestine cell G1/S transition and germ cell proliferation in C. elegans	Liu	2011	8		
654	chrII	9174557	9174581	3500194350	24		9174557	9174581	8421504	1	24	0	c	350019435000000091	0-24						Soybean peroxidase gene family and an assay for detecting soybean peroxidase activity	Vierling	1998	0		
655	chrII	9175816	9175844	3500251427	23		9175816	9175844	8421504	2	14,9	0,19	c	350025142700000045	3-26						QTL controlling Sclerotinia stem ROT resistance in soybean - Patent application	www.faqs.org	0	0		
655	chrII	9185130	9185157	3500400848	23		9185130	9185157	8421504	2	15,8	0,19	c	350040084800000110,350040084800000111	3-35,12-44						Characterisation of the Salmonella Pathogenicity Island 4-encoded proteins SiiE, SiiA and SiiB: a new mechanism of bacterial adhesion	b.uni-erlangen.de	0	0		
655	chrII	9205923	9206875	3500051644	47		9205923	9206875	8421504	2	23,24	0,928	c,g	350005164400000000,350005164400000001,350005164400000001	0-23,0-24,0-24						C. elegans neurobeachin/LRBA homolog, is a negative regulator of lin-12/Notch activity and affects endosomal traffic in polarized epithelial cells	ev.biologists.org	0	0		
655	chrII	9206197	9206940	3500355450	112		9206197	9206940	8421504	4	24,48,17,23	0,28,87,720	c,g	350035545000000000,350035545000000000,350035545000000006,350035545000000001	0-24,0-24,0-70,6-29						Splicing in Caenorhabditis Does NotRequire AG at 3' Splice	brary.caltech.edu	0	0		
655	chrII	9211760	9211824	3500327218	46		9211760	9211824	8421504	2	19,27	0,37	c	350032721800000005,350032721800000004	7-26,3-30						Total RNA purified from cytosolic and nuclear fractions	www.eurasnet.info	0	0		
655	chrII	9211760	9211824	3500183697	46		9211760	9211824	8421504	2	19,27	0,37	c	350018369700000001,350018369700000000	7-26,3-30						 SpringerImages - Schematic illustration of gene specific primer design to study hypothetical pre-mRNA and mRNA transcripts. (A) Exon–exon and exon/intron–intron primer combinations are preferred to screen pre-mRNA. In this case, primers sho	pringerimages.com	0	0		
655	chrII	9275907	9275975	3500394674	23		9275907	9275975	8421504	2	18,5	0,63	c	350039467400000012,350039467400000054	14-37,15-38						FUNCTIONAL INFLUENZA VIRUS-LIKE PARTICLES (VLPS) - Patent application	www.faqs.org	0	0		
655	chrII	9275907	9275975	3500295154	23		9275907	9275975	8421504	2	18,5	0,63	c	350029515400000058,350029515400000012	15-38,14-37						HIGHLY EFFICIENT INFLUENZA MATRIX (M1) PROTEINS - Patent application	www.faqs.org	0	0		
655	chrII	9275907	9275975	3500165405	23		9275907	9275975	8421504	2	18,5	0,63	c	350016540500000012	14-37						Functional influenza virus like particles (VLPs)	Smith	2008	0		
655	chrII	9275907	9275975	3500154252	23		9275907	9275975	8421504	2	18,5	0,63	c	350015425200000012	14-37						HIGHLY EFFICIENT INFLUENZA MATRIX (M1) PROTEINS	Smith	2011	0		
655	chrII	9275907	9275975	3500138313	23		9275907	9275975	8421504	2	18,5	0,63	c	350013831300000060,350013831300000012	15-38,14-37						Functional Influenza Virus Like Particles (vlps) 	.freshpatents.com	0	0		
655	chrII	9275907	9275975	3500039661	23		9275907	9275975	8421504	2	18,5	0,63	c	350003966100000054,350003966100000012	15-38,14-37						Functional Influenza Virus Like Particles (VLPs) - Patent application	www.faqs.org	0	0		
655	chrII	9275907	9275975	3500038194	23		9275907	9275975	8421504	2	18,5	0,63	c	350003819400000009	14-37						Functional influenza virus like particles (vlps)	Smith	2007	0		
655	chrII	9275907	9275975	3500013268	23		9275907	9275975	8421504	2	18,5	0,63	c	350001326800000012	14-37						Functional influenza virus like particles (VLPs)	Smith	2006	0		
655	chrII	9297786	9297812	3500426058	23		9297786	9297812	8421504	2	16,7	0,19	c	350042605800000257	1-26						<Html><Title> Complet list of 2v3z hssp file Complet list of	cnptia.embrapa.br	0	0		
655	chrII	9297938	9298185	3500371211	247		9297938	9298185	8421504	1	247	0	p,c,g	350037121100015001,350037121100000001,350037121100000001,350037121100000000,350037121100000000	69-315,10-36,10-36,9-34,9-34					Protein Science : A Publication of the Protein Society	Origin of fibronectin type II (FN2) modules: Structural analyses of distantly-related members of the kringle family idey the kringle domain of neurotrypsin as a potential link between FN2 domains and kringles	Olga	2001	0		
655	chrII	9298801	9304762	3500129768	51		9298801	9304762	8421504	2	25,26	0,5935	c,g	350012976800000005,350012976800000005,350012976800000004	14-39,14-39,15-41		17942487	10.1242/dev.005363	0950-1991	Development	The C. elegans ROR receptor tyrosine kinase, CAM-1, non-autonomously inhibits the Wnt pathway	Green	2007	7		
656	chrII	9322700	9326392	3500456164	40		9322700	9326392	8421504	2	20,20	0,3672	c,g	350045616400000001,350045616400000001,350045616400000000	0-20,0-20,0-20						Mutagenesis Reveals a Diversity of Mechanisms Affecting Response of Caenorhabditis elegans to the Bacterial Pathogen Microbacterium nematophilum	www.genetics.org	0	0		
656	chrII	9324828	9329227	3500232650	55		9324828	9329227	8421504	2	27,28	0,4371	c,g	350023265000000007,350023265000000007,350023265000000008,350023265000000008	33-60,33-60,15-43,15-43						PhD Thesis	uni-goettingen.de	0	0		
656	chrII	9334430	9337574	3500298215	124		9334430	9337574	8421504	6	22,20,22,20,20,20	0,801,1045,1748,2479,3124	c,g	350029821500000098,350029821500000098,350029821500000038,350029821500000038,350029821500000094,350029821500000034,350029821500000099,350029821500000099,350029821500000039,350029821500000039,350029821500000095,350029821500000035,350029821500000096,350029821500000096,350029821500000036,350029821500000036,350029821500000097,350029821500000037	0-22,0-22,0-22,0-22,0-20,0-20,0-22,0-22,0-22,0-22,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20						Animal models and methods for analysis of lipid metabolism and screening of pharmaceutical and pesticidal agents that modulate lipid metabolism	Costa	1999	0		
656	chrII	9338411	9338513	3500249133	102		9338411	9338513	8421504	1	102	0	c,g	350024913300000025,350024913300000025	0-102,0-102							roarrays.ucsd.edu	0	0		
656	chrII	9362146	9362206	3500223858	30		9362146	9362206	8421504	2	7,23	0,37	c	350022385800000312	0-30							biomedcentral.com	0	0		RNF165
656	chrII	9385325	9389316	3500290538	39		9385325	9389316	8421504	3	20,4,15	0,3971,3976	c,g	350029053800002941,350029053800002185	22-44,6-25						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
656	chrII	9404314	9404373	3500415441	59		9404314	9404373	8421504	1	59	0	c	350041544100000494,350041544100000495,350041544100000493	13-72,13-72,13-72						Genomic tRNA Database: Caenorhabditis brenneri (WUGSC 4.0 Jan 2007)	gtrnadb.ucsc.edu	0	0		
656	chrII	9405825	9433474	3500366475	40		9405825	9433474	8421504	3	12,8,20	0,13,27629	g	350036647500000739,350036647500001961,350036647500002518,350036647500001011	6-26,7-27,5-25,0-21						<HTML> <TITLE>BLAST Search Results  BLAST Search Results  BLAST Search Results  Complet list of 1omo hssp file Complet list of	cnptia.embrapa.br	0	0		
657	chrII	9502918	9502946	3500168119	23		9502918	9502946	8421504	2	15,8	0,20	c	350016811900000559	0-23						<Html><Title> Complet list of 2yvg hssp file Complet list of	cnptia.embrapa.br	0	0		
657	chrII	9517561	9517644	3500077185	44		9517561	9517644	8421504	2	25,19	0,64	g	350007718500000001	0-44						Searching for neuronal left/right asymmetry: Genome wide analysis of nematode receptor-type guanylyl cyclases	www.genetics.org	0	0		
657	chrII	9521382	9521407	3500013627	24		9521382	9521407	8421504	2	11,13	0,12	c	350001362700000042	0-26						Development of SSR markers for the phylogenetic analysis of almond trees from China and the Mediterranean region	.babrc.ac.cn:8080	0	0		
657	chrII	9525880	9528739	3500229775	41		9525880	9528739	8421504	2	21,20	0,2839	c,g	350022977500000000,350022977500000001	0-21,0-20						Strain Summary for BC13750	www.gfpworm.org	0	0		
657	chrII	9553623	9553648	3500309112	25		9553623	9553648	8421504	1	25	0	g	350030911200000000	7-32			10.1038/sj.emboj.7600493	ERROR! NO ISSN	The EMBO Journal	In vivo imaging of C. elegans ASH neurons: cellular response and adaptation to chemical repellents	Hilliard	2004	0		
657	chrII	9566181	9566254	3500415441	73		9566181	9566254	8421504	1	73	0	c,g	350041544100000127,350041544100000121,350041544100000132,350041544100000120,350041544100000129	0-73,0-73,0-73,0-73,0-73						Genomic tRNA Database: Caenorhabditis brenneri (WUGSC 4.0 Jan 2007)	gtrnadb.ucsc.edu	0	0		
658	chrII	9584673	9584887	3500136159	40		9584673	9584887	8421504	2	20,20	0,194	c,g	350013615900000017,350013615900000017,350013615900000016,350013615900000016	0-20,0-20,0-20,0-20						Supporting Information	www.pnas.org	0	0		
658	chrII	9589918	9590237	3500452764	168		9589918	9590237	8421504	2	60,108	0,211	p	350045276400015035,350045276400015029,350045276400015024	0-60,0-60,0-48						The Plant Cell, Vol. 10, 699-711, May 1998, www.plantcell.org ? 1998 American Society of Plant Physiologists Chloroplast Development at Low Temperatures Requires a James G. Tokuhisa,3 Perumal Vijayan,3 Kenneth A. Feldmann,b and John A. Browse31	www.jstor.org	0	0		
658	chrII	9601784	9601812	3500066613	23		9601784	9601812	8421504	3	6,4,13	0,10,15	g	350006661300000008	21-44						Antagonists and agonists of ldcam and methods of use	Galibert	2005	0		
658	chrII	9613457	9614709	3500208805	50		9613457	9614709	8421504	2	20,30	0,1222	c,g	350020880500000000,350020880500000001,350020880500000001	12-32,0-30,0-30		18927627	10.1371/journal.pgen.1000222	1553-7404	PLOS Genetics	PLOS Genetics: The HLH-6 Transcription Factor Regulates C. elegans Pharyngeal Gland Development and Function	Smit	2008	0		
658	chrII	9614040	9614384	3500262937	43		9614040	9614384	8421504	2	22,21	0,323	g	350026293700000005,350026293700000004	10-32,9-30						The Snail-like CES-1 protein of C. eleganscan block the expression of the BH3-onlycell-death activator gene egl-1by antagonizing the function of bHLH proteins	ev.biologists.org	0	0		
658	chrII	9625322	9625346	3500057006	24		9625322	9625346	8421504	1	24	0	c	350005700600000436	15-47						<HTML><HEAD><meta http-equiv="Content-Type" content="text/html; charset=ISO-8859-1"><LINK REL="SHORT	.economie.fgov.be	0	0		
658	chrII	9638347	9638371	3500174607	23		9638347	9638371	8421504	2	7,16	0,8	c,g	350017460700000149,350017460700000149	3-37,3-37						Self-Processing Plants and Plant Parts - Patent application	www.faqs.org	0	0		
658	chrII	9653481	9653505	3500127877	23		9653481	9653505	8421504	2	11,12	0,12	c	350012787700003091	8-35						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
658	chrII	9669526	9670121	3500325691	360		9669526	9670121	8421504	3	94,86,180	0,145,415	p	350032569100015011,350032569100015015	0-180,0-180						Tbn, a novel gene essential for the ICM	ev.biologists.org	0	0		
658	chrII	9689797	9690849	3500197656	195		9689797	9690849	8421504	4	69,24,39,63	0,84,941,989	p	350019765600015094,350019765600015093,350019765600015092	0-69,0-63,0-63						Karakterisatie van neuromedine U-, tachykinine- en GnRH-verwante receptoren	w.scriptiebank.be	0	0		
659	chrII	9706714	9706742	3500456891	23		9706714	9706742	8421504	3	6,5,12	0,9,16	g	350045689100000086	18-41						Investigating the role of papain-like cysteine protease RD21 in plant-pathogen interactions	s.ub.uni-koeln.de	0	0		
659	chrII	9716147	9717793	3500265940	49		9716147	9717793	8421504	2	19,30	0,1616	c,g	350026594000000003,350026594000000001	13-32,0-30		12397109		0950-1991	Development	Dominant mutations in the Caenorhabditis elegans Myt1 ortholog wee-1.3 reveal a novel domain that controls M-phase entry during spermatogenesis	Lamitina	2002	7		
659	chrII	9749205	9749312	3500258151	60		9749205	9749312	8421504	2	41,19	0,88	p	350025815100015005	0-60						nanos-related genes in C. elegans	ev.biologists.org	0	0		
659	chrII	9767716	9767921	3500442789	40		9767716	9767921	8421504	2	20,20	0,185	c,g	350044278900000010,350044278900000010,350044278900000011,350044278900000011	0-20,0-20,0-20,0-20		22768380	10.1038/srep00487	xxxx-xxxx	Scientific Reports	Genes down-regulated in spaceflight are involved in the control of longevity in Caenorhabditis elegans	Honda	2012	0		
659	chrII	9767716	9767921	3500149422	40		9767716	9767921	8421504	2	20,20	0,185	c,g	350014942200000010,350014942200000010,350014942200000011,350014942200000011	0-20,0-20,0-20,0-20		22768380	10.1038/srep00487	xxxx-xxxx	Scientific Reports	Genes down-regulated in spaceflight are involved in the control of longevity in Caenorhabditis elegans	Honda	2012	0		
659	chrII	9767716	9767921	3500062275	40		9767716	9767921	8421504	2	20,20	0,185	c,g	350006227500000010,350006227500000010,350006227500000011,350006227500000011	0-20,0-20,0-20,0-20		22768380	10.1038/srep00487		Scientific Reports	Genes down-regulated in spaceflight are involved in the control of longevity in Caenorhabditis elegans	Yoko	2012	0		
659	chrII	9771645	9771673	3500080241	25		9771645	9771673	8421504	2	15,10	0,18	c	350008024100000002	0-25						用于治疗不育症的异二聚体促卵泡激素－Fc(FSH－Fc)融合蛋白	Su Shan *C*Luo 	2007	0		
659	chrII	9774703	9774777	3500288532	74		9774703	9774777	8421504	1	74	0	g	350028853200000010	0-74						ScienceDirect.com - Genomics - A combined computational and experimental analysis of two families of snoRNA genes from Caenorhabditis elegans, revealing the expression and evolution pattern of snoRNAs in nematodes	sciencedirect.com	0	0		
659	chrII	9826621	9826675	3500270278	54		9826621	9826675	8421504	1	54	0	p	350027027800015015,350027027800015014	9-63,9-63						Planarian Pax6 genes	ev.biologists.org	0	0		
659	chrII	9827346	9827371	3500029240	23		9827346	9827371	8421504	2	9,14	0,11	g	350002924000000033	1-24						IBMCP-CSIC-UPV aEstudio transcriptA3mico y metabolA3mico del desarrollo partenocA!rpico 	riunet.upv.es	0	0		
660	chrII	9837026	9837060	3500082902	26		9837026	9837060	8421504	3	9,12,5	0,14,29	g	350008290200000116	2-28						B组链球菌抗原	B*R*Bu Luo Duo Yi Er 	2001	0		
660	chrII	9843323	9874462	3500402526	11613		9843323	9874462	8421504	33	1085,7,1082,90,143,56,1085,90,149,56,1085,87,149,56,1085,57,149,50,1085,114,149,47,808,287,71,149,59,796,286,115,784,281,21	0,1534,10613,11927,12061,12252,12556,14088,14222,14419,14730,15865,15996,16193,16488,17712,17832,18035,19051,20586,20745,20942,26076,26931,27417,27532,27731,28280,29121,29454,29896,30746,31118	p	350040252600015190,350040252600015191,350040252600015193,350040252600015192,350040252600015194,350040252600015195,350040252600015196,350040252600015197,350040252600015198	474-1566,0-1371,0-1380,0-1377,0-1341,0-1395,0-1377,0-1197,81-1170						Identification moléculaire d’une chitinase CHT-1, sa localisation et son rôle chez le nématode Caenorhabditis elegans	doc.rero.ch	0	0		
660	chrII	9874102	9874132	3500322237	25		9874102	9874132	8421504	3	5,7,13	0,8,17	c	350032223700000146	16-41						<Html><Title> Complet list of 1rz1 hssp file Complet list of	cnptia.embrapa.br	0	0		
660	chrII	9897819	9899364	3500155981	83		9897819	9899364	8421504	4	20,22,21,20	0,80,369,1525	c,g	350015598100000004,350015598100000004,350015598100000001,350015598100000001,350015598100000000,350015598100000000,350015598100000002,350015598100000002	12-32,12-32,0-22,0-22,0-21,0-21,0-20,0-20						Expression of the unc-4homeoprotein in Caenorhabditis elegansmotor neurons specifies presynaptic input	ev.biologists.org	0	0		
660	chrII	9900198	9903140	3500456958	40		9900198	9903140	8421504	3	19,15,6	0,2920,2936	c,g	350045695800000005,350045695800000004,350045695800000004	0-19,0-21,0-21					Proceedings of the National Academy of Sciences of the United States of America	Genetically targeted cell disruption in Caenorhabditis elegans	S.	1997	0		
660	chrII	9900198	9903140	3500434425	40		9900198	9903140	8421504	3	19,15,6	0,2920,2936	c,g	350043442500000006,350043442500000005,350043442500000005	0-19,0-21,0-21						Genetically targeted cell disruption in Caenorhabditis elegans	avernarakislab.gr	0	0		
660	chrII	9902687	9902713	3500361132	26		9902687	9902713	8421504	1	26	0	g	350036113200000039	16-42		16911797	10.1186/1741-7007-4-26	1741-7007	BMC Biology	Initiation of male sperm-transfer behavior in Caenorhabditis elegans requires input from the ventral nerve cord	Schindelman	2006	6		
660	chrII	9934487	9936829	3500104401	1566		9934487	9936829	8421504	5	324,198,376,490,178	0,766,1012,1456,2164	c,g	350010440100000149,350010440100000149	0-1566,0-1566						3-HYDROXYPROPIONIC ACID AND OTHER ORGANIC COMPOUNDS - Patent application	www.faqs.org	0	0		
660	chrII	9934493	9936829	3500380836	1469		9934493	9936829	8421504	28	59,57,58,58,58,18,40,58,57,37,22,55,56,55,55,55,57,54,55,55,55,55,55,56,58,56,55,60	0,61,120,180,240,300,760,802,862,921,1006,1030,1090,1150,1210,1270,1330,1460,1518,1578,1638,1698,1758,1817,1878,2157,2216,2276	g	350038083600000149	0-1469						US Patent # 7,186,541. 3-hydroxypropionic acid and other organic compounds - Patents.com	www.patents.com	0	0		
660	chrII	9934493	9936829	3500370305	1469		9934493	9936829	8421504	28	59,57,58,58,58,18,40,58,57,37,22,55,56,55,55,55,57,54,55,55,55,55,55,56,58,56,55,60	0,61,120,180,240,300,760,802,862,921,1006,1030,1090,1150,1210,1270,1330,1460,1518,1578,1638,1698,1758,1817,1878,2157,2216,2276	g	350037030500000142	0-1469						 3 	www.docstoc.com	0	0		
660	chrII	9934493	9936829	3500166501	1469		9934493	9936829	8421504	28	59,57,58,58,58,18,40,58,57,37,22,55,56,55,55,55,57,54,55,55,55,55,55,56,58,56,55,60	0,61,120,180,240,300,760,802,862,921,1006,1030,1090,1150,1210,1270,1330,1460,1518,1578,1638,1698,1758,1817,1878,2157,2216,2276	g	350016650100000149	0-1469						3-hydroxypropionic acid and other organic compounds - US Patent 7186541 Description	ww.patentstorm.us	0	0		
660	chrII	9954864	9956521	3500143533	324		9954864	9956521	8421504	9	27,27,27,27,130,27,5,27,27	0,50,222,764,849,1034,1181,1386,1630	g	350014353300000008,350014353300000010,350014353300000012,350014353300000014,350014353300000003,350014353300000002,350014353300000005,350014353300000018,350014353300000019,350014353300000021	0-27,0-27,0-27,0-27,4-134,4-139,0-26,0-27,0-27,0-27						Development 134, 669-679 (2007) doi:10.1242/dev.02769 C. elegans EVI1 proto-oncogene, EGL-43, is necessary for Notch-mediated cell fate specification and regulates cell invasion	brary.caltech.edu	0	0		
661	chrII	9965277	9965304	3500196959	23		9965277	9965304	8421504	3	6,12,5	0,8,22	g	350019695900001687	17-40						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
661	chrII	9987943	9987971	3500414565	24		9987943	9987971	8421504	2	13,11	0,17	g	350041456500000316	0-24						Analyzing Comparative Sequence Data to Understand Genome Function and Evolution	gradworks.umi.com	0	0		
661	chrII	10008979	10009023	3500386452	44		10008979	10009023	8421504	1	44	0	c	350038645200000538	20-64						NEUROPROTECTIVE MOLECULES AND METHODS OF TREATING NEUROLOGICAL DISORDERS AND INDUCING STRESS GRANULES	Anderson	2011	0		
661	chrII	10008979	10009023	3500235647	44		10008979	10009023	8421504	1	44	0	c	350023564700001331,350023564700000538	20-64,20-64						NEUROPROTECTIVE MOLECULES AND METHODS OF TREATING NEUROLOGICAL DISORDERS AND INDUCING STRESS GRANULES - Patent application	www.faqs.org	0	0		
661	chrII	10027289	10027334	3500036764	45		10027289	10027334	8421504	1	45	0	p	350003676400015196	0-45						COMPOUNDS, COMPOSITIONS AND METHODS FOR CONTROLLING INVERTEBRATE PESTS - Patent application	www.faqs.org	0	0		
661	chrII	10043080	10043195	3500395114	40		10043080	10043195	8421504	3	21,2,17	0,47,98	c,g	350039511400000017,350039511400000017,350039511400000016	0-21,0-21,0-19		23103171	10.1016/j.celrep.2012.09.019	2211-1247	Cell Reports	Cell Reports - Antagonism between MES-4 and Polycomb Repressive Complex 2 Promotes Appropriate Gene Expression in C. elegans Germ Cells	Gaydos	2012	0		
661	chrII	10043080	10043195	3500150118	40		10043080	10043195	8421504	3	21,2,17	0,47,98	c,g	350015011800000017,350015011800000017,350015011800000016	0-21,0-21,0-19		23103171	10.1016/j.celrep.2012.09.019	2211-1247	Cell Reports	Cell Reports - Antagonism between MES-4 and Polycomb Repressive Complex 2 Promotes Appropriate Gene Expression in C. elegans Germ Cells	Gaydos	2012	0		
661	chrII	10061745	10062001	3500289693	254		10061745	10062001	8421504	2	57,197	0,59	g	350028969300000282,350028969300000283,350028969300000279,350028969300000277,350028969300000275,350028969300000273,350028969300000271	0-37,16-36,0-20,0-44,0-52,0-52,0-49						5’ binding in Red color (shadow in green)	www.nature.com	0	0		
661	chrII	10068530	10068555	3500455554	23		10068530	10068555	8421504	3	12,5,6	0,13,19	c	350045555400000002	8-31		9774670		0270-7306	Molecular and Cellular Biology	Poly(A) Tail Length Control in Saccharomyces cerevisiae Occurs by Message-Specific Deadenylation	Brown	1998	6		
82	chrII	10079176	10099084	3500431569	41		10079176	10099084	8421504	2	21,20	0,19888	c,g	350043156900000319,350043156900000846	16-41,8-28						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
662	chrII	10094829	10094852	3500461888	23		10094829	10094852	8421504	1	23	0	c	350046188800002354	9-32						 Galaxy | Dataset | FASTQ to Tabular	popgenie.org:8080	0	0		
662	chrII	10101675	10101701	3500292075	23		10101675	10101701	8421504	2	8,15	0,11	c	350029207500001645	0-23						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
662	chrII	10106314	10106341	3500387859	23		10106314	10106341	8421504	3	4,13,6	0,5,21	c	350038785900000790	23-46						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
662	chrII	10109219	10121904	3500462587	12685		10109219	10121904	8421504	1	12685	0	c,g	350046258700000277,350046258700000000,350046258700000000,350046258700000279,350046258700000279,350046258700000002,350046258700000002,350046258700000281,350046258700000281,350046258700000001,350046258700000001,350046258700000280,350046258700000280	0-12685,0-22,0-22,0-22,0-22,0-22,0-22,0-22,0-22,0-22,0-22,0-22,0-22						Caenorhabditis elegans LOV-1 gene	Sternberg	2000	0		
662	chrII	10109568	10111329	3500148386	861		10109568	10111329	8421504	8	45,49,287,240,48,48,9,135	0,174,275,800,1383,1479,1572,1626	p	350014838600015115,350014838600015112,350014838600015111,350014838600015110,350014838600015109,350014838600015108,350014838600015107,350014838600015106,350014838600015103,350014838600015102,350014838600015101,350014838600015100,350014838600015099,350014838600015097,350014838600015095,350014838600015093,350014838600015092,350014838600015091	0-45,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48						Polycystic Xidney Disease Pkd2 Gene And Uses Thereop 	.freshpatents.com	0	0		
662	chrII	10111399	10111427	3500292410	23		10111399	10111427	8421504	2	10,13	0,15	g	350029241000000135	3-26						all.in.analysis	www.docstoc.com	0	0		
662	chrII	10140261	10140309	3500246636	48		10140261	10140309	8421504	1	48	0	p	350024663600015018	0-48						Characterization of a Bifidobacterium longum BORI Dipeptidase Belonging to the U34 Family	aem.asm.org	0	0		
662	chrII	10151602	10176117	3500214872	42		10151602	10176117	8421504	3	21,4,17	0,24493,24498	c,g	350021487200000558,350021487200000660	0-28,5-26						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
662	chrII	10157914	10169259	3500154339	203		10157914	10169259	8421504	4	50,51,50,52	0,3533,6405,11293	c,g	350015433900000077,350015433900000077,350015433900000050,350015433900000098,350015433900000062	0-50,0-50,0-51,0-50,48-100							biomedcentral.com	0	0		
662	chrII	10171526	10171610	3500210057	81		10171526	10171610	8421504	2	45,36	0,48	p	350021005700015163	0-81						US Patent # 7,267,976. Acyltransferases for alteration of polyunsaturated fatty acids and oil content in oleaginous yeasts - Patents.com	www.patents.com	0	0		
662	chrII	10171577	10171637	3500292468	60		10171577	10171637	8421504	1	60	0	p	350029246800015072	0-60						RESEARCH ARTICLE Open Access Interaction of the heterotrimeric G protein alpha subunit SSG-1 of Sporothrix schenckii	biomedcentral.com	0	0		
662	chrII	10171589	10171612	3500285098	23		10171589	10171612	8421504	1	23	0	c	350028509800000004	0-23						Functional Proteomics Reveals the BiochemicalNicheof C.elegans DCR-1in Multiple Small-RNA-Mediated Pathways	mcb.berkeley.edu	0	0		
662	chrII	10172004	10172319	3500278688	84		10172004	10172319	8421504	3	24,17,43	0,207,272	p	350027868800015054	3-87						The global expression analysis of stress response against denatured proteins in yeast Saccharomyces cerevisiae	ane.ll.chiba-u.jp	0	0		
662	chrII	10172161	10172315	3500136159	40		10172161	10172315	8421504	2	20,20	0,134	c,g	350013615900000006,350013615900000007,350013615900000007	0-20,0-20,0-20						Supporting Information	www.pnas.org	0	0		
662	chrII	10200500	10200693	3500178736	144		10200500	10200693	8421504	2	69,75	0,118	p	350017873600015048,350017873600015047,350017873600015046	0-48,0-48,0-48						ARV1, a protein involved in sterol uptake and sterol homeostasis in the budding yeast, S-cerevisiae, and a functional human ARV1 - Patent # 6566512 - PatentGenius	.patentgenius.com	0	0		
663	chrII	10238855	10239608	3500055232	71		10238855	10239608	8421504	3	20,20,31	0,43,722	c,g	350005523200000003,350005523200000003,350005523200000001,350005523200000001,350005523200000000,350005523200000000,350005523200000002,350005523200000002	0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20						ナショナルバイオリソースプロジェクト (NBRP) C.elegans Mutants	.shigen.nig.ac.jp	0	0		
663	chrII	10259118	10259142	3500251512	24		10259118	10259142	8421504	1	24	0	c	350025151200000005	12-36						miRNA396 AND GROWTH REGULATING FACTORS FOR CYST NEMATODE TOLERANCE IN PLANTS - Patent application	www.faqs.org	0	0		
663	chrII	10259118	10259142	3500057886	24		10259118	10259142	8421504	1	24	0	c	350005788600000005	12-36						miRNA396 AND GROWTH REGULATING FACTORS FOR CYST NEMATODE TOLERANCE IN PLANTS	Baum	2012	0		
663	chrII	10259118	10259142	3500022390	24		10259118	10259142	8421504	1	24	0	c	350002239000000005	12-36						miRNA396 AND GROWTH REGULATING FACTORS FOR CYST NEMATODE TOLERANCE IN PLANTS	Baum	2012	0		
663	chrII	10278916	10314208	3500284394	38		10278916	10314208	8421504	4	5,14,5,14	0,6,35271,35278	g	350028439400000531,350028439400000406	18-37,7-26						RNAi INHIBITION OF INFLUENZA VIRUS REPLICATION	Fougerolles	2011	0		
663	chrII	10278916	10314208	3500241875	40		10278916	10314208	8421504	3	5,14,21	0,6,35271	g	350024187500000531,350024187500000407	18-37,6-27					Patent	Enhancement of influenza gene expression (Patent US:8227188)	Fougerolles	2012	0		
663	chrII	10304717	10304775	3500386452	45		10304717	10304775	8421504	2	7,38	0,20	c	350038645200000651,350038645200000078	7-52,8-30						NEUROPROTECTIVE MOLECULES AND METHODS OF TREATING NEUROLOGICAL DISORDERS AND INDUCING STRESS GRANULES	Anderson	2011	0		
663	chrII	10310702	10310834	3500040837	49		10310702	10310834	8421504	2	20,29	0,103	c,g	350004083700000003,350004083700000003,350004083700000002	0-20,0-20,0-29		19875417	10.1093/nar/gkp868		Nucleic Acids Research	Single-cell transcriptional analysis of taste sensory neuron pair in Caenorhabditis elegans	Jun	2010	0		
663	chrII	10324873	10324901	3500200751	24		10324873	10324901	8421504	3	13,5,6	0,15,22	g	350020075100000005	18-42		20231284	10.1074/jbc.M110.101543		The Journal of Biological Chemistry	Prodrug Activation by Cryptosporidium Thymidine Kinase	Xin	2010	0		
663	chrII	10351340	10351367	3500239229	24		10351340	10351367	8421504	2	13,11	0,16	c	350023922900003098	12-36						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
664	chrII	10394073	10395202	3500435771	1129		10394073	10395202	8421504	1	1129	0	g	350043577100000017	0-1129						Genomic sequences of GAPDH-1 - _gi_167295_gb_M93427	www.docstoc.com	0	0		
664	chrII	10394076	10395202	3500204997	1126		10394076	10395202	8421504	1	1126	0	g	350020499700000019	0-1126						>gi|167295|gb|M93427	ww.bellarmine.edu	0	0		
664	chrII	10394442	10394487	3500138562	45		10394442	10394487	8421504	1	45	0	p	350013856200015008	0-45						Myrothecium Sp Transformation And Expression System 	.freshpatents.com	0	0		
664	chrII	10394442	10394487	3500121926	45		10394442	10394487	8421504	1	45	0	p	350012192600015012	0-45						 <HTML> <HEAD><TITLE>aaaC/a1/4a?a1/4eoa1/4a - c1ei1/4i1/4i1/4i1/4i1/4i1/4i1/4i1/4i1/4i1/4 | j-tokkyo	www.j-tokkyo.com	0	0		
664	chrII	10394779	10394950	3500121934	171		10394779	10394950	8421504	1	171	0	p	350012193400015009	0-171						Presentazione di PowerPoint	www.iscra.net	0	0		
664	chrII	10404438	10404463	3500084495	23		10404438	10404463	8421504	2	18,5	0,20	g	350008449500000028	8-31						Recombinant plant viral nucleic acids	Dawson	1994	0		
664	chrII	10417961	10417986	3500071183	24		10417961	10417986	8421504	2	15,9	0,16	c	350007118300000358	11-35						Molekulargenetische Untersuchungen beim Hund: Genomweite Analysen zur generalisierten Progressiven Retina Atrophie und mitochondriale sowie Y-chromosomale Studien zur genealogischen Abstammung	uhr-uni-bochum.de	0	0		
664	chrII	10437458	10437485	3500343354	23		10437458	10437485	8421504	2	8,15	0,12	c	350034335400000098	14-37						<Html><Title> Complet list of 3hdn hssp file Complet list of	cnptia.embrapa.br	0	0		
664	chrII	10451316	10451748	3500236586	87		10451316	10451748	8421504	5	23,4,19,20,21	0,24,83,104,411	c,g	350023658600000007,350023658600000007,350023658600000009,350023658600000008,350023658600000008,350023658600000004,350023658600000004	0-23,0-23,0-23,0-20,0-20,0-21,0-21		21196525	10.1534/genetics.110.124487		Genetics	The LIN-15A and LIN-56 Transcriptional Regulators Interact to Negatively Regulate EGF/Ras Signaling in Caenorhabditis elegans Vulval Cell-Fate Determination	Ewa	2011	0		
664	chrII	10466962	10466990	3500178220	24		10466962	10466990	8421504	2	13,11	0,17	c	350017822000000791	9-36						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
664	chrII	10480327	10480973	3500021688	40		10480327	10480973	8421504	2	20,20	0,626	c,g	350002168800000003,350002168800000003,350002168800000002,350002168800000002	0-20,0-20,0-20,0-20			10.1101/gr.50823006		Genome Research	Genomic clusters, putative pathogen recognition molecules, and antimicrobial genes are induced by infection of C. elegans with M. nematophilum	Delia	2006	0		
665	chrII	10505979	10506004	3500241788	24		10505979	10506004	8421504	2	14,10	0,15	g	350024178800000627	8-40						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
665	chrII	10513304	10513328	3500249257	23		10513304	10513328	8421504	2	9,14	0,10	g	350024925700000036	13-37					Patent	Insect-specific paralytic neurotoxin genes for use in biological insect control: methods and compositions (Patent US:5266317)	Miller	1993	0		
665	chrII	10513304	10513328	3500037822	23		10513304	10513328	8421504	2	9,14	0,10	g	350003782200000036	13-37					Patent	Insect-specific paralytic neurotoxin genes for use in biological insect control: methods and compositions (Patent US:5266317)	Miller	1993	0		
665	chrII	10535742	10535770	3500268910	25		10535742	10535770	8421504	2	20,5	0,23	g	350026891000000031,350026891000000028	4-25,0-26						Methods for the survey and genetic analysis of populations	Ashby	2001	0		
665	chrII	10542600	10542625	3500177899	24		10542600	10542625	8421504	2	16,8	0,17	c	350017789900000476	2-26						<Html><Title> Complet list of 3f55 hssp file Complet list of	cnptia.embrapa.br	0	0		
665	chrII	10545138	10545269	3500288532	131		10545138	10545269	8421504	1	131	0	c	350028853200000023	3-134						ScienceDirect.com - Genomics - A combined computational and experimental analysis of two families of snoRNA genes from Caenorhabditis elegans, revealing the expression and evolution pattern of snoRNAs in nematodes	sciencedirect.com	0	0		
665	chrII	10545398	10546161	3500218806	498		10545398	10546161	8421504	10	45,45,45,93,45,45,45,45,45,45	0,238,286,334,430,478,526,574,670,718	p	350021880600015047,350021880600015043,350021880600015042,350021880600015040,350021880600015039	0-45,0-318,0-45,0-45,0-45						 Crystallographic Structure Of Mnk 	www.docstoc.com	0	0		
665	chrII	10585272	10585300	3500157544	23		10585272	10585300	8421504	2	12,11	0,17	c	350015754400000019	5-31						 SpringerImages - Primers used for amplification in this study 	pringerimages.com	0	0		
665	chrII	10591396	10591435	3500334881	30		10591396	10591435	8421504	4	7,3,5,15	0,12,18,24	c	350033488100002366	18-48						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
83	chrII	10591643	10638587	3500197929	40		10591643	10638587	8421504	4	1,14,4,21	0,722,737,46923	c	350019792900004030,350019792900000169	9-28,3-24						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
666	chrII	10638997	10639026	3500321117	26		10638997	10639026	8421504	2	5,21	0,8	c	350032111700000376	11-37						<Html><Title> Complet list of 1pa1 hssp file Complet list of	cnptia.embrapa.br	0	0		
666	chrII	10646697	10646720	3500135691	23		10646697	10646720	8421504	1	23	0	c	350013569100000096	13-36						Neue calpaine, ihre herstellung und verwendung	Boehm	1998	0		
666	chrII	10703734	10703762	3500285664	26		10703734	10703762	8421504	2	10,16	0,12	g	350028566400000043,350028566400000042,350028566400000034,350028566400000035,350028566400000047,350028566400000046,350028566400000045,350028566400000044,350028566400000058,350028566400000059,350028566400000060,350028566400000057	8-33,5-29,5-29,10-34,10-34,5-29,10-34,5-29,10-34,5-29,10-34,5-29						Herbicide-Resistant Plants, And Polynucleotides And Methods For Providing Same - Patent application	www.faqs.org	0	0		
666	chrII	10703735	10703762	3500260884	25		10703735	10703762	8421504	2	9,16	0,11	g	350026088400000058,350026088400000046,350026088400000047,350026088400000044,350026088400000045,350026088400000035,350026088400000034,350026088400000057	10-34,5-29,10-34,5-29,10-34,10-34,5-29,5-29						Herbicide-resistant plants, and polynucleotides and methods for providing same	Arias	2004	0		
666	chrII	10710424	10710448	3500091543	23		10710424	10710448	8421504	2	19,4	0,20	c,g	350009154300000028,350009154300000028	16-40,16-40						Sequence-specific Binding of Arc Repressor to DNA	www.jbc.org	0	0		
667	chrII	10773698	10773731	3500235999	29		10773698	10773731	8421504	2	6,23	0,10	g	350023599900000097	6-36						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
667	chrII	10783308	10783351	3500121907	40		10783308	10783351	8421504	2	20,20	0,23	g	350012190700000000,350012190700000004	0-20,0-20				0021-9533	Journal of Cell Science	The Caenorhabditis elegans histone hairpin-binding protein is required for core histone gene expression and is essential for embryonic and postembryonic cell division	Pettitt	2002	6		
667	chrII	10785625	10785663	3500264010	30		10785625	10785663	8421504	3	12,9,9	0,15,29	g	350026401000000005	0-31						Isolation and Genetic Characterization of a Microbial Consortium Capable of Cyanide Degradation	etd.uovs.ac.za	0	0		
667	chrII	10786080	10786772	3500382955	47		10786080	10786772	8421504	2	22,25	0,667	c,g	350038295500000028,350038295500000028,350038295500000029,350038295500000029	0-22,0-22,0-25,0-25						BMC Molecular Biology BioMed Central	biomedcentral.com	0	0		
667	chrII	10786080	10786772	3500140592	47		10786080	10786772	8421504	2	22,25	0,667	c,g	350014059200000015,350014059200000015,350014059200000016,350014059200000016	0-22,0-22,0-25,0-25					BMC Molecular Biology	Histone gene expression and histone mRNA 3' end structure in Caenorhabditis elegans - Scolaris	Keall	2007	0		
667	chrII	10796837	10798419	3500271466	67		10796837	10798419	8421504	3	21,24,22	0,770,1560	c,g	350027146600000001,350027146600000001,350027146600000002,350027146600000000	8-29,8-29,8-32,6-28						ScienceDirect.com - Developmental Biology - Early embryonic requirement for nucleoporin Nup35/NPP-19 in nuclear assembly	sciencedirect.com	0	0		
667	chrII	10812923	10812951	3500193112	27		10812923	10812951	8421504	2	11,16	0,12	g	350019311200000086	9-36						<Html><Title> Complet list of 1z16 hssp file Complet list of	cnptia.embrapa.br	0	0		
667	chrII	10824297	10825480	3500404771	40		10824297	10825480	8421504	2	20,20	0,1163	c,g	350040477100000013,350040477100000014,350040477100000014	0-20,0-20,0-20		15767665	10.1128/MCB.25.7.2583-2592.2005	0270-7306	Molecular and Cellular Biology	HCP-4/CENP-C Promotes the Prophase Timing of Centromere Resolution by Enabling the Centromere Association of HCP-6 in Caenorhabditis elegans	Moore	2005	6		
667	chrII	10824407	10825772	3500124427	42		10824407	10825772	8421504	2	21,21	0,1344	c,g	350012442700000002,350012442700000003,350012442700000003	0-21,11-32,11-32						ScienceDirect.com - Cell - MIX-1: An Essential Component of the C. elegans Mitotic Machinery Executes X Chromosome Dosage Compensation	sciencedirect.com	0	0		
667	chrII	10865066	10865095	3500336276	29		10865066	10865095	8421504	1	29	0	c	350033627600000381	2-31						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
667	chrII	10865066	10865095	3500209433	29		10865066	10865095	8421504	1	29	0	c	350020943300000431	2-31						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
667	chrII	10867770	10874755	3500127877	40		10867770	10874755	8421504	4	14,6,15,5	0,16,6964,6980	c,g	350012787700003814,350012787700001006	9-29,8-28						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
667	chrII	10870804	10872546	3500447808	1536		10870804	10872546	8421504	5	170,379,787,121,79	0,219,654,1487,1663	p	350044780800015135,350044780800015134,350044780800015133,350044780800015132,350044780800015131,350044780800015130,350044780800015129,350044780800015128,350044780800015127,350044780800015126,350044780800015125,350044780800015124,350044780800015123,350044780800015122,350044780800015121,350044780800015120,350044780800015119,350044780800015118,350044780800015117,350044780800015116,350044780800015115,350044780800015114,350044780800015113,350044780800015112,350044780800015111,350044780800015110,350044780800015109,350044780800015108,350044780800015107,350044780800015106,350044780800015105,350044780800015104,350044780800015038	0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-45						Tyrosine-containing cyclophilin and related methods	Carlow	2000	0		
667	chrII	10872135	10872518	3500363503	42		10872135	10872518	8421504	2	21,21	0,362	c,g	350036350300000019,350036350300000018,350036350300000018	0-21,0-21,0-21						The Society of Nematologists 2008. Effects of Ivermectin and Moxidectin on the Transcription of Genes Coding for Multidrug Resistance Associated Proteins and Behaviour in Caenorhabditis elegans	oneandoneshop.com	0	0		
668	chrII	10898517	10898545	3500356983	24		10898517	10898545	8421504	3	5,15,4	0,8,24	g	350035698300000037	17-41						%N฀฀฀OBTENTION฀U฀ %0$5035%&-6/*7&34*5² %&506-064&	s.inp-toulouse.fr	0	0		
668	chrII	10902828	10903076	3500442789	43		10902828	10903076	8421504	2	22,21	0,227	c,g	350044278900000023,350044278900000023,350044278900000022,350044278900000022	0-22,0-22,0-21,0-21		22768380	10.1038/srep00487	xxxx-xxxx	Scientific Reports	Genes down-regulated in spaceflight are involved in the control of longevity in Caenorhabditis elegans	Honda	2012	0		
668	chrII	10902828	10903076	3500149422	43		10902828	10903076	8421504	2	22,21	0,227	c,g	350014942200000023,350014942200000023,350014942200000022,350014942200000022	0-22,0-22,0-21,0-21		22768380	10.1038/srep00487	xxxx-xxxx	Scientific Reports	Genes down-regulated in spaceflight are involved in the control of longevity in Caenorhabditis elegans	Honda	2012	0		
668	chrII	10902828	10903076	3500062275	43		10902828	10903076	8421504	2	22,21	0,227	c,g	350006227500000023,350006227500000023,350006227500000022,350006227500000022	0-22,0-22,0-21,0-21		22768380	10.1038/srep00487		Scientific Reports	Genes down-regulated in spaceflight are involved in the control of longevity in Caenorhabditis elegans	Yoko	2012	0		
668	chrII	10910251	10915529	3500337592	52		10910251	10915529	8421504	3	10,17,25	0,11,5253	c,g	350033759200000014,350033759200000013,350033759200000013	0-31,0-25,0-25		19432959	10.1186/1749-8104-4-16	1749-8104	Neural Development	Interactions between innexins UNC-7 and UNC-9 mediate electrical synapse specificity in the Caenorhabditis elegans locomotory nervous system	Starich	2009	4		
668	chrII	10919061	10919110	3500017433	49		10919061	10919110	8421504	1	49	0	p,c	350001743300000020,350001743300000016,350001743300000068,350001743300015009	14-35,14-35,0-41,0-45						CONTROL OF PESTS IN PLANTS - Patent application	www.faqs.org	0	0		
668	chrII	10929279	10929372	3500104191	90		10929279	10929372	8421504	2	45,45	0,48	p	350010419100015190,350010419100015191	0-45,0-45						Human methionine synthase: cloning, and methods for evaluating risk of neural tube defects, cardiovascular disease, and cancer	Gravel	1997	0		
668	chrII	10951253	10953673	3500258151	188		10951253	10953673	8421504	5	20,20,108,20,20	0,42,725,2339,2400	p,c,g	350025815100000001,350025815100000001,350025815100000003,350025815100015003,350025815100000002,350025815100000000	0-20,0-20,0-20,9-117,0-20,0-20						nanos-related genes in C. elegans	ev.biologists.org	0	0		
668	chrII	10965843	10965869	3500185454	23		10965843	10965869	8421504	2	13,10	0,16	g	350018545400000016	0-23						Primer Sequence Primers for Forward (5′→3 (5 3 Reverse Annealing temperature (°C)	www.molvis.org	0	0		
668	chrII	10975508	10995377	3500401248	179		10975508	10995377	8421504	8	26,21,22,21,22,19,23,25	0,8230,8315,10277,10402,19458,19619,19844	c,g	350040124800000006,350040124800000006,350040124800000004,350040124800000004,350040124800000007,350040124800000007,350040124800000003,350040124800000003,350040124800000005,350040124800000005,350040124800000000,350040124800000000,350040124800000001,350040124800000001,350040124800000002,350040124800000002	0-26,0-26,0-21,0-21,0-22,0-22,0-21,0-21,0-22,0-22,0-19,0-19,0-23,0-23,0-25,0-25		11959824		0950-1991	Development	The C. elegans LAR-like receptor tyrosine phosphatase PTP-3 and the VAB-1 Eph receptor tyrosine kinase have partly redundant functions in morphogenesis	Harrington	2002	7		
668	chrII	10980904	10980931	3500266598	23		10980904	10980931	8421504	2	6,17	0,10	g	350026659800000134	4-27						<Html><Title> Complet list of 3jqb hssp file Complet list of	cnptia.embrapa.br	0	0		
83	chrII	10998927	11016133	3500144391	40		10998927	11016133	8421504	4	15,6,14,5	0,16,17184,17201	c,g	350014439100000221,350014439100001122	9-30,18-37						SPIDER SILK DRAGLINE POLYNUCLEOTIDES, POLYPEPTIDES AND METHODS OF USE THEREOF - Patent application	www.faqs.org	0	0		
83	chrII	11021748	11331805	3500073651	6912		11021748	11331805	8421504	4	568,3818,2393,133	0,569,4388,309924	g	350007365100000023,350007365100000026	4-9609,924-10177						用双链rna抑制鉴定基因功能	G*Pu Lai Ting Ke 	2007	0		
83	chrII	11021748	11331805	3500064404	6912		11021748	11331805	8421504	4	568,3818,2393,133	0,569,4388,309924	g	350006440400000023,350006440400000026	4-9597,920-10156					Patent	用双链rna抑制鉴定基因功能 (Patent CN:1198938)	G*Pu Lai Ting Ke 	2005	0		
669	chrII	11022290	11022314	3500358796	24		11022290	11022314	8421504	1	24	0	g	350035879600000009	9-33						ATP-binding cassette transporters are required for efficient RNA interference in Caenorhabditis elegans. - ResearchGate	.researchgate.net	0	0		
669	chrII	11022290	11022314	3500052689	24		11022290	11022314	8421504	1	24	0	g	350005268900000009	9-33		16723499	10.1091/mbc.E06-03-0192	1059-1524	Molecular Biology of the Cell	ATP-binding Cassette Transporters Are Required for Efficient RNA Interference in Caenorhabditis elegans	Sundaram	2006	5		
83	chrII	11022317	11331805	3500073651	6125		11022317	11331805	8421504	17	1477,939,117,527,448,105,263,13,955,172,280,116,294,116,39,131,133	0,1478,2418,2639,3264,3713,3819,4083,4099,5056,5229,5510,5627,5922,6040,6081,309355	g	350007365100000027	927-9960						用双链rna抑制鉴定基因功能	G*Pu Lai Ting Ke 	2007	0		
83	chrII	11022317	11331805	3500064404	6340		11022317	11331805	8421504	7	1442,106,2268,1247,149,995,133	0,1443,1550,3819,5067,5217,309355	g	350006440400000027	924-10163					Patent	用双链rna抑制鉴定基因功能 (Patent CN:1198938)	G*Pu Lai Ting Ke 	2005	0		
669	chrII	11058162	11083824	3500396785	4319		11058162	11083824	8421504	84	201,23,27,7,26,4,23,10,101,99,99,26,20,11,31,15,218,98,11,11,10,6,47,41,8,183,79,13,8,25,6,20,1,21,39,33,35,166,99,51,12,29,72,127,99,107,84,5,104,79,46,62,7,16,43,33,15,82,52,48,80,119,45,45,14,6,32,31,38,169,52,17,89,24,4,27,21,147,142,15,53,45,13,17	0,212,236,301,309,344,388,415,447,549,649,780,847,868,880,915,931,1150,1285,1297,1346,1357,1364,1414,1456,1465,1666,1754,1768,1777,1815,1824,2042,2047,2069,2110,2145,2233,2400,2876,3392,3411,3443,3621,3749,3849,5190,8497,8505,9180,9260,9356,9419,9428,9445,9489,9527,10315,10399,10827,10876,11436,11559,12494,12553,12568,12575,12611,12645,12684,12854,12921,12939,13029,13057,13062,13090,15189,15519,20498,20518,22261,25631,25645	c,g	350039678500000694,350039678500000693,350039678500000692,350039678500000692,350039678500000689,350039678500000687,350039678500000687,350039678500000686,350039678500000686,350039678500000685,350039678500000685,350039678500000684,350039678500000683,350039678500000683,350039678500000682,350039678500000682,350039678500000681,350039678500000681,350039678500000680,350039678500000680,350039678500000676,350039678500000673,350039678500000672,350039678500000672,350039678500000844,350039678500000844,350039678500000843,350039678500000671,350039678500000671,350039678500000842,350039678500000842,350039678500000670,350039678500000670,350039678500000838,350039678500000838,350039678500000669,350039678500000668,350039678500000668,350039678500000834,350039678500000834,350039678500000667,350039678500000667,350039678500000832,350039678500000832,350039678500000666,350039678500000666,350039678500000831,350039678500000831,350039678500000664,350039678500000664,350039678500000662,350039678500000662,350039678500000661,350039678500000661,350039678500000826,350039678500000826,350039678500000660,350039678500000660,350039678500000825,350039678500000659,350039678500000823,350039678500000657,350039678500000657,350039678500000822,350039678500000656,350039678500000655,350039678500000655,350039678500000654,350039678500000653,350039678500000653,350039678500000651,350039678500000649,350039678500000648,350039678500000648,350039678500000647,350039678500000646,350039678500000646,350039678500000643,350039678500000805,350039678500000645,350039678500000804,350039678500000803,350039678500000803,350039678500000642,350039678500000800,350039678500000640,350039678500000640,350039678500000797,350039678500000797,350039678500000639,350039678500000639,350039678500000794,350039678500000638,350039678500000638,350039678500000637,350039678500000793,350039678500000636,350039678500000760,350039678500000760,350039678500000635,350039678500000635,350039678500000757,350039678500000634,350039678500000633,350039678500000633,350039678500000627	0-101,0-100,0-50,0-50,0-72,0-101,0-101,0-99,0-99,0-99,0-99,0-26,0-95,0-95,0-100,0-100,0-100,0-100,0-103,0-103,0-22,0-98,0-97,0-97,0-24,0-24,0-54,0-100,0-100,0-29,0-29,0-79,0-79,4-31,4-31,0-83,0-92,0-92,0-64,0-64,0-101,0-101,0-27,0-27,0-100,0-100,3-24,3-24,0-99,0-99,0-95,0-95,0-99,0-99,0-20,0-20,0-99,0-99,6-38,0-106,0-20,0-99,0-99,0-25,0-97,0-100,0-100,0-99,0-99,0-99,0-92,0-97,0-100,0-100,0-99,0-101,0-101,0-89,0-45,5-90,0-43,0-34,0-34,0-99,0-20,0-97,0-97,0-51,0-51,0-60,0-60,0-55,0-21,0-21,0-95,0-29,0-100,0-33,0-33,0-100,0-100,0-33,0-97,0-98,0-98,0-30						Vertebrate homologues of unc-53 protein of c. elegans	Bogaert	1998	0		
669	chrII	11061360	11061391	3500307734	25		11061360	11061391	8421504	3	7,4,14	0,12,17	g	350030773400000200	5-30						Simple sequence repeat marker development and genetic mapping in quinoa (Chenopodium quinoa Willd.)	www.ias.ac.in	0	0		
669	chrII	11069604	11089357	3500038490	91		11069604	11089357	8421504	3	40,24,27	0,4081,19726	c,g	350003849000000002,350003849000000002,350003849000000003,350003849000000003,350003849000000006,350003849000000006,350003849000000005,350003849000000005,350003849000000007,350003849000000007	0-20,0-20,0-20,0-20,11-35,11-35,20-47,20-47,14-39,14-39		12091307		0950-1991	Development	unc-53 controls longitudinal migration in C. elegans	Stringham	2002	7		
669	chrII	11083094	11083125	3500105864	27		11083094	11083125	8421504	2	13,14	0,17	g	350010586400000334	5-32							www.brassica.info	0	0		
669	chrII	11098284	11098595	3500209861	74		11098284	11098595	8421504	2	23,51	0,260	p,g	350020986100000010,350020986100000005,350020986100015025	0-23,0-23,0-51						METHOD OF EXPRESSING dsRNA IN PLANTS TO INHIBIT INSECT PESTS - DNA PLANT TECHNOLOGY CORPORATION	www.sumobrain.com	0	0		
670	chrII	11167160	11167242	3500288532	82		11167160	11167242	8421504	1	82	0	c,g	350028853200000006,350028853200000006	0-82,0-82						ScienceDirect.com - Genomics - A combined computational and experimental analysis of two families of snoRNA genes from Caenorhabditis elegans, revealing the expression and evolution pattern of snoRNAs in nematodes	sciencedirect.com	0	0		
670	chrII	11199886	11199916	3500414846	24		11199886	11199916	8421504	3	5,13,6	0,7,24	g	350041484600003352	17-42						Rank Transcription unit Names NtcA site Downstream of ntcA site Position of ntcA site Score -10 like	coitweb.uncc.edu	0	0		
670	chrII	11224117	11224193	3500288532	76		11224117	11224193	8421504	1	76	0	c,g	350028853200000007,350028853200000007	0-76,0-76						ScienceDirect.com - Genomics - A combined computational and experimental analysis of two families of snoRNA genes from Caenorhabditis elegans, revealing the expression and evolution pattern of snoRNAs in nematodes	sciencedirect.com	0	0		
670	chrII	11235311	11236224	3500339371	741		11235311	11236224	8421504	5	297,13,126,140,165	0,303,361,539,748	p	350033937100015109,350033937100015080,350033937100015079,350033937100015049,350033937100015028,350033937100015011	0-240,0-57,0-114,0-165,0-102,0-63						THE J BIOLOGICAL C © 2003 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. Overlapping Specificities of the Mitochondrial Cytochrome c and c Heme Lyases*	ci.ohio-state.edu	0	0		
670	chrII	11255600	11255627	3500140543	24		11255600	11255627	8421504	2	12,12	0,15	c	350014054300000014	0-24						Next Generation Sequencing Bioinformatics	rofs.sci.univr.it	0	0		
671	chrII	11323282	11323332	3500249133	50		11323282	11323332	8421504	1	50	0	c,g	350024913300000011,350024913300000011	0-50,0-50							roarrays.ucsd.edu	0	0		
671	chrII	11328443	11328467	3500229451	23		11328443	11328467	8421504	2	9,14	0,10	g	350022945100000007	0-23						<HTML><HEAD><meta http-equiv="Content-Type" content="text/html; charset=ISO-8859-1"><LINK REL="SHORT	.economie.fgov.be	0	0		
671	chrII	11336663	11337685	3500436017	41		11336663	11337685	8421504	2	21,20	0,1002	c,g	350043601700000013,350043601700000012,350043601700000012	8-29,10-30,10-30			10.1002/dvdy.10259	1097-0177	Developmental Dynamics	Caenorhabditis elegans exoskeleton collagen COL-19: An adult-specific marker for collagen modification and assembly, and the analysis of organismal morphology - Thein - 2003 - Developmental Dynamics - Wiley Online Library	Thein	2003	0		
671	chrII	11354382	11354408	3500126049	26		11354382	11354408	8421504	1	26	0	g	350012604900000003	0-26		11078724			American Journal of Physiology - Cell Physiolog	 Into Ion Channel and Transporter Function. Caenorhabditis elegans ClC-type chloride channels: novel variants and functional expression	Nehrke	2000	0		
672	chrII	11424197	11424220	3500358649	23		11424197	11424220	8421504	1	23	0	g	350035864900000059	0-23						Materialien und M	ebdoc.sub.gwdg.de	0	0		
672	chrII	11438356	11438383	3500257367	27		11438356	11438383	8421504	1	27	0	g	350025736700000001	26-53						 RAB-10 Is Required for Endocytic Recycling in the Caenorhabditis elegans Intestine□ D 	rch.microsoft.com	0	0		
672	chrII	11438356	11438383	3500008284	27		11438356	11438383	8421504	1	27	0	g	350000828400000005	26-53		19158391	10.1091/mbc.E08-08-0837	1059-1524	Molecular Biology of the Cell	Caveolin-2 Is Required for Apical Lipid Trafficking and Suppresses Basolateral Recycling Defects in the Intestine of Caenorhabditis elegans	Parker	2009	5		
672	chrII	11439259	11439285	3500140650	26		11439259	11439285	8421504	1	26	0	c,g	350014065000000004,350014065000000004	0-26,0-26		19174521	10.1073/pnas.0810338106		Proceedings of the National Academy of Sciences of the United States of America	Biosynthesis of the Caenorhabditis elegans dauer pheromone	Rebecca	2009	0		
672	chrII	11442673	11443715	3500280197	40		11442673	11443715	8421504	2	20,20	0,1022	c,g	350028019700000000,350028019700000001,350028019700000001	12-32,15-35,15-35						CiteULike: Identification and Characterization of Factors Required for Microtubule Growth and Nucleation in the Early C. elegans Embryo	www.citeulike.org	0	0		
672	chrII	11446852	11446876	3500271863	24		11446852	11446876	8421504	1	24	0	c,g	350027186300000073,350027186300000074,350027186300000074	1-24,0-23,0-23						Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel	biomedcentral.com	0	0		
672	chrII	11446852	11446875	3500421940	23		11446852	11446875	8421504	1	23	0	c,g	350042194000000027,350042194000000027	0-23,0-23						ThemicroRNAs of Caenorhabditis elegans	cseweb.ucsd.edu	0	0		
672	chrII	11446852	11446875	3500168776	23		11446852	11446875	8421504	1	23	0	c,g	350016877600001692,350016877600001692	0-23,0-23						Micrornas (mirnas) For Plant Growth And Development 	.freshpatents.com	0	0		
672	chrII	11452862	11455560	3500169765	63		11452862	11455560	8421504	3	19,24,20	0,1052,2678	c,g	350016976500000016,350016976500000007,350016976500000019,350016976500000009,350016976500000009	0-19,8-28,7-30,0-20,0-20						ScienceDirect.com - Mechanisms of Development - Unique and redundant functions of SR proteins, a conserved family of splicing factors, in Caenorhabditiselegans development	sciencedirect.com	0	0		
672	chrII	11464832	11468420	3500446855	1312		11464832	11468420	8421504	10	124,154,94,107,159,94,25,149,153,253	0,180,396,548,708,929,1024,2912,3123,3335	c,g	350044685500000006,350044685500000083,350044685500000083,350044685500000085,350044685500000085,350044685500000087,350044685500000089,350044685500000089,350044685500000091,350044685500000091,350044685500000093,350044685500000093,350044685500000095,350044685500000096,350044685500000097,350044685500000099,350044685500000099,350044685500000101,350044685500000101,350044685500000025,350044685500000103,350044685500000103,350044685500000106,350044685500000106,350044685500000105,350044685500000105,350044685500000026,350044685500000026	3-1308,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,283-358,0-60,0-60,0-60,0-60,0-54,0-54,0-30,0-30						Étude de la fonction des Rho GAP au cours du développement embryonnaire du nématode caenorhabditis elegans	.archipel.uqam.ca	0	0		
672	chrII	11470322	11471381	3500076526	528		11470322	11471381	8421504	6	54,54,48,174,162,36	0,515,572,678,855,1023	p	350007652600015051,350007652600015049,350007652600015047	0-177,0-177,0-177						41 human secreted proteins	Komatsoulis	2001	0		
672	chrII	11470347	11470372	3500144391	24		11470347	11470372	8421504	2	12,12	0,13	c	350014439100000286,350014439100000318,350014439100000376	25-45,13-37,25-45						SPIDER SILK DRAGLINE POLYNUCLEOTIDES, POLYPEPTIDES AND METHODS OF USE THEREOF - Patent application	www.faqs.org	0	0		
672	chrII	11484619	11484688	3500288532	69		11484619	11484688	8421504	1	69	0	c,g	350028853200000002,350028853200000002	0-69,0-69						ScienceDirect.com - Genomics - A combined computational and experimental analysis of two families of snoRNA genes from Caenorhabditis elegans, revealing the expression and evolution pattern of snoRNAs in nematodes	sciencedirect.com	0	0		
672	chrII	11485650	11485676	3500262670	23		11485650	11485676	8421504	2	7,16	0,10	g	350026267000000041	19-42					Patent	Antibody library (Patent US:8101553)	Kurosawa	2012	0		
672	chrII	11489667	11490307	3500247198	573		11489667	11490307	8421504	5	117,156,66,204,30	0,123,285,357,610	p	350024719800015106,350024719800015104,350024719800015102,350024719800015099	0-57,0-171,0-174,0-180						50 human secreted proteins	Komatsoulis	2000	0		
672	chrII	11496142	11496170	3500407806	23		11496142	11496170	8421504	2	12,11	0,17	c	350040780600000144	0-23						METHOD RELATING TO SWEETNESS ENHANCEMENT - Patent application	www.faqs.org	0	0		
672	chrII	11519643	11526946	3500116523	3235		11519643	11526946	8421504	68	19,55,48,7,57,54,1,56,57,59,55,55,52,3,55,54,59,53,55,56,6,49,55,55,55,28,27,57,57,58,57,40,59,57,59,57,58,58,40,58,59,59,58,56,58,40,58,45,10,56,55,55,54,55,56,57,54,55,6,49,56,54,58,52,5,55,11,49	0,24,84,840,852,913,972,1410,1469,1529,1591,1649,1709,3506,3514,3574,3633,3696,3754,3814,3875,3932,3986,4045,4105,4165,4864,4896,4956,5016,5077,5136,5196,5257,5316,5377,5436,5496,5556,5616,5676,5737,5798,5858,5916,5976,6036,6096,6189,6204,6264,6324,6384,6443,6503,6563,6625,6684,6744,6802,6856,6916,6975,7036,7174,7182,7242,7254	c,g	350011652300000030,350011652300000029,350011652300000028,350011652300000027	0-1454,0-388,0-388,0-1005						Therapeutic and diagnostic tools for impaired glucose tolerance conditions - US Patent 7414169 Description	ww.patentstorm.us	0	0		
672	chrII	11519643	11526946	3500023596	3235		11519643	11526946	8421504	68	19,55,48,7,57,54,1,56,57,59,55,55,52,3,55,54,59,53,55,56,6,49,55,55,55,28,27,57,57,58,57,40,59,57,59,57,58,58,40,58,59,59,58,56,58,40,58,45,10,56,55,55,54,55,56,57,54,55,6,49,56,54,58,52,5,55,11,49	0,24,84,840,852,913,972,1410,1469,1529,1591,1649,1709,3506,3514,3574,3633,3696,3754,3814,3875,3932,3986,4045,4105,4165,4864,4896,4956,5016,5077,5136,5196,5257,5316,5377,5436,5496,5556,5616,5676,5737,5798,5858,5916,5976,6036,6096,6189,6204,6264,6324,6384,6443,6503,6563,6625,6684,6744,6802,6856,6916,6975,7036,7174,7182,7242,7254	c,g	350002359600000030,350002359600000029,350002359600000028,350002359600000027	0-1454,0-388,0-388,0-1005						US Patent # 7,414,169. Therapeutic and diagnostic tools for impaired glucose tolerance conditions - Patents.com	www.patents.com	0	0		
672	chrII	11521297	11523177	3500259767	40		11521297	11523177	8421504	2	20,20	0,1860	c,g	350025976700000041,350025976700000041,350025976700000040,350025976700000040	0-20,0-20,0-20,0-20		18828672	10.1371/journal.pbio.0060233		PLoS Biology	Caenorhabditis elegans HCF-1 Functions in Longevity Maintenance as a DAF-16 Regulator	Ji	2008	0		
673	chrII	11537418	11538476	3500270812	47		11537418	11538476	8421504	2	25,22	0,1036	c,g	350027081200000008,350027081200000009,350027081200000009	10-35,9-31,9-31		19675127	10.1242/dev.039008	0950-1991	Development	Systematic analysis of dynamic miRNA-target interactions during C. elegans development	Zhang	2009	7		
673	chrII	11537442	11538038	3500167862	41		11537442	11538038	8421504	2	22,19	0,577	c,g	350016786200000003,350016786200000002,350016786200000002	0-22,0-19,0-19						Genome-scale spatiotemporal analysis of Caenorhabditis elegans microRNA promoter activity	ship.umassmed.edu	0	0		
673	chrII	11537529	11537961	3500338804	169		11537529	11537961	8421504	3	111,20,38	0,178,394	c,g	350033880400000027,350033880400000005,350033880400000134,350033880400000035,350033880400000016,350033880400000016,350033880400000092,350033880400000092,350033880400000006,350033880400000006,350033880400000093,350033880400000093,350033880400000157,350033880400000065,350033880400000056,350033880400000008	0-111,0-26,0-84,0-109,0-93,0-93,0-26,0-26,0-67,0-67,0-23,0-23,19-39,84-122,73-111,83-121						miR-Intess: cel-mir-35	www.macgenome.org	0	0		
673	chrII	11537531	11539429	3500004218	259		11537531	11539429	8421504	12	20,21,19,19,25,22,30,19,25,20,20,19	0,51,101,202,319,450,575,658,690,806,914,1879	c,g	350000421800000004,350000421800000003,350000421800000003,350000421800000006,350000421800000008,350000421800000009,350000421800000010,350000421800000011,350000421800000011,350000421800000014,350000421800000013,350000421800000016,350000421800000016,350000421800000015,350000421800000021,350000421800000017,350000421800000017,350000421800000001	0-20,0-21,0-21,9-28,9-28,9-32,6-29,9-31,9-31,9-30,8-27,9-28,9-28,9-34,8-28,9-29,9-29,0-19		21691303	10.1038/cr.2011.102	1001-0602	Cell Research	mir-35 is involved in intestine cell G1/S transition and germ cell proliferation in C. elegans	Liu	2011	8		
673	chrII	11537603	11538325	3500389139	154		11537603	11538325	8421504	7	22,22,22,22,22,22,22	0,105,225,322,475,571,700	c,g	350038913900000150,350038913900000150,350038913900000151,350038913900000151,350038913900000152,350038913900000152,350038913900000153,350038913900000154,350038913900000154,350038913900000155,350038913900000155,350038913900000156,350038913900000156	22-44,22-44,22-44,22-44,22-44,22-44,22-44,22-44,22-44,22-44,22-44,22-44,22-44						Anti-microrna oligonucleotide molecules	Tuschl	2006	0		
673	chrII	11537603	11538325	3500306561	132		11537603	11538325	8421504	6	22,22,22,22,22,22	0,105,225,322,571,700	c,g	350030656100000149,350030656100000149,350030656100000150,350030656100000150,350030656100000151,350030656100000151,350030656100000152,350030656100000154,350030656100000154,350030656100000155,350030656100000155	22-44,22-44,22-44,22-44,22-44,22-44,22-44,22-44,22-44,22-44,22-44						Anti-microRNA oligonucleotide molecules	Landthaler	2011	0		
673	chrII	11537603	11538325	3500257436	154		11537603	11538325	8421504	7	22,22,22,22,22,22,22	0,105,225,322,475,571,700	c,g	350025743600000149,350025743600000149,350025743600000150,350025743600000150,350025743600000151,350025743600000151,350025743600000152,350025743600000153,350025743600000154,350025743600000154,350025743600000155,350025743600000155	22-44,22-44,22-44,22-44,22-44,22-44,22-44,22-44,22-44,22-44,22-44,22-44						Anti-MicroRna Oligonucleotide Molecules	Tuschl	2007	0		
673	chrII	11537603	11538325	3500232262	155		11537603	11538325	8421504	7	22,22,22,23,22,22,22	0,105,225,322,475,571,700	c,g	350023226200000149,350023226200000149,350023226200000150,350023226200000150,350023226200000151,350023226200000151,350023226200000152,350023226200000153,350023226200000153,350023226200000154,350023226200000154,350023226200000155,350023226200000155	22-44,22-44,22-44,22-44,22-44,22-44,21-44,22-44,22-44,22-44,22-44,22-44,22-44					Patent	Anti-microRNA oligonucleotide molecules (Patent US:7772389)	Tuschl	2010	0		
673	chrII	11537828	11538325	3500011796	88		11537828	11538325	8421504	4	22,22,22,22	0,250,346,475	c,g	350001179600000017,350001179600000017,350001179600000019,350001179600000019,350001179600000020,350001179600000020,350001179600000021,350001179600000021	0-22,0-22,0-22,0-22,0-22,0-22,0-22,0-22						Wyman Supplemental Methods	genome.cshlp.org	0	0		
673	chrII	11537919	11537944	3500185748	25		11537919	11537944	8421504	1	25	0	g	350018574800000001	0-25		16489184	10.1261/rna.2231506	1355-8382	RNA	Interacting endogenous and exogenous RNAi pathways in Caenorhabditis elegans	LEE	2006	5		
673	chrII	11538024	11538111	3500090499	87		11538024	11538111	8421504	1	87	0	c,g	350009049900000008,350009049900000007,350009049900000007	0-87,0-19,0-19						miR-Intess: cel-mir-39	www.macgenome.org	0	0		
673	chrII	11542802	11544441	3500461406	40		11542802	11544441	8421504	2	20,20	0,1619	c,g	350046140600000001,350046140600000001,350046140600000000,350046140600000000	0-20,0-20,0-20,0-20		17914060	10.1091/mbc.E07-03-0243	1059-1524	Molecular Biology of the Cell	Caenorhabditis elegans prom-1 Is Required for Meiotic Prophase Progression and Homologous Chromosome Pairing	Jantsch	2007	5		
673	chrII	11542802	11544441	3500045766	40		11542802	11544441	8421504	2	20,20	0,1619	c,g	350004576600000001,350004576600000001,350004576600000000,350004576600000000	0-20,0-20,0-20,0-20			10.1091/mbc.E07-03-0243		Molecular Biology of the Cell	Caenorhabditis elegans prom-1 Is Required for Meiotic Prophase Progression and Homologous Chromosome Pairing	Verena	2007	0		
673	chrII	11543531	11543557	3500361565	24		11543531	11543557	8421504	2	11,13	0,13	g	350036156500000005	6-33						122 2006 338 Article-web 1.	sippe.ac.cn	0	0		
673	chrII	11557079	11557106	3500257805	25		11557079	11557106	8421504	2	9,16	0,11	c	350025780500000196	0-25						<Html><Title> Complet list of 1v0l hssp file Complet list of	cnptia.embrapa.br	0	0		
673	chrII	11557080	11557107	3500129293	24		11557080	11557107	8421504	2	8,16	0,11	c	350012929300000119	0-24						<Html><Title> Complet list of 2wta hssp file Complet list of	cnptia.embrapa.br	0	0		
673	chrII	11569777	11572863	3500202045	167		11569777	11572863	8421504	8	20,23,20,22,19,20,20,23	0,306,345,1040,1962,2071,2209,3063	c,g	350020204500000010,350020204500000010,350020204500000006,350020204500000006,350020204500000011,350020204500000011,350020204500000007,350020204500000007,350020204500000004,350020204500000004,350020204500000008,350020204500000008,350020204500000009,350020204500000009,350020204500000005	0-20,0-20,0-23,0-23,0-20,0-20,0-22,0-22,0-19,0-19,0-20,0-20,0-20,0-20,0-23						International Journal for Parasitology	005.pasteur.ac.ir	0	0		
673	chrII	11585604	11585628	3500054618	23		11585604	11585628	8421504	2	8,15	0,9	c,g	350005461800001065,350005461800001065	1-25,1-25						SOYBEAN PLANTS HAVING SUPERIOR AGRONOMIC PERFORMANCE AND METHODS FOR THEIR PRODUCTION - Patent application	www.faqs.org	0	0		
673	chrII	11586407	11586434	3500321117	23		11586407	11586434	8421504	2	8,15	0,12	g	350032111700000402	0-26						<Html><Title> Complet list of 1pa1 hssp file Complet list of	cnptia.embrapa.br	0	0		
673	chrII	11613513	11613623	3500161294	23		11613513	11613623	8421504	3	8,5,10	0,93,100	c	350016129400000000	0-23				0095-1137		Characteristic Signatures of the lytA Gene Provide a Basis for Rapid and Reliable Diagnosis of Streptococcus pneumoniae Infections 	jcm.asm.org	0	4		
673	chrII	11616051	11616896	3500443211	25		11616051	11616896	8421504	2	6,19	0,826	c	350044321100001030	0-25						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
673	chrII	11643476	11643499	3500459839	23		11643476	11643499	8421504	1	23	0	g	350045983900000140	2-25						An investigation into flavonoid pathway regulation in sweet cherry (Prunus avium L.) fruit	y.adelaide.edu.au	0	0		
673	chrII	11650822	11650848	3500221520	24		11650822	11650848	8421504	2	9,15	0,11	g	350022152000000009	8-38						 J-STORE(明細書～ＲＮＡ干渉によりラブドウイルスに対して抵抗性を得るた̈	jstore.jst.go.jp	0	0		
674	chrII	11699085	11699277	3500156356	63		11699085	11699277	8421504	2	36,27	0,165	p	350015635600015000	0-63			10.1111/j.1365-2958.2006.05216.x	1365-2958	Molecular Microbiology	The glycosylphosphatidylinositol (GPI) biosynthetic pathway of bloodstream-form Trypanosoma brucei is dependent on the de novo synthesis of inositol - Martin - 2006 - Molecular Microbiology - Wiley Online Library	Martin	2006	0		
674	chrII	11699088	11699277	3500212370	60		11699088	11699277	8421504	2	33,27	0,162	p	350021237000015000	0-60						Spatial and temporal expression analysis of D- -inositol 3-phosphate synthase (MIPS) gene family in Glycine max	demicjournals.org	0	0		
674	chrII	11707700	11707724	3500136689	23		11707700	11707724	8421504	2	19,4	0,20	c,g	350013668900000001,350013668900000001	3-28,3-28			10.1110/ps.041210405		Protein Science : A Publication of the Protein Society	Enterococcus faecalis phosphomevalonate kinase	Stephanie	2005	0		
674	chrII	11743915	11747584	3500129913	38		11743915	11747584	8421504	2	19,19	0,3650	c,g	350012991300000001,350012991300000001,350012991300000000,350012991300000000	0-19,0-19,0-19,0-19			10.1186/gb-2000-2-1-research0002	1465-6906	Genome Biology	Effectiveness of specific RNA-mediated interference through ingested double-stranded RNA in Caenorhabditis elegans	Kamath	2000	0		
674	chrII	11743972	11746070	3500254985	46		11743972	11746070	8421504	2	23,23	0,2075	c,g	350025498500000002,350025498500000002,350025498500000003	0-23,0-23,0-23						DEPLETION OF Y ASSOCIATED PROTEINS BY RNAi DOWN-REGULATES THE Y RNA IN CAENORHABDITIS ELEGANS	www.pakbs.org	0	0		
674	chrII	11745714	11745993	3500201814	96		11745714	11745993	8421504	4	21,27,21,27	0,108,183,252	p	350020181400015010,350020181400015006	0-48,0-48						PTX sensitive G proteins, the production and use thereof	Siffert	1999	0		
674	chrII	11746903	11746927	3500206169	24		11746903	11746927	8421504	1	24	0	c	350020616900000025	0-24						<HTML> <HEAD> <TITLE>Table 2 - Chromosomal localization of selected SCARs converted from new RAPD,	hnology.equipu.cl	0	0		
674	chrII	11758150	11761688	3500443850	66		11758150	11761688	8421504	2	33,33	0,3505	c,g	350044385000000008,350044385000000008,350044385000000009	0-33,0-33,0-33			10.1111/j.1474-9726.2006.00192.x	1474-9726	Aging Cell	Blueberry polyphenols increase lifespan and thermotolerance in Caenorhabditis elegans - Wilson - 2006 - Aging Cell - Wiley Online Library	Wilson	2006	0		
674	chrII	11760173	11760221	3500270521	48		11760173	11760221	8421504	1	48	0	p	350027052100015016	27-75						PROTEÔMICA DIFERENCIAL EM CLONES DE	www.tede.ufv.br	0	0		SNORD48
674	chrII	11760263	11760311	3500418440	48		11760263	11760311	8421504	1	48	0	p	350041844000015011	0-48						Characterization of recombinant ketol-acid	is.lib.ncu.edu.tw	0	0		
674	chrII	11760269	11760314	3500211515	45		11760269	11760314	8421504	1	45	0	p	350021151500015020	3-48						IN VIVO CTL ELICITATION BY HEAT SHOCK PROTEIN FUSION PROTEINS MAPS TO A DISCRETE DOMAIN AND IS CD4+ T CELL-INDEPENDENT - Patent application	www.faqs.org	0	0		
674	chrII	11761127	11761190	3500395633	63		11761127	11761190	8421504	1	63	0	p	350039563300015032	69-132						Functional significance of Hsp70 post- translational modification in prion propagation and cellular function	eprints.nuim.ie	0	0		
674	chrII	11761151	11761196	3500298715	45		11761151	11761196	8421504	1	45	0	p	350029871500015011	0-45						CATECHOLAMINE REGULATED PROTEIN - Patent application	www.faqs.org	0	0		HSPA2
675	chrII	11827450	11827477	3500341598	24		11827450	11827477	8421504	2	16,8	0,19	g	350034159800000089	0-24						<Html><Title> Complet list of 1asz hssp file Complet list of	cnptia.embrapa.br	0	0		
675	chrII	11827450	11827477	3500158624	24		11827450	11827477	8421504	2	16,8	0,19	g	350015862400000091	0-24						<Html><Title> Complet list of 1asy hssp file Complet list of	cnptia.embrapa.br	0	0		
675	chrII	11858663	11858689	3500388601	26		11858663	11858689	8421504	1	26	0	g	350038860100000014	0-26		11078724			American Journal of Physiology - Cell Physiolog	 Into Ion Channel and Transporter Function. Caenorhabditis elegans ClC-type chloride channels: novel variants and functional expression	Nehrke	2000	0		
675	chrII	11858663	11858689	3500126049	26		11858663	11858689	8421504	1	26	0	g	350012604900000014	0-26		11078724			American Journal of Physiology - Cell Physiolog	 Into Ion Channel and Transporter Function. Caenorhabditis elegans ClC-type chloride channels: novel variants and functional expression	Nehrke	2000	0		
675	chrII	11858663	11858689	3500022228	26		11858663	11858689	8421504	1	26	0	g	350002222800000014	0-26		11078724			American Journal of Physiology - Cell Physiolog	 Into Ion Channel and Transporter Function. Caenorhabditis elegans ClC-type chloride channels: novel variants and functional expression	Nehrke	2000	0		
675	chrII	11868522	11868549	3500461816	24		11868522	11868549	8421504	3	7,13,4	0,9,23	c	350046181600000117	2-31						Transgenic plants expressing lepidopteran-active δ-endotoxins	Baum	1997	0		
675	chrII	11868522	11868549	3500007879	24		11868522	11868549	8421504	3	7,13,4	0,9,23	c	350000787900000116	2-31						Lepidopteran-resistent transgenic plants	Baum	1999	0		
675	chrII	11869741	11870767	3500034726	40		11869741	11870767	8421504	2	20,20	0,1006	c,g	350003472600000006,350003472600000006,350003472600000007,350003472600000007	19-39,19-39,19-39,19-39						The use of eukaryotic genes affecting chromatin separation for diagnosis and treatment of proliferative diseases	Echeverri	2005	0		
675	chrII	11880894	11889930	3500306561	68		11880894	11889930	8421504	3	22,22,24	0,8913,9012	c,g	350030656100000158,350030656100000156,350030656100000156,350030656100000157,350030656100000157	0-22,22-44,0-22,20-44,0-24						Anti-microRNA oligonucleotide molecules	Landthaler	2011	0		
675	chrII	11880894	11889930	3500232262	68		11880894	11889930	8421504	3	22,22,24	0,8913,9012	c,g	350023226200000158,350023226200000156,350023226200000156,350023226200000157,350023226200000157	0-22,22-44,0-22,20-44,0-24					Patent	Anti-microRNA oligonucleotide molecules (Patent US:7772389)	Tuschl	2010	0		
675	chrII	11880895	11889929	3500271863	44		11880895	11889929	8421504	2	21,23	0,9011	c,g	350027186300000020,350027186300000020,350027186300000012,350027186300000012	0-21,0-21,0-23,0-23						Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel	biomedcentral.com	0	0		
675	chrII	11881045	11881072	3500363058	24		11881045	11881072	8421504	2	12,12	0,15	g	350036305800000377	0-25						<Html><Title> Complet list of 2vpj hssp file Complet list of	cnptia.embrapa.br	0	0		
675	chrII	11885537	11885634	3500037294	23		11885537	11885634	8421504	3	13,3,7	0,14,90	c	350003729400000019	0-23						Plant pla2 polypeptides involved in plant defence reaction, polynucleotides encoding said polypeptides and transformed plants containing them	Dhondt	2001	0		
675	chrII	11889807	11890041	3500389139	68		11889807	11890041	8421504	3	22,24,22	0,99,212	c,g	350038913900000157,350038913900000157,350038913900000158,350038913900000158,350038913900000159,350038913900000159	22-44,22-44,20-44,20-44,22-44,22-44						Anti-microrna oligonucleotide molecules	Tuschl	2006	0		
675	chrII	11889807	11889930	3500257436	46		11889807	11889930	8421504	2	22,24	0,99	c,g	350025743600000156,350025743600000156,350025743600000157,350025743600000157	22-44,22-44,20-44,20-44						Anti-MicroRna Oligonucleotide Molecules	Tuschl	2007	0		
675	chrII	11897330	11903983	3500053726	58		11897330	11903983	8421504	3	20,19,19	0,5000,6634	g	350005372600000006,350005372600000003,350005372600000000	0-20,0-19,0-19						LIN-39 and the EGFR/RAS/MAPK pathway regulate C. elegans vulval morphogenesis via the VAB-23 zinc finger protein	www.imls.uzh.ch	0	0		
675	chrII	11902207	11902235	3500390912	24		11902207	11902235	8421504	2	7,17	0,11	g	350039091200000117	0-24						UNIVERSITE DE LIMOGES	cations.unilim.fr	0	0		
84	chrII	11918278	11933161	3500467559	57		11918278	11933161	8421504	2	27,30	0,14853	c	350046755900000013,350046755900000012	11-38,9-39						Supplementary Materials for	ww.sciencemag.org	0	0		
84	chrII	11919364	11935350	3500321781	230		11919364	11935350	8421504	10	20,20,23,39,20,24,21,21,23,19	0,1034,1311,1987,2083,12508,12753,13867,15653,15967	c,g	350032178100000012,350032178100000011,350032178100000004,350032178100000015,350032178100000014,350032178100000003,350032178100000009,350032178100000002,350032178100000001,350032178100000007,350032178100000000	0-20,0-20,0-23,15-39,0-39,0-20,0-24,0-21,0-21,0-23,0-19						The terminal differentiation factor LIN-29 is required for proper vulval morphogenesis and egg laying in Caenorhabditis elegans. - ResearchGate	.researchgate.net	0	0		
675	chrII	11919631	11921336	3500155635	401		11919631	11921336	8421504	8	20,54,9,75,90,75,69,9	0,165,228,298,382,807,891,1696	p,c,g	350015563500000002,350015563500000002,350015563500015014,350015563500015012,350015563500015010,350015563500000003,350015563500000003,350015563500000001,350015563500000001,350015563500015008,350015563500015006	0-20,0-20,0-54,0-84,0-90,0-20,0-20,0-20,0-20,0-75,0-78						The heterochronic gene lin-29encodes a zinc finger protein that controls a terminal differentiation event in Caenorhabditis elegans	ev.biologists.org	0	0		
675	chrII	11919775	11919805	3500242901	23		11919775	11919805	8421504	3	6,11,6	0,10,24	g	350024290100000245	10-34						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
676	chrII	11959320	11959353	3500386452	33		11959320	11959353	8421504	1	33	0	c,g	350038645200000790,350038645200000790,350038645200000789	9-42,9-42,9-42						NEUROPROTECTIVE MOLECULES AND METHODS OF TREATING NEUROLOGICAL DISORDERS AND INDUCING STRESS GRANULES	Anderson	2011	0		
676	chrII	11959320	11959353	3500235647	33		11959320	11959353	8421504	1	33	0	c,g	350023564700001583,350023564700001583,350023564700000790,350023564700000790,350023564700000789,350023564700001582	9-42,9-42,9-42,9-42,9-42,9-42						NEUROPROTECTIVE MOLECULES AND METHODS OF TREATING NEUROLOGICAL DISORDERS AND INDUCING STRESS GRANULES - Patent application	www.faqs.org	0	0		
676	chrII	11960831	11960896	3500288532	65		11960831	11960896	8421504	1	65	0	g	350028853200000011	0-65						ScienceDirect.com - Genomics - A combined computational and experimental analysis of two families of snoRNA genes from Caenorhabditis elegans, revealing the expression and evolution pattern of snoRNAs in nematodes	sciencedirect.com	0	0		
676	chrII	11966614	11966739	3500241318	45		11966614	11966739	8421504	2	27,18	0,107	p	350024131800015038	0-45						GTP binding stress-related proteins and methods of use in plants - US Patent 7259294 Description	ww.patentstorm.us	0	0		
676	chrII	11980410	11988386	3500389660	93		11980410	11988386	8421504	4	26,19,20,28	0,5551,6588,7948	c,g	350038966000000006,350038966000000015,350038966000000015,350038966000000016,350038966000000016,350038966000000012,350038966000000007	9-35,0-19,0-19,0-20,0-20,9-37,9-31						Members of the H3K4 trimethylation complex regulate lifespan in a germline-dependent manner in C. elegans	ww.ab-mart.com.cn	0	0		
676	chrII	12012365	12012395	3500077222	23		12012365	12012395	8421504	3	12,5,6	0,14,24	c	350007722200000128	3-26						具有改变的特性的变体	Qia Si Teng *An De Sen 	2003	0		
676	chrII	12012365	12012395	3500076687	23		12012365	12012395	8421504	3	12,5,6	0,14,24	g	350007668700000095	3-26						具有改变的特性的变体	Qia Si Teng *An De Sen 	2009	0		
676	chrII	12023662	12023690	3500467340	26		12023662	12023690	8421504	2	15,11	0,17	c	350046734000000014	8-34						<Html><Title> Complet list of 1kw3 hssp file Complet list of	cnptia.embrapa.br	0	0		
677	chrII	12104178	12104204	3500278210	24		12104178	12104204	8421504	2	14,10	0,16	c	350027821000000012	18-42						Transgenic expression cassettes for the expression of nucleic acids in plant blooms	Ralf	2004	0		
677	chrII	12178229	12178254	3500352612	23		12178229	12178254	8421504	3	13,4,6	0,14,19	c	350035261200000927	0-23						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
678	chrII	12189951	12190177	3500306023	23		12189951	12190177	8421504	2	14,9	0,217	c	350030602300000010	0-23		19181702	10.1093/nar/gkp018		Nucleic Acids Research	Mitochondrial DNA level, but not active replicase, is essential for Caenorhabditis elegans development	Ivana	2009	0		
678	chrII	12215796	12215819	3500421869	23		12215796	12215819	8421504	1	23	0	c	350042186900000081	24-47						 <HTML> <HEAD><TITLE>aooa*Y=aa(c)a3a1aa3/4a3ac"aaeoa1/4aaC/a1ae1ae3 - c1ea13i1/4i1/4	www.j-tokkyo.com	0	0		
678	chrII	12225293	12226119	3500130314	210		12225293	12226119	8421504	3	48,108,54	0,589,772	p	350013031400015067,350013031400015077,350013031400015082,350013031400015083	0-48,0-57,0-51,0-54						DANIELA LUZ AMBRÓSIO	w2.fcfar.unesp.br	0	0		
678	chrII	12283716	12283742	3500291095	23		12283716	12283742	8421504	2	5,18	0,8	c,g	350029109500000013,350029109500000013	4-27,4-27						ESTUDO DO PAPEL DA TCTP ( Translationally Controlled Tumour Protein ) NA RESPOSTA AOS ESTRESSES BIÓTICOS E ABIÓTICOS EM PLANTAS	www2.ibb.unesp.br	0	0		
678	chrII	12290202	12290225	3500134783	23		12290202	12290225	8421504	1	23	0	c,g	350013478300000038,350013478300000038	1-24,1-24						INTERNATIONAL JOURNAL OF INNOVATIVE HORTICULTURE	.researchgate.net	0	0		
678	chrII	12294072	12294096	3500071183	23		12294072	12294096	8421504	2	11,12	0,12	c	350007118300000084	0-23						Molekulargenetische Untersuchungen beim Hund: Genomweite Analysen zur generalisierten Progressiven Retina Atrophie und mitochondriale sowie Y-chromosomale Studien zur genealogischen Abstammung	uhr-uni-bochum.de	0	0		
679	chrII	12341281	12373961	3500218028	39		12341281	12373961	8421504	3	20,8,11	0,32659,32669	g	350021802800000234,350021802800000036	15-35,15-34					Patent	Methods and means to modulate programmed cell death in eukaryotic cells (Patent CN:1289680)	E*Ba Bi Chu Ke 	2006	0		
679	chrII	12347171	12347204	3500344389	30		12347171	12347204	8421504	3	10,15,5	0,12,28	c	350034438900001300	16-46						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
679	chrII	12347171	12347204	3500190843	30		12347171	12347204	8421504	3	10,15,5	0,12,28	c	350019084300001282	16-46						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
679	chrII	12354527	12354553	3500426992	23		12354527	12354553	8421504	2	11,12	0,14	c	350042699200000983	13-42						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
679	chrII	12369340	12369401	3500126074	34		12369340	12369401	8421504	2	17,17	0,44	g	350012607400000376	10-69						<Html><Title> Complet list of 1m2n hssp file Complet list of	cnptia.embrapa.br	0	0		
679	chrII	12387943	12387971	3500196072	23		12387943	12387971	8421504	2	16,7	0,21	g	350019607200001415	2-25						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
679	chrII	12422019	12427963	3500140650	90		12422019	12427963	8421504	4	23,22,22,23	0,1522,3582,5921	c,g	350014065000000003,350014065000000007,350014065000000002,350014065000000002,350014065000000000,350014065000000000	10-33,8-30,13-35,13-35,10-33,10-33		19174521	10.1073/pnas.0810338106		Proceedings of the National Academy of Sciences of the United States of America	Biosynthesis of the Caenorhabditis elegans dauer pheromone	Rebecca	2009	0		
679	chrII	12444971	12444994	3500306261	23		12444971	12444994	8421504	1	23	0	g	350030626100000584	12-35						<Html><Title> Complet list of 2b6p hssp file Complet list of	cnptia.embrapa.br	0	0		
680	chrII	12494739	12494771	3500196959	26		12494739	12494771	8421504	3	12,7,7	0,13,25	g	350019695900000737	10-44						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
680	chrII	12508282	12508318	3500295681	30		12508282	12508318	8421504	3	5,13,12	0,8,24	c	350029568100000644	7-37						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
680	chrII	12519122	12519324	3500425488	66		12519122	12519324	8421504	3	20,22,24	0,142,178	c,g	350042548800000010,350042548800000002,350042548800000002,350042548800000011	0-20,0-22,0-22,0-24						Modulating XRN2 - NOVARTIS FORSCHUNGSSTIFTUNG, ZWEIGNIEDERLASSUNG, FRIEDRICH MIESCHER INSITITUTE FOR BIOMEDICAL RESEARCH	www.sumobrain.com	0	0		
680	chrII	12519122	12519283	3500219292	39		12519122	12519283	8421504	2	20,19	0,142	c,g	350021929200000008,350021929200000002,350021929200000002	0-20,0-19,0-19						Active turnover modulates mature microRNA activity in Caenorhabditis elegans	rnajc.ucsf.edu	0	0		
680	chrII	12539571	12539604	3500415441	33		12539571	12539604	8421504	1	33	0	g	350041544100000216	39-72						Genomic tRNA Database: Caenorhabditis brenneri (WUGSC 4.0 Jan 2007)	gtrnadb.ucsc.edu	0	0		
680	chrII	12546266	12546298	3500307097	26		12546266	12546298	8421504	3	8,12,6	0,11,26	c	350030709700000062	11-37						Thermostable Reverse Transcriptases And Uses Thereof 	.freshpatents.com	0	0		
681	chrII	12587346	12587372	3500329235	24		12587346	12587372	8421504	2	10,14	0,12	g	350032923500001832	8-32						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
681	chrII	12636926	12673573	3500387859	47		12636926	12673573	8421504	4	7,5,14,21	0,8,15,36626	c	350038785900000862,350038785900000342	0-26,18-39						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
681	chrII	12660299	12686549	3500242967	46		12660299	12686549	8421504	5	12,7,7,6,14	0,15,26214,26225,26236	g	350024296700000603,350024296700000477	0-19,0-27						<Html><Title> Complet list of 1j2p hssp file Complet list of	cnptia.embrapa.br	0	0		
681	chrII	12693272	12693295	3500155916	23		12693272	12693295	8421504	1	23	0	g	350015591600000273	10-38						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
681	chrII	12696361	12697027	3500197241	23		12696361	12697027	8421504	4	12,3,3,5	0,14,656,661	c	350019724100000402	3-26						Pyrrolnitrin biosynthesis genes and uses thereof	Ligon	1998	0		
682	chrII	12728684	12728753	3500415441	69		12728684	12728753	8421504	1	69	0	c,g	350041544100000088,350041544100000106,350041544100000096,350041544100000097,350041544100000086,350041544100000085,350041544100000090	3-72,3-68,3-66,3-62,6-61,3-55,3-55						Genomic tRNA Database: Caenorhabditis brenneri (WUGSC 4.0 Jan 2007)	gtrnadb.ucsc.edu	0	0		
682	chrII	12770144	12770169	3500311536	23		12770144	12770169	8421504	2	8,15	0,10	g	350031153600000143	18-41						<Html><Title> Complet list of 1a5y hssp file Complet list of	cnptia.embrapa.br	0	0		
682	chrII	12785156	12785182	3500460467	23		12785156	12785182	8421504	2	7,16	0,10	g	350046046700000303	15-38						 Neutrophil Inhibitors 	www.docstoc.com	0	0		
682	chrII	12785156	12785182	3500231688	23		12785156	12785182	8421504	2	7,16	0,10	g	350023168800000307	15-38						Method of detecting neutophil inhibitory factor mimics	Moyle	1993	0		
682	chrII	12785156	12785182	3500180791	23		12785156	12785182	8421504	2	7,16	0,10	g	350018079100000277	15-38						Modified hookworm neutrophil inhibitors	Moyle	1995	0		
682	chrII	12806838	12810724	3500281047	942		12806838	12810724	8421504	6	212,121,116,215,146,132	0,834,1066,1499,2779,3754	p	350028104700015007,350028104700015014,350028104700015022,350028104700015030,350028104700015039,350028104700015047,350028104700015055	0-99,0-177,0-150,0-150,0-135,0-138,0-93						Untersuchungen zur Polyaminbiosynthese bei Diatomeen	uni-regensburg.de	0	0		
682	chrII	12809214	12809241	3500391876	23		12809214	12809241	8421504	3	13,5,5	0,14,22	g	350039187600000019	5-30						Method for identifying target epitopes of the T cell mediated immune response and for assaying epitope-specific T cells	Deml	2002	0		
682	chrII	12829370	12829397	3500144391	24		12829370	12829397	8421504	3	11,5,8	0,13,19	g	350014439100001024	11-36						SPIDER SILK DRAGLINE POLYNUCLEOTIDES, POLYPEPTIDES AND METHODS OF USE THEREOF - Patent application	www.faqs.org	0	0		
682	chrII	12832381	12832583	3500395143	40		12832381	12832583	8421504	2	20,20	0,182	c,g	350039514300000000,350039514300000000,350039514300000001,350039514300000001	0-20,0-20,0-20,0-20		19556237	10.1074/jbc.M109.026609		The Journal of Biological Chemistry	Cadmium Induces Retinoic Acid Signaling by Regulating Retinoic Acid Metabolic Gene Expression	Yuxia	2009	0		
683	chrII	12866669	12866696	3500413512	24		12866669	12866696	8421504	3	7,4,13	0,9,14	g	350041351200000035	6-30						RT-PCR Primers	www.docstoc.com	0	0		
683	chrII	12918749	12918793	3500294355	44		12918749	12918793	8421504	1	44	0	g	350029435500000015	0-44		21156961	10.1261/rna.2447111	1355-8382	RNA	Identification of transcription start sites of trans-spliced genes: Uncovering unusual operon arrangements	Morton	2011	5		
683	chrII	12923175	12923199	3500115360	23		12923175	12923199	8421504	2	13,10	0,14	g	350011536000000001	9-32						FUNDACIAN PRESIDENTE 	ddd.uab.cat	0	0		
683	chrII	12923175	12923199	3500014221	23		12923175	12923199	8421504	2	13,10	0,14	g	350001422100000001	9-32						Genes Implicados en el desarrollo de la semilla	ddd.uab.cat	0	0		
85	chrII	12953615	12982912	3500245494	44		12953615	12982912	8421504	3	17,4,23	0,18,29274	c,g	350024549400000341,350024549400000059	4-25,10-33						<Html><Title> Complet list of 2x2w hssp file Complet list of	cnptia.embrapa.br	0	0		
683	chrII	12953615	12953645	3500158624	26		12953615	12953645	8421504	2	17,9	0,21	c	350015862400000296	0-26						<Html><Title> Complet list of 1asy hssp file Complet list of	cnptia.embrapa.br	0	0		
684	chrII	12981339	12981364	3500227264	23		12981339	12981364	8421504	2	17,6	0,19	g	350022726400000179	0-24						ORFeome-based arrays in eukaryotic expression vectors - a new approach to screen for the function of viral proteins (LANA-1 meets the mediator)	b.uni-muenchen.de	0	0		
684	chrII	12988246	12992128	3500332115	67		12988246	12992128	8421504	4	21,21,7,18	0,3718,3805,3864	c,g	350033211500000001,350033211500000001,350033211500000002,350033211500000002,350033211500000000	0-21,0-21,0-21,0-21,0-25						生物化学-诺贝尔获奖论文-fire1 - 豆丁网	www.docin.com	0	0		
684	chrII	12994403	12994430	3500393909	26		12994403	12994430	8421504	2	19,7	0,20	c	350039390900000427	4-38						rec_num ORF_name deletion_alias gene_names UPTAG_sequence	ence.stanford.edu	0	0		
684	chrII	12994403	12994430	3500216944	26		12994403	12994430	8421504	2	19,7	0,20	c,g	350021694400000427,350021694400000427	4-38,4-38						rec_num ORF_name deletion_alias gene_names UPTAG_sequence	ence.stanford.edu	0	0		
684	chrII	12995652	12995675	3500182542	23		12995652	12995675	8421504	1	23	0	c,g	350018254200000079,350018254200000087	0-20,0-21						Cyst Nematode Resistant Transgenic Plants	Baum	2009	0		
684	chrII	12995652	12995675	3500099126	23		12995652	12995675	8421504	1	23	0	c,g	350009912600000080,350009912600000088	0-20,0-21						Cyst nematode resistant transgenic plants	Baum	2008	0		
684	chrII	12995652	12995675	3500081217	23		12995652	12995675	8421504	1	23	0	c,g	350008121700000079,350008121700000206,350008121700000087	0-20,7-29,0-21						Cyst Nematode Resistant Transgenic Plants - Patent application	www.faqs.org	0	0		
684	chrII	13014261	13030807	3500015653	201		13014261	13030807	8421504	9	28,23,23,20,2,24,35,23,23	0,8938,9152,10881,11119,11151,11910,16424,16523	c,g	350001565300000010,350001565300000002,350001565300000003,350001565300000004,350001565300000008,350001565300000008,350001565300000005,350001565300000005,350001565300000001,350001565300000000,350001565300000009,350001565300000007	0-28,0-23,0-23,0-22,0-24,0-24,0-24,0-24,0-23,0-23,0-23,0-23		17050621	10.1242/dev.02648	0950-1991	Development	The Caenorhabditis elegans P21-activated kinases are differentially required for UNC-6/netrin-mediated commissural motor axon guidance	Lucanic	2006	7		
684	chrII	13014368	13025770	3500460725	2532		13014368	13025770	8421504	16	90,160,98,113,157,114,533,144,131,132,206,162,203,78,125,86	0,100,928,1666,2831,3031,4010,5310,5965,8519,9213,9469,10600,11012,11139,11316	p,c,g	350046072500000037,350046072500000038,350046072500000022,350046072500000005,350046072500000027,350046072500000003,350046072500000013,350046072500000018,350046072500000017,350046072500000016,350046072500000015,350046072500000014,350046072500000008,350046072500000008,350046072500000009,350046072500000007,350046072500000012,350046072500000011,350046072500000010,350046072500000039,350046072500000030,350046072500000030,350046072500015089,350046072500000035,350046072500000035,350046072500000034,350046072500000034	0-90,0-160,11-33,11-33,83-885,11-33,130-1414,132-2080,132-1939,132-2080,147-2151,132-2074,0-1941,0-1941,0-1941,0-1281,0-1947,0-1806,0-1947,0-750,88-876,88-876,0-45,0-50,0-50,0-300,0-300						NOVEL C. ELEGANS P21-ACTIVATED KINASE (PAK) GENE AND ASSOCIATED LOSS-OF-FUNCTION PHENOTYPES THAT FACILITATE SCREENING FOR SMALL MOLECULE MODULATORS OF PAK ACTIVITY IN THE NEMATODE, CAENORHABDITIS ELEGANS - Patent application	www.faqs.org	0	0		
684	chrII	13015296	13025708	3500254070	69		13015296	13025708	8421504	3	22,23,24	0,5143,10388	c,g	350025407000000003,350025407000000005,350025407000000002,350025407000000006	11-33,11-33,17-40,17-41						Novel C. Elegans P21-activated Kinase (pak) Gene And Associated Loss-of-function Phenotypes That Facilitate Screening For Small Molecule Modulators Of Pak Activity In The Nematode, Caenorhabditis Elegans 	.freshpatents.com	0	0		
684	chrII	13017464	13026194	3500457479	114		13017464	13026194	8421504	6	23,23,23,20,2,23	0,2243,5949,7678,7916,8707	c,g	350045747900000015,350045747900000015,350045747900000014,350045747900000012,350045747900000013,350045747900000011	0-23,0-23,0-23,0-23,0-22,0-23		23390595	10.1534/g3.112.004416		G3: Genes|Genomes|Genetics	Redundant Canonical and Noncanonical Caenorhabditis elegans p21-Activated Kinase Signaling Governs Distal Tip Cell Migrations	Eldon	2013	0		
684	chrII	13023645	13023672	3500391832	24		13023645	13023672	8421504	2	7,17	0,10	c	350039183200000031	12-36						RNAcode: Robust Discrimination of Coding and Noncoding Regions in Comparative Sequence Data	www.santafe.edu	0	0		
685	chrII	13117808	13117910	3500345126	63		13117808	13117910	8421504	2	30,33	0,69	p	350034512600015033	141-243						Nucleotide Sequence and Phylogeny ofthe Tetracycline Resistance Determinant Staphylococcus	aac.asm.org	0	0		
685	chrII	13165567	13170642	3500105042	51		13165567	13170642	8421504	2	23,28	0,5047	g	350010504200000001,350010504200000000	0-23,0-28						20111108_moe-3_10_L1	gs.washington.edu	0	0		
685	chrII	13198017	13199351	3500192921	462		13198017	13199351	8421504	6	114,84,60,54,54,96	0,147,369,468,1154,1238	p	350019292100015011,350019292100015024,350019292100015043,350019292100015049,350019292100015057	0-114,0-84,0-60,0-108,0-96						Galectin expression is induced in cirrhotic liver and hepatocellular carcinoma	Hsu	2001	0		
685	chrII	13237347	13237370	3500331042	23		13237347	13237370	8421504	1	23	0	g	350033104200000008	0-23						ISSN 1993 - 8233	demicjournals.org	0	0		
686	chrII	13246150	13246346	3500331578	23		13246150	13246346	8421504	3	6,1,16	0,178,180	c	350033157800000003	0-23						Improving our insight in the genetic origin of congenital heart 	www.docstoc.com	0	0		
686	chrII	13290821	13290846	3500157259	23		13290821	13290846	8421504	3	8,11,4	0,9,21	g	350015725900000027	5-31						A survey of all 11 ABC transporters in fission yeast: two novel ABC transporters are required for red pigment accumulation in a Schizosaccharomyces pombe adenine biosynthetic mutant	c.sgmjournals.org	0	0		
686	chrII	13296709	13296735	3500117342	23		13296709	13296735	8421504	2	12,11	0,15	g	350011734200000209	5-28						<HTML> <HEAD> <META HTTP-EQUIV="Content-Type" CONTENT="text/html;charset=Shift_JIS"> <TITLE>NSD1</TI	ia.med.keio.ac.jp	0	0		
686	chrII	13311535	13320839	3500174708	2436		13311535	13320839	8421504	7	144,67,184,1038,671,201,131	0,935,1054,2248,4885,7413,9173	p	350017470800015000,350017470800015069,350017470800015068,350017470800015066,350017470800015056,350017470800015055,350017470800015050,350017470800015039,350017470800015038,350017470800015037,350017470800015024,350017470800015023,350017470800015017,350017470800015016,350017470800015003,350017470800015002,350017470800015001	0-2436,0-48,0-84,0-78,0-69,0-306,0-96,0-81,0-66,0-120,0-309,0-48,0-135,0-150,0-135,0-192,0-51						C. elegans MAC-1, an essential member of the AAA family of ATPases, can bind CED-4 and prevent cell death	ev.biologists.org	0	0		
686	chrII	13320797	13338090	3500403182	146		13320797	13338090	8421504	6	29,22,22,21,30,22	0,4558,4677,9637,14171,17271	c,g	350040318200000002,350040318200000001,350040318200000001,350040318200000003,350040318200000003,350040318200000006,350040318200000000,350040318200000004	0-29,0-22,0-22,0-22,0-22,15-36,0-30,0-22						Regulation of C elegans presynaptic differentiation and neurite branching via a novel signaling pathway initiated by	ev.biologists.org	0	0		
686	chrII	13326928	13326954	3500396083	24		13326928	13326954	8421504	2	10,14	0,12	g	350039608300000017	17-41						Exxon Valdez Oil Spill Restoration Project Final Report	vostc.state.ak.us	0	0		
686	chrII	13361004	13361029	3500335263	23		13361004	13361029	8421504	2	10,13	0,12	g	350033526300000225	9-34						Parasitic nematode transglutaminase proteins, nucleic acid molecules, and uses thereof	Chandrashekar	1999	0		
686	chrII	13361004	13361029	3500008109	23		13361004	13361029	8421504	2	10,13	0,12	g	350000810900000054	21-46						Parasitic nematode transglutaminase proteins and uses thereof	Chandrashekar	1997	0		
687	chrII	13374806	13374830	3500362074	23		13374806	13374830	8421504	2	19,4	0,20	c	350036207400000115	0-23						<HTML> <TITLE>BLAST Search Results  BLAST Search Results  BLAST Search Results  BLAST Search Results    pykA PAGE   Complet list of 3d9c hssp file Complet list of	cnptia.embrapa.br	0	0		
687	chrII	13495427	13495534	3500027547	52		13495427	13495534	8421504	3	18,6,28	0,72,79	c	350002754700000013,350002754700000006	0-24,0-28			10.1371/journal.pgen.0010017	1553-7404	PLOS Genetics	PLOS Genetics: New Genes Tied to Endocrine, Metabolic, and Dietary Regulation of Lifespan from a Caenorhabditis elegans Genomic RNAi Screen	Hansen	2005	0		
687	chrII	13495427	13495534	3500010528	52		13495427	13495534	8421504	3	18,6,28	0,72,79	c	350001052800000013,350001052800000006	0-24,0-28			10.1371/journal.pgen.0010017		PLoS Genetics	New Genes Tied to Endocrine, Metabolic, and Dietary Regulation of Lifespan from a Caenorhabditis elegans Genomic RNAi Screen	Malene	July	0		
688	chrII	13529429	13531125	3500349140	41		13529429	13531125	8421504	2	21,20	0,1676	c,g	350034914000000001,350034914000000001,350034914000000000	0-21,0-21,0-20		21148288	10.1091/mbc.E10-09-0756	1059-1524	Molecular Biology of the Cell	Three sorting nexins drive the degradation of apoptotic cells in response to PtdIns(3)P signaling	Lu	2011	5		
688	chrII	13546952	13546979	3500216700	24		13546952	13546979	8421504	2	6,18	0,9	g	350021670000000157	0-25						#QUERY: #Match: All #Sticky ends: No sticky ends #PDB_ID ENTRY_ID PUBMED_ID RESOLUTION SPECIES MULTI	melolab.org	0	0		
688	chrII	13577798	13577823	3500223858	25		13577798	13577823	8421504	1	25	0	c	350022385800000810	15-40							biomedcentral.com	0	0		
688	chrII	13601385	13608716	3500437352	158		13601385	13608716	8421504	5	53,21,21,43,20	0,1610,2590,3579,7311	c,g	350043735200000010,350043735200000010,350043735200000005,350043735200000005,350043735200000004,350043735200000011,350043735200000011,350043735200000012,350043735200000012,350043735200000007,350043735200000007,350043735200000013,350043735200000006,350043735200000009,350043735200000001,350043735200000001	11-31,11-31,11-31,11-31,0-50,9-30,9-30,9-30,9-30,9-30,9-30,7-32,8-32,20-40,0-20,0-20		23505386	10.1371/journal.pgen.1003341	1553-7404	PLOS Genetics	PLOS Genetics: Both the Caspase CSP-1 and a Caspase-Independent Pathway Promote Programmed Cell Death in Parallel to the Canonical Pathway for Apoptosis in Caenorhabditis elegans	Denning	2013	0		
688	chrII	13601385	13608716	3500136583	140		13601385	13608716	8421504	5	53,21,21,25,20	0,1610,2590,3579,7311	c,g	350013658300000010,350013658300000010,350013658300000005,350013658300000005,350013658300000004,350013658300000011,350013658300000011,350013658300000012,350013658300000012,350013658300000007,350013658300000007,350013658300000013,350013658300000006,350013658300000001,350013658300000001	11-31,11-31,11-31,11-31,0-50,9-30,9-30,9-30,9-30,9-30,9-30,7-32,8-32,0-20,0-20		23505386	10.1371/journal.pgen.1003341		PLoS Genetics	Both the Caspase CSP-1 and a Caspase-Independent Pathway Promote Programmed Cell Death in Parallel to the Canonical Pathway for Apoptosis in Caenorhabditis elegans	DaniP.	2013	0		
688	chrII	13618286	13618310	3500394783	24		13618286	13618310	8421504	1	24	0	g	350039478300000154	0-24						<Html><Title> Complet list of 1dj9 hssp file Complet list of	cnptia.embrapa.br	0	0		
689	chrII	13653542	13666957	3500460406	39		13653542	13666957	8421504	5	15,4,4,12,4	0,1413,13393,13398,13411	c,g	350046040600000549,350046040600000435	4-23,15-35						Transgenic maize seed and method for controlling insect pests	Koziel	2001	0		
689	chrII	13653542	13666957	3500436940	39		13653542	13666957	8421504	5	15,4,4,12,4	0,1413,13393,13398,13411	c,g	350043694000000528,350043694000000415	4-23,15-35						Synthetic DNA sequence having enhanced activity in maize	Koziel	1995	0		
689	chrII	13653542	13666957	3500203326	39		13653542	13666957	8421504	5	15,4,4,12,4	0,1413,13393,13398,13411	c,g	350020332600000551,350020332600000437	4-23,15-35						Synthetic DNA sequence having enhanced insecticidal activity in maize	Koziel	1995	0		
689	chrII	13653542	13666957	3500111307	39		13653542	13666957	8421504	5	15,4,4,12,4	0,1413,13393,13398,13411	c,g	350011130700000540,350011130700000426	4-23,15-35					Patent	Method for producing a plant-optimized nucleic acid coding sequence (Patent US:6121014)	Desai	2000	0		
689	chrII	13659712	13659737	3500091264	23		13659712	13659737	8421504	2	10,13	0,12	g	350009126400000014	17-46						Increased Proliferation and Analysis of Differential Gene Expression in Human Wharton's Jelly-derived Mesenchymal Stromal Cells under Hypoxia	www.ijbs.com	0	0		
689	chrII	13708456	13709626	3500275631	40		13708456	13709626	8421504	2	20,20	0,1150	c,g	350027563100000003,350027563100000003,350027563100000004	0-20,0-20,0-20		17942636	10.1152/ajpcell.00303.2007		American Journal of Physiology - Cell Physiolog	Intestinal Ca2+ wave dynamics in freely moving C. elegans coordinate execution of a rhythmic motor program	Nehrke	2008	0		
689	chrII	13708456	13709626	3500143472	40		13708456	13709626	8421504	2	20,20	0,1150	c,g	350014347200000003,350014347200000003,350014347200000004	0-20,0-20,0-20		17942636	10.1152/ajpcell.00303.2007		American Journal of Physiology - Cell Physiolog	Intestinal Ca2+ wave dynamics in freely moving C. elegans coordinate execution of a rhythmic motor program	Nehrke	2008	0		
689	chrII	13708456	13709626	3500030341	40		13708456	13709626	8421504	2	20,20	0,1150	c,g	350003034100000003,350003034100000003,350003034100000004	0-20,0-20,0-20						Intestinal Ca2+ wave dynamics in freely moving C. elegans coordinate execution of a rhythmic motor program	g.library.pcc.edu	0	0		
689	chrII	13708456	13709626	3500000207	40		13708456	13709626	8421504	2	20,20	0,1150	c,g	350000020700000003,350000020700000003,350000020700000004	0-20,0-20,0-20		17942636	10.1152/ajpcell.00303.2007		American Journal of Physiology - Cell Physiology	Intestinal Ca2+ wave dynamics in freely moving C. elegans coordinate execution of a rhythmic motor program	Nehrke	2008	0		
689	chrII	13709219	13709687	3500338672	84		13709219	13709687	8421504	2	47,37	0,431	p	350033867200015110,350033867200015173,350033867200015239,350033867200015059,350033867200015154,350033867200015017	0-48,0-48,0-48,0-48,0-48,0-48						KVLQT1--a long qt syndrome gene	www.devileye.net	0	0		
689	chrII	13709222	13709681	3500381625	75		13709222	13709681	8421504	2	44,31	0,428	p	350038162500015110,350038162500015171,350038162500015059,350038162500015153	0-45,0-45,0-45,0-45						KVLQT1—a long QT syndrome gene	Keating	2000	0		
689	chrII	13709222	13709681	3500205101	75		13709222	13709681	8421504	2	44,31	0,428	p	350020510100015109,350020510100015164,350020510100015059,350020510100015146	0-45,0-45,0-45,0-45						Mutations in the KCNE1 gene encoding human mink which cause arrhythmia susceptibility thereby establishing KCNE1 as an LQT gene	Keating	1999	0		
689	chrII	13709243	13709675	3500343942	48		13709243	13709675	8421504	2	23,25	0,407	p	350034394200015017	0-48						Polymorphisms associated with ion-channel disease - US Patent Application 20050089905 Description	ww.patentstorm.us	0	0		
689	chrII	13709246	13709675	3500106373	45		13709246	13709675	8421504	2	20,25	0,404	p	350010637300015113	0-45						Human KCNQ5 potassium channel, methods and compositions thereof - Patent application	www.faqs.org	0	0		
689	chrII	13709255	13709687	3500329173	48		13709255	13709687	8421504	2	11,37	0,395	p	350032917300015016	0-48						Mutations in the KCNE1 gene encoding human minK which cause arrhythmia susceptibility thereby establishing KCNE1 as an LQT gene - US Patent 7247436 Description	ww.patentstorm.us	0	0		
689	chrII	13760772	13760963	3500136159	40		13760772	13760963	8421504	2	20,20	0,171	c,g	350013615900000022,350013615900000022,350013615900000023	0-20,0-20,0-20						Supporting Information	www.pnas.org	0	0		
690	chrII	13777041	13777067	3500019475	23		13777041	13777067	8421504	2	8,15	0,11	c	350001947500000003	13-36						Sagar Supp Tables - ResearchGate	.researchgate.net	0	0		
690	chrII	13819489	13824790	3500382955	56		13819489	13824790	8421504	2	36,20	0,5281	c,g	350038295500000003,350038295500000012,350038295500000009,350038295500000006,350038295500000035	0-36,0-34,0-32,0-33,0-20						BMC Molecular Biology BioMed Central	biomedcentral.com	0	0		
690	chrII	13828357	13828381	3500004484	23		13828357	13828381	8421504	2	12,11	0,13	c	350000448400001826	13-39						#NEXUS [MacClade 3.01 registered to Brent D. Mishler, Duke University] [**The final matrix GP-COMB	jeps.berkeley.edu	0	0		
690	chrII	13835060	13835084	3500323209	23		13835060	13835084	8421504	2	11,12	0,12	g	350032320900000469	0-29						2007 Characterization of arsenic resistant bacteria and a novel gene cluster in 'Bacillus' sp. CDB3	ro.uow.edu.au	0	0		
690	chrII	13835547	13835572	3500168684	24		13835547	13835572	8421504	2	6,18	0,7	c	350016868400000661	6-30						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
690	chrII	13836369	13852715	3500103185	40		13836369	13852715	8421504	2	21,19	0,16327	c,g	350010318500000008,350010318500000008,350010318500000007	0-21,0-21,2-21		10022876		0270-7306	Molecular and Cellular Biology	Alterations in the Conserved SL1trans-Spliced Leader of Caenorhabditis elegansDemonstrate Flexibility in Length and Sequence Requirements In Vivo	Ferguson	1999	6		
690	chrII	13879729	13879756	3500199533	24		13879729	13879756	8421504	2	5,19	0,8	c	350019953300000006,350019953300000007,350019953300000015	18-42,0-24,6-28						Targeted vaccine delivery systems	Zauderer	2001	0		
691	chrII	13908850	13915045	3500063443	39		13908850	13915045	8421504	2	19,20	0,6175	c,g	350006344300000000,350006344300000000,350006344300000001	20-39,20-39,20-40				0021-9533	Journal of Cell Science	Rho-binding kinase (LET-502) and myosin phosphatase (MEL-11) regulate cytokinesis in the early Caenorhabditis elegans embryo	Piekny	2002	6		
691	chrII	13930235	13930263	3500347663	23		13930235	13930263	8421504	3	12,6,5	0,15,23	c,g	350034766300000026,350034766300000026	0-24,0-24						Preparing Your Samples - Functional Genomics Center - University of Rochester Medical Center	rmc.rochester.edu	0	0		
691	chrII	13960882	13960919	3500009376	31		13960882	13960919	8421504	2	24,7	0,30	c	350000937600000231	16-47						 Galaxy | Dataset | FASTQ Groomer on data 2	popgenie.org:8080	0	0		
691	chrII	13982109	13982139	3500144055	24		13982109	13982139	8421504	3	7,12,5	0,11,25	c	350014405500000408	12-36						GENERATION AND REPRODUCTION OF DNA SEQUENCES AND ANALYSIS OF POLYMORPHISMS AND MUTATIONS BY USING ERROR-CORRECTING CODES - Patent application	www.faqs.org	0	0		
691	chrII	14018280	14018365	3500288532	85		14018280	14018365	8421504	1	85	0	c,g	350028853200000012,350028853200000012	0-85,0-85						ScienceDirect.com - Genomics - A combined computational and experimental analysis of two families of snoRNA genes from Caenorhabditis elegans, revealing the expression and evolution pattern of snoRNAs in nematodes	sciencedirect.com	0	0		
692	chrII	14035331	14036184	3500440408	44		14035331	14036184	8421504	2	25,19	0,834	c,g	350044040800000002,350044040800000002,350044040800000003,350044040800000003	0-25,0-25,0-19,0-19		20843862	10.1242/dev.048850	0950-1991	Development	The C. elegans developmental timing protein LIN-42 regulates diapause in response to environmental cues	Tennessen	2010	7		
692	chrII	14040016	14040041	3500354585	24		14040016	14040041	8421504	2	18,6	0,19	g	350035458500000002	7-31						Presentazione di PowerPoint	ampusnet.unito.it	0	0		
692	chrII	14040016	14040041	3500107726	24		14040016	14040041	8421504	2	18,6	0,19	g	350010772600000002	7-31						 <HTML><head> <!-- <script type="text/javascript" src="http://ajax.googleapis.com/ajax/lib	t-it.abctribe.com	0	0		
692	chrII	14063379	14064483	3500314113	47		14063379	14064483	8421504	2	24,23	0,1081	c,g	350031411300000001,350031411300000000,350031411300000000	9-33,0-23,0-23		22171324	10.1091/mbc.E11-06-0505	1059-1524	Molecular Biology of the Cell	Ce-emerin and LEM-2: essential roles in Caenorhabditis elegans development, muscle function, and mitosis	Barkan	2012	5		
692	chrII	14096041	14096067	3500135082	24		14096041	14096067	8421504	3	15,4,5	0,16,21	g	350013508200000002	9-33						Poly(ADP-ribose) polymerase-gene - US Patent 7754459 Description	ww.patentstorm.us	0	0		
86	chrII	14155642	14158170	3500355728	46		14155642	14158170	8421504	2	23,23	0,2505	c,g	350035572800000007,350035572800000008,350035572800000008	0-23,0-23,0-23						Les courts ARN chez C. elegans : spécificité et fonction des protéines Argonautes	de.bibl.ulaval.ca	0	0		
86	chrII	14155711	14165843	3500425488	89		14155711	14165843	8421504	4	23,20,20,26	0,9554,9743,10106	c,g	350042548800000018,350042548800000016,350042548800000016,350042548800000017,350042548800000017,350042548800000019	10-33,0-20,0-20,0-20,0-20,12-38						Modulating XRN2 - NOVARTIS FORSCHUNGSSTIFTUNG, ZWEIGNIEDERLASSUNG, FRIEDRICH MIESCHER INSITITUTE FOR BIOMEDICAL RESEARCH	www.sumobrain.com	0	0		
86	chrII	14155711	14165843	3500219292	89		14155711	14165843	8421504	4	23,20,20,26	0,9554,9743,10106	c,g	350021929200000016,350021929200000014,350021929200000014,350021929200000015,350021929200000015,350021929200000017	10-33,0-20,0-20,0-20,0-20,12-38						Active turnover modulates mature microRNA activity in Caenorhabditis elegans	rnajc.ucsf.edu	0	0		
693	chrII	14164631	14164658	3500355183	23		14164631	14164658	8421504	2	6,17	0,10	g	350035518300000181	3-26						<HTML> <TITLE>BLAST Search Results  BLAST Search Results     Complet list of 1ejy hssp file Complet list of	cnptia.embrapa.br	0	0		
693	chrII	14256341	14270474	3500321117	38		14256341	14270474	8421504	3	12,7,19	0,15,14114	c,g	350032111700000189,350032111700000520	9-28,7-26						<Html><Title> Complet list of 1pa1 hssp file Complet list of	cnptia.embrapa.br	0	0		
693	chrII	14256846	14257816	3500006669	23		14256846	14257816	8421504	2	17,6	0,964	c	350000666900000107	9-32						<Html><Title> Complet list of 1vly hssp file Complet list of	cnptia.embrapa.br	0	0		
694	chrII	14299306	14310047	3500413711	7458		14299306	14310047	8421504	54	556,53,28,226,74,47,30,20,223,395,24,12,8,29,215,57,11,36,3,10,13,97,40,389,152,120,211,643,24,236,36,20,1461,127,16,6,5,262,73,191,89,206,5,12,23,16,36,5,545,9,48,96,144,45	0,557,611,640,867,944,992,1023,1045,1269,1667,1692,1706,1716,1747,1972,2030,2042,2079,2083,2094,2117,2215,2256,2651,2812,4238,4450,5095,5121,5358,5395,5417,7333,7462,7479,7487,7493,7756,7834,8042,8132,8339,8345,8358,8382,8399,8442,8448,10006,10207,10357,10504,10696	p,c,g	350041371100000017,350041371100015022,350041371100000016,350041371100000015,350041371100000005,350041371100000001,350041371100015005,350041371100015004,350041371100015003,350041371100000014,350041371100015002,350041371100015001,350041371100000013,350041371100000008,350041371100000009,350041371100000011,350041371100000010,350041371100015031,350041371100015030,350041371100015028,350041371100015026,350041371100015025,350041371100015024,350041371100015023,350041371100015021,350041371100015016,350041371100015014,350041371100015013,350041371100015011,350041371100015010,350041371100015009,350041371100015007	0-1960,0-48,0-130,0-310,0-22,0-22,0-48,0-48,0-48,0-360,0-48,0-48,0-120,2-1493,5-2130,0-680,2-910,0-45,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,3-48						Method for increasing life-span	Chalfie	1997	0		
694	chrII	14299666	14299768	3500350443	99		14299666	14299768	8421504	3	45,4,50	0,46,52	c,g	350035044300000166,350035044300000167,350035044300000167	0-49,0-50,0-50						OLIGONUCLEOTIDE ANALOGUES FOR DETECTING AND ANALYZING NUCLEIC ACIDS - Exiqon, A/s	www.sumobrain.com	0	0		
694	chrII	14305749	14310276	3500213973	53		14305749	14310276	8421504	2	25,28	0,4499	c,g	350021397300000001,350021397300000003,350021397300000003	1-29,0-29,0-29						Assay techniques based on growth stage dependent expression in c. elegans	Bogaert	2001	0		
694	chrII	14305749	14305774	3500027727	25		14305749	14305774	8421504	1	25	0	c,g	350002772700000001,350002772700000001	1-29,1-29						Compound screens relating to insulin deficiency or insulin resistance	Feichtinger	2001	0		
694	chrII	14305973	14305997	3500129453	23		14305973	14305997	8421504	2	13,10	0,14	c	350012945300000397	0-23					Patent	Perhydrolase (Patent EP:1689859)	Amin	2011	0		
694	chrII	14319138	14319715	3500214250	40		14319138	14319715	8421504	2	20,20	0,557	c,g	350021425000000006,350021425000000007,350021425000000007	0-20,0-20,0-20						Frequent Germline Mutations and Somatic Repeat Instability in DNA Mismatch-Repair-Deficient Caenorhabditis elegans	www.genetics.org	0	0		
10	chrII	14339262	15106099	3500400920	711		14339262	15106099	8421504	7	311,11,6,58,33,7,285	0,315,330,338,397,530758,766552	g	350040092000000000	236-949						Spec Review - BioDAS	www.biodas.org	0	0		
694	chrII	14352099	14352123	3500070088	23		14352099	14352123	8421504	2	19,4	0,20	c	350007008800000693	17-40						RNAI INHIBITION OF INFLUENZA VIRUS REPLICATION	Fougerolles	2006	0		
694	chrII	14352099	14352123	3500019915	23		14352099	14352123	8421504	2	19,4	0,20	c	350001991500000693	17-40						Rnai Inhibition Of Influenza Virus Replication 	.freshpatents.com	0	0		
694	chrII	14384092	14385068	3500096380	48		14384092	14385068	8421504	2	24,24	0,952	c,g	350009638000000002,350009638000000002,350009638000000003,350009638000000003	0-24,0-24,0-24,0-24		16322520	10.1534/genetics.105.048751	0016-6731	Genetics	gon-14 Functions With Class B and Class C Synthetic Multivulva Genes to Control Larval Growth in Caenorhabditis elegans	Chesney	2006	4		
694	chrII	14384092	14385068	3500057107	48		14384092	14385068	8421504	2	24,24	0,952	c,g	350005710700000002,350005710700000002,350005710700000003,350005710700000003	0-24,0-24,0-24,0-24						gon-14 Functions With Class B and Class C Synthetic Multivulva Genes to Control Larval Growth in Caenorhabditis elegans--《遗传学杂志》--医学期刊频道--首席医&#	journal.9med.net	0	0		
694	chrII	14390646	14407662	3500154339	300		14390646	14407662	8421504	6	50,50,50,50,50,50	0,9362,10103,13934,14825,16966	c,g	350015433900000002,350015433900000002,350015433900000000,350015433900000000,350015433900000003,350015433900000134,350015433900000001,350015433900000001,350015433900000033	50-100,50-100,50-100,50-100,0-50,50-100,50-100,50-100,0-50							biomedcentral.com	0	0		
694	chrII	14399023	14399049	3500127454	24		14399023	14399049	8421504	2	9,15	0,11	c	350012745400000002	0-24						Use Of A Gene Encoding A Histidine Protein Kinase To Create Drought Resistant Plants 	.freshpatents.com	0	0		
694	chrII	14409439	14409492	3500415441	53		14409439	14409492	8421504	1	53	0	c	350041544100000625,350041544100000624,350041544100000626,350041544100000621,350041544100000620,350041544100000623,350041544100000612,350041544100000613,350041544100000614,350041544100000615,350041544100000617,350041544100000618	70-123,67-120,67-120,67-120,68-121,67-120,69-122,68-121,66-119,71-124,71-124,73-119						Genomic tRNA Database: Caenorhabditis brenneri (WUGSC 4.0 Jan 2007)	gtrnadb.ucsc.edu	0	0		
695	chrII	14423467	14423493	3500371239	23		14423467	14423493	8421504	2	15,8	0,18	g	350037123900000017	0-31		19906914	10.1128/JVI.01301-09	0022-538X	Journal of Virology	Wide-Scale Use of Notch Signaling Factor CSL/RBP-Jκ in RTA-Mediated Activation of Kaposi's Sarcoma-Associated Herpesvirus Lytic Genes	Persson	2010	5		
695	chrII	14423467	14423493	3500035349	23		14423467	14423493	8421504	2	15,8	0,18	g	350003534900000017	0-31		19906914	10.1128/JVI.01301-09		Journal of Virology	Wide-Scale Use of Notch Signaling Factor CSL/RBP-Jκ in RTA-Mediated Activation of Kaposi's Sarcoma-Associated Herpesvirus Lytic Genes 	Linda	2010	0		
695	chrII	14424271	14424309	3500121931	38		14424271	14424309	8421504	1	38	0	c	350012193100000033	0-38						Supporting Online Material for	mcb.berkeley.edu	0	0		
695	chrII	14476052	14476087	3500398557	28		14476052	14476087	8421504	3	7,15,6	0,11,29	c	350039855700001537	5-34						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
695	chrII	14476052	14476087	3500390993	28		14476052	14476087	8421504	3	7,15,6	0,11,29	c	350039099300001562	5-34						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
695	chrII	14490758	14490787	3500231920	25		14490758	14490787	8421504	2	10,15	0,14	g	350023192000000708	3-43						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
695	chrII	14528937	14528961	3500252796	23		14528937	14528961	8421504	2	14,9	0,15	g	350025279600000131	19-42						METHODS AND COMPOSITIONS FOR PREVENTION OR TREATMENT OF RSV INFECTION	Vaishnaw	2008	0		
695	chrII	14528937	14528961	3500147965	23		14528937	14528961	8421504	2	14,9	0,15	g	350014796500000131	19-42						Methods and compositions for prevention or treatment of RSV infection (патент US № 8410073)	www.freepatent.ru	0	0		
696	chrII	14550934	14552198	3500197656	45		14550934	14552198	8421504	2	7,38	0,1226	p	350019765600015233	0-45						Karakterisatie van neuromedine U-, tachykinine- en GnRH-verwante receptoren	w.scriptiebank.be	0	0		
696	chrII	14558606	14559932	3500199600	50		14558606	14559932	8421504	3	22,2,26	0,670,1300	c,g	350019960000000001,350019960000000000,350019960000000000	0-24,0-26,0-26						Improvements relating to double-stranded rna inhibition	Thierry	2001	0		
696	chrII	14558606	14559278	3500166839	24		14558606	14559278	8421504	2	22,2	0,670	c	350016683900000001	0-24						Improvements relating to double-stranded rna inhibition	Bogaert	2001	0		
696	chrII	14589484	14589511	3500162981	26		14589484	14589511	8421504	2	15,11	0,16	c	350016298100001232	12-39						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
696	chrII	14596650	14596782	3500334644	81		14596650	14596782	8421504	2	67,14	0,118	p	350033464400015022	0-81						Gill-specific transcriptional regulation of Na /K -ATPase -subunit in the euryhaline shore crab Pachygrapsus marmoratus: sequence variants and promoter structure	eb.biologists.org	0	0		
696	chrII	14606345	14608011	3500044932	106		14606345	14608011	8421504	4	20,39,25,22	0,791,1597,1644	c,g	350004493200000039,350004493200000015,350004493200000015,350004493200000017,350004493200000017,350004493200000018,350004493200000018,350004493200000042,350004493200000042,350004493200000040	0-20,0-19,0-19,0-21,0-21,0-20,0-20,12-32,12-32,0-22						Functional genomic analysis of the ADP-ribosylation factor family of GTPases: phylogeny among diverse eukaryotes and function in C. elegans	biology.uiowa.edu	0	0		
696	chrII	14658992	14659018	3500269432	24		14658992	14659018	8421504	2	14,10	0,16	c,g	350026943200000231,350026943200000231	11-35,11-35						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
696	chrII	14662270	14662294	3500252866	23		14662270	14662294	8421504	2	9,14	0,10	g	350025286600000076	24-47						 Maize PR 	www.docstoc.com	0	0		
696	chrII	14662270	14662294	3500032197	23		14662270	14662294	8421504	2	9,14	0,10	g	350003219700000076	24-47						Maize PR-1 gene promoters - US Patent 6429362 Description	ww.patentstorm.us	0	0		
697	chrII	14686640	14686668	3500343811	23		14686640	14686668	8421504	2	10,13	0,15	g	350034381100001103	25-48						1531 26.93 2.31 1.16 sequence_4 1 432 (149568) + Gypsy12-ZM_I LTR/Gypsy 	nomics.purdue.edu	0	0		
697	chrII	14698439	14729859	3500397262	44		14698439	14729859	8421504	4	18,6,14,6	0,21,31395,31414	g	350039726200000651,350039726200000471	6-30,11-31						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
697	chrII	14734455	14738136	3500063695	1383		14734455	14738136	8421504	34	93,1,44,42,1,41,45,13,29,45,45,42,45,15,27,45,48,45,30,12,45,42,42,45,12,33,93,45,39,16,29,141,48,45	0,96,744,791,839,883,930,978,1035,1070,1118,1166,1214,1262,1543,1576,1624,1720,1768,2650,2668,2716,2764,2862,2958,3028,3064,3160,3214,3256,3319,3351,3495,3636	c,g	350006369500000239,350006369500000239,350006369500000238,350006369500000237,350006369500000236,350006369500000235,350006369500000234,350006369500000234,350006369500000233,350006369500000232,350006369500000232,350006369500000231,350006369500000231,350006369500000230,350006369500000230,350006369500000229,350006369500000229,350006369500000228,350006369500000227,350006369500000226,350006369500000226,350006369500000224,350006369500000223,350006369500000222,350006369500000221,350006369500000221,350006369500000220,350006369500000220,350006369500000219,350006369500000219,350006369500000217,350006369500000216,350006369500000215,350006369500000215,350006369500000214,350006369500000214,350006369500000213,350006369500000213,350006369500000212,350006369500000211,350006369500000211,350006369500000210,350006369500000210,350006369500000209,350006369500000209,350006369500000208,350006369500000208,350006369500000206	0-48,0-48,0-45,0-45,0-42,0-42,0-45,0-45,0-42,0-45,0-45,0-45,0-45,0-42,0-42,0-45,0-45,0-42,0-45,0-48,0-48,0-45,0-42,0-45,0-42,0-42,0-42,0-42,0-45,0-45,0-45,0-48,0-45,0-45,0-45,0-45,0-39,0-39,0-45,0-48,0-48,0-48,0-48,0-45,0-45,0-48,0-48,0-45						G protein-coupled receptor-like receptors and modulators thereof - US Patent 7208591 Description	ww.patentstorm.us	0	0		
697	chrII	14779287	14779312	3500392358	23		14779287	14779312	8421504	2	7,16	0,9	g	350039235800000153	23-46						UNIVERSITÉ D’EVRY VAL D’ESSONNE	hives-ouvertes.fr	0	0		
697	chrII	14779684	14779711	3500331756	24		14779684	14779711	8421504	2	18,6	0,21	g	350033175600000101	18-42						<Html><Title> Complet list of 2v23 hssp file Complet list of	cnptia.embrapa.br	0	0		
697	chrII	14779685	14779711	3500331014	23		14779685	14779711	8421504	2	17,6	0,20	g	350033101400000168	24-47						<Html><Title> Complet list of 1wsr hssp file Complet list of	cnptia.embrapa.br	0	0		
697	chrII	14785317	14785508	3500107727	23		14785317	14785508	8421504	3	5,2,16	0,169,175	c	350010772700000284,350010772700000283	0-21,0-21						COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF FACTOR VII GENES - Patent application	www.faqs.org	0	0		
697	chrII	14797796	14797829	3500245494	26		14797796	14797829	8421504	3	6,15,5	0,11,28	g	350024549400000218	12-38						<Html><Title> Complet list of 2x2w hssp file Complet list of	cnptia.embrapa.br	0	0		
698	chrII	14822248	14865494	3500241007	43		14822248	14865494	8421504	4	6,15,8,14	0,8,43223,43232	g	350024100700000882,350024100700002555	24-45,6-42						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
698	chrII	14867765	14867813	3500293541	48		14867765	14867813	8421504	1	48	0	p	350029354100015001	0-48						Glutathione Peroxidase cDNA Cloning and Expression in Soybean Roots under Heterodera glycines Infection	www.ccsenet.org	0	0		
698	chrII	14880089	14880960	3500322748	23		14880089	14880960	8421504	3	18,2,3	0,22,868	c	350032274800002947	0-23						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
698	chrII	14890274	14890300	3500266829	23		14890274	14890300	8421504	2	15,8	0,18	g	350026682900000945	16-39						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
698	chrII	14895407	14895435	3500373316	24		14895407	14895435	8421504	3	5,14,5	0,6,23	g	350037331600000045	4-28						by A dissertation submitted in partial satisfaction of the requirements for the degree of	s.csb.utoronto.ca	0	0		
698	chrII	14895407	14895435	3500074588	24		14895407	14895435	8421504	3	5,14,5	0,6,23	g	350007458800000045	4-28						by A dissertation submitted in partial satisfaction of the requirements for the degree of	rana.lbl.gov	0	0		
698	chrII	14906126	14909411	3500362686	40		14906126	14909411	8421504	2	19,21	0,3264	g	350036268600002553,350036268600000476,350036268600000318	17-36,18-43,18-43						<HTML> <TITLE>BLAST Search Results  Complet list of 1a2f hssp file Complet list of	cnptia.embrapa.br	0	0		
699	chrII	14947783	14947806	3500249990	23		14947783	14947806	8421504	1	23	0	g	350024999000000100	16-39						INTRODUCTION	www.sequenom.com	0	0		
699	chrII	14964715	14964739	3500143083	23		14964715	14964739	8421504	2	19,4	0,20	g	350014308300000001	5-28						神経活動を可視化するプローブ	Ishimoto	2010	0		
699	chrII	14982597	14982675	3500195313	26		14982597	14982675	8421504	3	15,10,1	0,20,77	c	350019531300000021	6-48						Process for production of L-aspartic acid	Mukouyama	1999	0		
699	chrII	14983791	14983814	3500403182	23		14983791	14983814	8421504	1	23	0	c	350040318200000005	2-25						Regulation of C elegans presynaptic differentiation and neurite branching via a novel signaling pathway initiated by	ev.biologists.org	0	0		
699	chrII	15003043	15003067	3500460445	23		15003043	15003067	8421504	2	9,14	0,10	g	350046044500000002	0-23						IL-2 重组毒素的克隆、表达及对IL-2R + 淋巴细胞的特异性细胞毒效应 检验医学 | 39	www.39kf.com	0	0		
699	chrII	15003043	15003067	3500005283	23		15003043	15003067	8421504	2	9,14	0,10	g	350000528300000002	0-23						 IL-2 重组毒素的克隆、表达及对IL-2R + 淋巴细胞的特异性细胞毒效应,-来宝网 	www.labbase.net	0	0		
699	chrII	15025737	15025817	3500288532	80		15025737	15025817	8421504	1	80	0	c,g	350028853200000005,350028853200000005	0-80,0-80						ScienceDirect.com - Genomics - A combined computational and experimental analysis of two families of snoRNA genes from Caenorhabditis elegans, revealing the expression and evolution pattern of snoRNAs in nematodes	sciencedirect.com	0	0		
699	chrII	15036162	15036190	3500344389	25		15036162	15036190	8421504	2	5,20	0,8	c	350034438900000986	10-35						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
700	chrII	15143301	15143327	3500017711	24		15143301	15143327	8421504	2	16,8	0,18	c	350001771100000119	11-35						<Html><Title> Complet list of 1c8u hssp file Complet list of	cnptia.embrapa.br	0	0		
701	chrII	15206818	15206845	3500019211	27		15206818	15206845	8421504	1	27	0	c	350001921100000011	0-27						Method for construction of normalized cDNA libraries - Patent # 5482845 - PatentGenius	.patentgenius.com	0	0		
701	chrII	15206819	15206842	3500186865	23		15206819	15206842	8421504	1	23	0	c	350018686500000173	0-23						<Html><Title> Complet list of 3gs6 hssp file Complet list of	cnptia.embrapa.br	0	0		
701	chrII	15260792	15260815	3500242967	23		15260792	15260815	8421504	1	23	0	g	350024296700000538	13-36						<Html><Title> Complet list of 1j2p hssp file Complet list of	cnptia.embrapa.br	0	0		
701	chrII	15268404	15273238	3500250463	1032		15268404	15273238	8421504	5	74,336,172,178,272	0,978,1379,2315,4562	p,c,g	350025046300015000,350025046300000001,350025046300000001,350025046300015001,350025046300015002	0-333,0-1032,0-1032,0-183,0-366						RubyからRの機能を使う - TogoWiki	.lifesciencedb.jp	0	0		
585	chrIII	0	480	3500407753	480		0	480	8421504	1	480	0	g	350040775300000000	0-480						Supervised Data mining model for DNA Sequence Analysis	hams.anilogix.biz	0	0		
585	chrIII	62999	66210	3500199211	1818		62999	66210	8421504	8	144,141,714,21,188,49,331,230	0,342,489,1206,1797,2031,2089,2981	p	350019921100015202,350019921100015187,350019921100015186,350019921100015179,350019921100015178,350019921100015172,350019921100015166,350019921100015156,350019921100015155,350019921100015145,350019921100015144,350019921100015137,350019921100015131	0-60,0-84,0-90,0-51,0-180,0-240,0-240,0-54,0-180,0-78,0-150,0-240,0-171						Etude des voies metaboliques des sucres chez l'huitre creuse crassostrea gigas. Implication dans les mortalites estivales.	chimer.ifremer.fr	0	0		
73	chrIII	78942	493114	3500375358	453		78942	493114	8421504	17	61,30,16,19,35,33,32,12,16,15,18,55,2,26,15,19,49	0,351,537,6591,6612,391527,391581,391727,391743,391859,391889,413565,413651,413684,413725,413748,414123	g	350037535800000001	2-612						Parameters for accurate genome alignment	biomedcentral.com	0	0		
585	chrIII	118420	125042	3500254945	39		118420	125042	8421504	4	13,6,5,15	0,14,6600,6607	c,g	350025494500002874,350025494500002874,350025494500002906	19-38,19-38,5-25						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
585	chrIII	120411	120436	3500189449	25		120411	120436	8421504	1	25	0	g	350018944900000112	10-45						家禽微卫星DNA遗传多样性检测技术规程 - 豆丁网	www.docin.com	0	0		
73	chrIII	125029	154346	3500397435	42		125029	154346	8421504	4	12,9,15,6	0,16,29294,29311	c,g	350039743500000114,350039743500002240	7-28,6-27						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
586	chrIII	139675	139699	3500457479	24		139675	139699	8421504	1	24	0	c	350045747900000008	0-24		23390595	10.1534/g3.112.004416		G3: Genes|Genomes|Genetics	Redundant Canonical and Noncanonical Caenorhabditis elegans p21-Activated Kinase Signaling Governs Distal Tip Cell Migrations	Eldon	2013	0		
586	chrIII	160572	160665	3500290247	93		160572	160665	8421504	1	93	0	p	350029024700015000	0-93						 seqs5 Palmebi.net Online Porno ონლაინ პორნო	palmebi.net	0	0		
586	chrIII	208074	208102	3500148814	24		208074	208102	8421504	2	9,15	0,13	g	350014881400000051	6-36						Methods and means to modulate programmed cell death in eukaryotic cells	E*Ba Bi Chu Ke 	2001	0		
586	chrIII	208968	208997	3500325155	26		208968	208997	8421504	3	13,6,7	0,15,22	g	350032515500000051,350032515500000015	0-29,0-29						METHOD FOR PROTECTING PLANTS FROM STRESS AND SENESCENCE - Patent application	www.faqs.org	0	0		
586	chrIII	212620	212646	3500295844	23		212620	212646	8421504	2	18,5	0,21	g	350029584400001489	0-23						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
586	chrIII	242783	242807	3500462888	24		242783	242807	8421504	1	24	0	c	350046288800000011	14-38						<!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01 Transitional//EN"> <HTML> <HEAD> <META http-equiv="Cont	web.sapmed.ac.jp	0	0		
587	chrIII	268775	276944	3500204223	44		268775	276944	8421504	3	11,12,21	0,2967,8148	c,g	350020422300000000,350020422300000001,350020422300000001	0-23,0-21,0-21						TaiLieu.VN: Báo cáo y học: "Decline of nucleotide excision repair capacity in aging Caenorhabditis elegan" 	tailieu.vn/doc/ba	0	0		
587	chrIII	280659	280685	3500446741	23		280659	280685	8421504	2	18,5	0,21	c	350044674100000009	9-32						 <HTML> <HEAD><TITLE>aedege|aa-a?a - c1ei1/4i1/4i1/4i1/4i1/4i1/4i1/4i1/4i1/4i1/4i1/4 | j-tokkyo</TITL	www.j-tokkyo.com	0	0		
587	chrIII	336078	336101	3500365031	23		336078	336101	8421504	1	23	0	c	350036503100000503	20-43						PURIFIED SR-p70 PROTEIN	Caput	1997	0		
587	chrIII	336078	336101	3500326924	23		336078	336101	8421504	1	23	0	c	350032692400000503	20-43						PURIFIED SR-p70 PROTEIN	Caput	1997	0		
73	chrIII	341117	493433	3500375358	285		341117	493433	8421504	10	19,81,15,16,16,20,84,9,9,16	0,50,5568,129517,129548,129568,152118,152222,152276,152300	g	350037535800000000	0-347						Parameters for accurate genome alignment	biomedcentral.com	0	0		
587	chrIII	344345	344372	3500305547	23		344345	344372	8421504	2	11,12	0,15	g	350030554700000141	21-44						Fungal variants and uses thereof	Milne	2006	0		
587	chrIII	347803	347827	3500368889	24		347803	347827	8421504	1	24	0	c	350036888900000200	16-40						<Html><Title> Complet list of 3gsb hssp file Complet list of	cnptia.embrapa.br	0	0		
587	chrIII	382462	382490	3500252948	25		382462	382490	8421504	2	5,20	0,8	g	350025294800000009	18-45						Running title: Light regulation of cell wall loosening enzymes Author for correspondence	.plantphysiol.org	0	0		
588	chrIII	408416	418691	3500399531	1398		408416	418691	8421504	31	157,89,30,12,65,13,45,31,11,45,45,45,42,45,16,26,42,42,30,15,45,93,45,33,12,45,81,60,62,28,48	0,495,587,1496,1514,2130,2149,2197,2831,2848,2896,3693,3741,3789,3837,5461,5493,5541,5589,8530,8548,8596,8692,8740,9186,9201,9249,9671,9734,10193,10227	c,g	350039953100000516,350039953100000516,350039953100000247,350039953100000515,350039953100000246,350039953100000514,350039953100000514,350039953100000245,350039953100000245,350039953100000513,350039953100000244,350039953100000512,350039953100000512,350039953100000243,350039953100000243,350039953100000242,350039953100000241,350039953100000509,350039953100000238,350039953100000237,350039953100000236,350039953100000236,350039953100000235,350039953100000233,350039953100000233,350039953100000232,350039953100000231,350039953100000230,350039953100000229,350039953100000228,350039953100000227,350039953100000226,350039953100000225,350039953100000224,350039953100000223,350039953100000222,350039953100000221,350039953100000221,350039953100000220,350039953100000220,350039953100000219,350039953100000218,350039953100000218,350039953100000217,350039953100000216,350039953100000215,350039953100000452	0-42,0-42,0-42,0-42,0-45,0-42,0-42,0-42,0-42,0-45,0-42,0-42,0-42,0-45,0-45,0-42,0-42,0-42,0-45,0-42,0-45,0-45,0-45,0-45,0-45,0-42,0-45,0-42,0-42,0-42,0-45,0-45,0-48,0-45,0-45,0-45,0-45,0-45,0-48,0-48,0-48,0-45,0-45,0-48,0-42,0-45,0-48						 Methods Of Modulating And Identifying Agents That Modulate Intracellular Calcium 	www.docstoc.com	0	0		
588	chrIII	408416	418691	3500138257	1077		408416	418691	8421504	12	153,90,66,48,48,48,126,114,81,111,110,82	0,527,1496,2149,3693,3789,5493,8530,8692,9186,9686,10193	c,g	350013825700000519,350013825700000519,350013825700000247,350013825700000246,350013825700000517,350013825700000517,350013825700000245,350013825700000515,350013825700000243,350013825700000243,350013825700000514,350013825700000242,350013825700000513,350013825700000241,350013825700000238,350013825700000233,350013825700000231,350013825700000229,350013825700000228,350013825700000227,350013825700000226,350013825700000225,350013825700000223,350013825700000222,350013825700000221,350013825700000221,350013825700000220,350013825700000218,350013825700000218,350013825700000217,350013825700000216,350013825700000215	0-45,0-45,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48						METHODS OF MODULATING AND IDENTIFYING AGENTS THAT MODULATE INTRACELLULAR CALCIUM - Patent application	www.faqs.org	0	0		
588	chrIII	408416	418691	3500096485	1326		408416	418691	8421504	13	157,92,17,31,100,65,28,164,126,243,111,110,82	0,495,1562,1929,2128,2831,2944,3673,5493,8530,9186,9686,10193	c,g	350009648500000519,350009648500000519,350009648500000247,350009648500000247,350009648500000518,350009648500000246,350009648500000246,350009648500000517,350009648500000517,350009648500000245,350009648500000516,350009648500000244,350009648500000515,350009648500000515,350009648500000243,350009648500000243,350009648500000240,350009648500000512,350009648500000238,350009648500000237,350009648500000236,350009648500000234,350009648500000233,350009648500000232,350009648500000231,350009648500000229,350009648500000228,350009648500000227,350009648500000226,350009648500000226,350009648500000225,350009648500000224,350009648500000223,350009648500000222,350009648500000221,350009648500000221,350009648500000220,350009648500000218,350009648500000218,350009648500000217,350009648500000216,350009648500000215,350009648500000215	0-45,0-45,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-21,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48						METHODS OF MODULATING AND IDENTIFYING AGENTS THAT MODULATE INTRACELLULAR CALCIUM - Patent application	www.faqs.org	0	0		
588	chrIII	408999	409024	3500027650	23		408999	409024	8421504	3	4,4,15	0,5,10	g	350002765000000009	15-38						UNIVERSIDAD POLITACNICA DE VALENCIA Escuela TA(c)cnica Superior de Ingenieros AgrA3nomos Departam	riunet.upv.es	0	0		
588	chrIII	436070	436093	3500038735	23		436070	436093	8421504	1	23	0	c	350003873500000803	11-34						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
588	chrIII	458294	504885	3500323108	44		458294	504885	8421504	4	12,8,18,6	0,17,46566,46585	g	350032310800000426,350032310800001086,350032310800000433	0-20,11-35,0-23						Plant genes and uses thereof	J*M*Sa Er Mi Long 	2002	0		
588	chrIII	491907	501809	3500089576	599		491907	501809	8421504	11	26,45,33,45,45,135,90,45,90,16,29	0,1870,2876,2967,4410,5593,5818,5953,7463,8699,9873	p,c	350008957600000008,350008957600015010,350008957600000026,350008957600015023,350008957600015027,350008957600015033,350008957600015034,350008957600015035,350008957600015037,350008957600015038,350008957600015040,350008957600015046,350008957600015047,350008957600015053	4-30,0-45,0-33,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45						Figures	ioinformatics.org	0	0		
588	chrIII	493576	493832	3500053622	38		493576	493832	8421504	2	19,19	0,237	c,g	350005362200000004,350005362200000004,350005362200000005,350005362200000005	0-19,0-19,0-19,0-19		9847081	10.1101/gr.8.11.1192	1088-9051	Genome Research	CeRep25B Forms Chromosome-Specific Minisatellite Arrays in Caenorhabditis elegans	Pilgrim	1998	14		
588	chrIII	502800	502886	3500288532	86		502800	502886	8421504	1	86	0	g	350028853200000003	0-86						ScienceDirect.com - Genomics - A combined computational and experimental analysis of two families of snoRNA genes from Caenorhabditis elegans, revealing the expression and evolution pattern of snoRNAs in nematodes	sciencedirect.com	0	0		
588	chrIII	509748	509774	3500402504	23		509748	509774	8421504	2	5,18	0,8	c	350040250400000005	5-28		22925434	10.1111/j.1469-0691.2012.03976.x	1469-0691	Clinical Microbiology and Infection	Development of a single tube multiplex real-time PCR to detect the most clinically relevant Mucormycetes species - Bernal-Martínez - 2012 - Clinical Microbiology and Infection - Wiley Online Library	Bernal-Martinez	2013	0		
589	chrIII	593973	594932	3500133886	42		593973	594932	8421504	4	5,17,11,9	0,7,937,950	g	350013388600000345,350013388600000132	0-22,0-21						Brain Endothelial Cell Expression Patterns	Madden	2012	0		
589	chrIII	599600	603379	3500038690	42		599600	603379	8421504	2	21,21	0,3758	c,g	350003869000000001,350003869000000001,350003869000000000,350003869000000000	13-34,13-34,11-32,11-32		21115491	10.1074/jbc.M110.188581		The Journal of Biological Chemistry	Caenorhabditis elegans Galectins LEC-6 and LEC-10 Interact with Similar Glycoconjugates in the Intestine	Lisa	2011	0		
589	chrIII	599979	600116	3500047981	85		599979	600116	8421504	4	4,22,40,19	0,5,52,118	c,g	350004798100000092,350004798100000028,350004798100000093,350004798100000032,350004798100000032,350004798100000097,350004798100000097,350004798100000030,350004798100000030,350004798100000095,350004798100000095	0-26,1-22,1-22,0-20,0-20,0-20,0-20,0-19,0-19,0-19,0-19						Reducing Template Independent Primer Extension and Threshold Time for Loop Mediated Isothermal Amplification - Patent application	www.faqs.org	0	0		
589	chrIII	618942	618968	3500439977	23		618942	618968	8421504	2	18,5	0,21	c	350043997700000067	22-45						Ostertagia Vaccine - Patent application	www.faqs.org	0	0		
589	chrIII	633670	634612	3500053622	45		633670	634612	8421504	2	22,23	0,919	c,g	350005362200000001,350005362200000000	0-22,9-32		9847081	10.1101/gr.8.11.1192	1088-9051	Genome Research	CeRep25B Forms Chromosome-Specific Minisatellite Arrays in Caenorhabditis elegans	Pilgrim	1998	14		
589	chrIII	646913	646943	3500072483	25		646913	646943	8421504	3	6,6,13	0,7,17	g	350007248300000638	14-40						Method of Producing Transgenic Graminaceous Cells and Plants - Patent application	www.faqs.org	0	0		
589	chrIII	653308	653389	3500333469	81		653308	653389	8421504	1	81	0	p	350033346900015012	0-81						A mutation in Orai1 causes immune deficiency by abrogating CRAC channel function	thology.wustl.edu	0	0		
589	chrIII	653437	653671	3500148659	162		653437	653671	8421504	2	98,64	0,170	p	350014865900015147	6-168						50 human secreted proteins	Komatsoulis	2002	0		
589	chrIII	653437	653671	3500068672	162		653437	653671	8421504	2	98,64	0,170	p	350006867200015147	6-168						50 human secreted proteins	Komatsoulis	2000	0		
590	chrIII	662658	662685	3500168684	27		662658	662685	8421504	1	27	0	g	350016868400001328	27-54						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
590	chrIII	675599	675623	3500143070	24		675599	675623	8421504	1	24	0	c	350014307000000420	12-36						<Html><Title> Complet list of 3a2p hssp file Complet list of	cnptia.embrapa.br	0	0		
590	chrIII	693585	693655	3500062896	24		693585	693655	8421504	3	5,2,17	0,47,53	c	350006289600000022	24-48						Boletim de Pesquisa 180 e Desenvolvimento ISSN 1676 - 1340	nargen.embrapa.br	0	0		
590	chrIII	709230	713303	3500254085	24		709230	713303	8421504	3	1,15,8	0,4048,4065	c	350025408500000001	0-24		14983050	10.1073/pnas.0308474100	0027-8424	Proceedings of the National Academy of Sciences of the United States of America	Mutation of the zebrafish choroideremia gene encoding Rab escort protein 1 devastates hair cells	Starr	2004	10		
590	chrIII	729098	739026	3500370254	42		729098	739026	8421504	3	20,11,11	0,9901,9917	c,g	350037025400000782,350037025400000642	18-38,0-22						ENGINEERED MICROORGANISMS WITH ENHANCED FERMENTATION ACTIVITY - Patent application	www.faqs.org	0	0		
590	chrIII	729272	729299	3500280784	23		729272	729299	8421504	2	8,15	0,12	c	350028078400000019	0-23						<Html><Title> Complet list of 1od8 hssp file Complet list of	cnptia.embrapa.br	0	0		
590	chrIII	729274	729300	3500242967	23		729274	729300	8421504	2	13,10	0,16	c	350024296700000250	0-23						<Html><Title> Complet list of 1j2p hssp file Complet list of	cnptia.embrapa.br	0	0		
590	chrIII	765188	771378	3500320031	1863		765188	771378	8421504	9	73,301,313,87,178,249,90,185,387	0,3365,3714,4095,4697,5069,5402,5539,5803	p,c,g	350032003100000003,350032003100015002,350032003100000004,350032003100000005,350032003100000006,350032003100000007,350032003100000008,350032003100000009,350032003100000009,350032003100015006,350032003100015008,350032003100000010,350032003100000010,350032003100015010,350032003100000011,350032003100000011,350032003100015012,350032003100000012,350032003100000012,350032003100015014,350032003100000013,350032003100000013,350032003100015016,350032003100000014,350032003100000014,350032003100015018,350032003100000015,350032003100000015,350032003100015020,350032003100000016,350032003100015022,350032003100000017,350032003100000017,350032003100015039,350032003100000018,350032003100000018,350032003100015024,350032003100000000,350032003100000000,350032003100015044,350032003100015026,350032003100000019,350032003100000019,350032003100000020,350032003100000020,350032003100015028,350032003100015046,350032003100000021,350032003100000021,350032003100015030,350032003100015001,350032003100015048,350032003100000022,350032003100000022,350032003100015032,350032003100015000,350032003100000023,350032003100015038,350032003100000047,350032003100015034,350032003100015060,350032003100015056,350032003100000024,350032003100000024,350032003100000001,350032003100000001,350032003100015035,350032003100000025,350032003100015036	7-60,0-45,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-61,0-61,0-87,0-60,0-60,0-60,7-37,7-37,0-90,0-60,0-61,0-61,0-60,0-60,0-60,0-87,0-60,0-60,0-60,0-45,0-72,0-60,0-60,0-60,0-45,0-60,0-54,0-396,0-60,0-90,0-84,0-60,0-60,8-34,8-34,0-60,0-164,0-54						PTL-1, a microtubule-associated protein with tau-like repeats from the nematode Caenorhabditis elegans	cs.biologists.org	0	0		
590	chrIII	768997	769132	3500384752	135		768997	769132	8421504	1	135	0	p	350038475200015032	0-135						48 human secreted proteins	Komatsoulis	2002	0		
590	chrIII	768997	769132	3500375425	135		768997	769132	8421504	1	135	0	p	350037542500015032	0-135						48 human secreted proteins	Komatsoulis	2000	0		
590	chrIII	770042	770281	3500017253	45		770042	770281	8421504	2	21,24	0,215	p	350001725300015010	0-45						Pathogenic Tau mutations in transgenic mice	Hutton	2000	0		
590	chrIII	771162	772699	3500153246	1080		771162	772699	8421504	7	83,66,189,127,195,209,211	0,144,259,639,812,1062,1326	g	350015324600000016	0-1080						TYROSYLPROTEIN SULFOTRANSFERASES AND METHODS OF USE THEREOF - Patent application	www.faqs.org	0	0		
590	chrIII	771162	772699	3500074325	1080		771162	772699	8421504	7	83,66,189,127,195,209,211	0,144,259,639,812,1062,1326	g	350007432500000016	0-1080						Tyrosylprotein sulfotransferases	Moore	2003	0		
590	chrIII	773531	773690	3500136159	40		773531	773690	8421504	2	20,20	0,139	c,g	350013615900000010,350013615900000011,350013615900000011	0-20,0-20,0-20						Supporting Information	www.pnas.org	0	0		
590	chrIII	783838	783866	3500155152	25		783838	783866	8421504	2	12,13	0,15	c	350015515200000265	12-37						<Html><Title> Complet list of 1cmj hssp file Complet list of	cnptia.embrapa.br	0	0		
591	chrIII	811931	814002	3500273984	67		811931	814002	8421504	3	22,24,21	0,1972,2050	g	350027398400000005,350027398400000008,350027398400000006	12-34,0-24,0-21						Cell Metabolism Article	sciencedirect.com	0	0		
591	chrIII	812726	813254	3500266468	49		812726	813254	8421504	2	25,24	0,504	c,g	350026646800000056,350026646800000059,350026646800000059	0-25,0-24,0-24						Molecular and Biochemical Parasitology	005.pasteur.ac.ir	0	0		
591	chrIII	813903	814002	3500361680	45		813903	814002	8421504	2	24,21	0,78	g	350036168000000008,350036168000000006	0-24,0-21						Cell Metabolism Article	lty.salisbury.edu	0	0		
591	chrIII	816003	816029	3500254463	23		816003	816029	8421504	2	16,7	0,19	g	350025446300000080	8-31						<Html><Title> Complet list of 1rvv hssp file Complet list of	cnptia.embrapa.br	0	0		
591	chrIII	839824	839862	3500115116	28		839824	839862	8421504	3	13,9,6	0,18,32	g	350011511600000087	1-29						Simian adenovirus nucleic acid and amino acid sequences, vectors containing same, and methods of use	J*M*Wei Er Sen 	2005	0		
591	chrIII	853179	853599	3500358534	38		853179	853599	8421504	2	19,19	0,401	c,g	350035853400000015,350035853400000015,350035853400000014	0-19,0-19,0-19			10.1261/rna.5420503		RNA	The Ref/Aly proteins are dispensable for mRNA export and development in Caenorhabditis elegans	DASA	July	0		
591	chrIII	860991	861406	3500092599	61		860991	861406	8421504	3	20,20,21	0,28,394	c,g	350009259900000010,350009259900000010,350009259900000016,350009259900000016,350009259900000017	0-20,0-20,0-20,0-20,0-21		18780728	10.1534/genetics.108.093310		Genetics	ADBP-1 Regulates an ADAR RNA-Editing Enzyme to Antagonize RNA-Interference-Mediated Gene Silencing in Caenorhabditis elegans	Hiromitsu	2008	0		
591	chrIII	865828	865898	3500440700	70		865828	865898	8421504	1	70	0	g	350044070000000000	0-70						matlab运行出现错误，不知道怎么回事？是用n来统计个数，最后不该是0啊！！	zhidao.baidu.com	0	0		
591	chrIII	866483	866511	3500014387	24		866483	866511	8421504	2	7,17	0,11	g	350001438700000144	5-29						<Html><Title> Complet list of 1u5h hssp file Complet list of	cnptia.embrapa.br	0	0		
591	chrIII	872749	873027	3500174186	28		872749	873027	8421504	4	1,6,3,18	0,246,253,260	c	350017418600000003	6-34						Journal of Virological Methods	ww.optigene.co.uk	0	0		
591	chrIII	902411	907528	3500446855	3022		902411	907528	8421504	12	261,393,66,281,135,115,127,599,527,185,284,49	0,364,1343,1480,1833,2218,2376,3183,3835,4504,4737,5068	c,g	350044685500000011,350044685500000032,350044685500000032,350044685500000146,350044685500000146,350044685500000144,350044685500000144,350044685500000143,350044685500000031,350044685500000141,350044685500000141,350044685500000139,350044685500000139,350044685500000137,350044685500000137,350044685500000135,350044685500000135,350044685500000133,350044685500000134,350044685500000134,350044685500000131,350044685500000131,350044685500000129,350044685500000129,350044685500000127,350044685500000127,350044685500000125,350044685500000125,350044685500000123,350044685500000123,350044685500000121,350044685500000121	0-3017,0-20,0-20,0-60,0-60,0-60,0-60,0-45,79-740,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60						Étude de la fonction des Rho GAP au cours du développement embryonnaire du nématode caenorhabditis elegans	.archipel.uqam.ca	0	0		
591	chrIII	911688	911714	3500105987	23		911688	911714	8421504	2	15,8	0,18	c	350010598700000002,350010598700000003	0-23,14-37						Insertion of IF (insertion-in-flap) Domain into F36V to Provide Higher Activity of Peptidyl-propyl cis-trans Isomerase	rnal.kcsnet.or.kr	0	0		
592	chrIII	1011238	1011266	3500241896	23		1011238	1011266	8421504	2	7,16	0,12	c	350024189600000011	0-23		17012262	10.1096/fj.06-5761com	0892-6638	The FASEB Journal	Obscurin modulates the assembly and organization of sarcomeres and the sarcoplasmic reticulum	Kontrogianni-Konstantopoulos	2006	6		
592	chrIII	1011238	1011266	3500053201	23		1011238	1011266	8421504	2	7,16	0,12	c	350005320100000011	0-23		17012262	10.1096/fj.06-5761com	0892-6638	The FASEB Journal	Obscurin modulates the assembly and organization of sarcomeres and the sarcoplasmic reticulum	Kontrogianni-Konstantopoulos	2006	6		
592	chrIII	1015374	1015397	3500196959	23		1015374	1015397	8421504	1	23	0	g	350019695900000020	11-36						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
592	chrIII	1021733	1021767	3500426004	24		1021733	1021767	8421504	3	11,7,6	0,16,28	c	350042600400000020	9-33						Parasitic helminth PLA2 proteins	Grieve	1995	0		
592	chrIII	1021733	1021767	3500315927	24		1021733	1021767	8421504	3	11,7,6	0,16,28	c	350031592700000021	9-33						Parasitic helminth PLA2 proteins and nucleic acid molecules - US Patent 6060281 Description	ww.patentstorm.us	0	0		
593	chrIII	1086675	1086702	3500083511	23		1086675	1086702	8421504	2	11,12	0,15	g	350008351100000001	0-23						T07E3.1: sEx14642 | Flickr - Photo Sharing!	www.flickr.com	0	0		
593	chrIII	1104234	1104258	3500027708	24		1104234	1104258	8421504	1	24	0	c	350002770800000041	0-24						DIE HUMANE ACETYLCHOLINESTERASE DESIGN UND SYNTHESE EINES OPTIMIERTEN GENS UND DIE EXPRESSION IN PICHIA PASTORIS	.uni-stuttgart.de	0	0		
593	chrIII	1107406	1107433	3500450119	23		1107406	1107433	8421504	2	13,10	0,17	g	350045011900000018	25-48						US Patent # 5,378,625. Bacillus thuringiensis cryIIIC, (b) protein toxic to coleopteran insects - Patents.com	www.patents.com	0	0		
593	chrIII	1122565	1122591	3500346257	23		1122565	1122591	8421504	2	5,18	0,8	g	350034625700000001	7-30						求助： 谁有生物基因算法类的书籍推荐-Perl-ChinaUnix.net	bbs.chinaunix.net	0	0		
593	chrIII	1124132	1164789	3500168119	38		1124132	1164789	8421504	4	5,14,8,11	0,7,40636,40646	c,g	350016811900000368,350016811900000769	0-19,4-23						<Html><Title> Complet list of 2yvg hssp file Complet list of	cnptia.embrapa.br	0	0		
593	chrIII	1127233	1127791	3500122340	90		1127233	1127791	8421504	3	12,33,45	0,477,513	p	350012234000015050,350012234000015048	0-45,0-45						Polynucleotides Encoding Acetylcholine-Gated Chloride Channel Subunits of Caenorhabditis Elegans - Patent application	www.faqs.org	0	0		
593	chrIII	1139060	1139086	3500226963	23		1139060	1139086	8421504	2	5,18	0,8	c	350022696300000385	5-28						<Html><Title> Complet list of 1juk hssp file Complet list of	cnptia.embrapa.br	0	0		ACTR2
593	chrIII	1147209	1147235	3500144883	24		1147209	1147235	8421504	3	5,11,8	0,6,18	g	350014488300000537	16-40						Method for producing polyunsaturated fatty acids in transgenic plants - Patent application	www.faqs.org	0	0		
593	chrIII	1147209	1147235	3500088374	24		1147209	1147235	8421504	3	5,11,8	0,6,18	g	350008837400000412	16-40						Method For Producing Multiple Unsaturated Fatty Acids In Plants 	.freshpatents.com	0	0		
593	chrIII	1154538	1154572	3500289089	30		1154538	1154572	8421504	2	13,17	0,17	g	350028908900000000	0-33						BMC Genomics BioMed Central	biomedcentral.com	0	0		
593	chrIII	1159668	1159697	3500405107	25		1159668	1159697	8421504	2	10,15	0,14	g	350040510700000150	4-29						<Html><Title> Complet list of 1epx hssp file Complet list of	cnptia.embrapa.br	0	0		
593	chrIII	1161939	1161964	3500321340	23		1161939	1161964	8421504	2	15,8	0,17	g	350032134000000003	0-23			10.1590/S1415-47572006000300030	1415-4757	Genetics and Molecular Biology	Genetics and Molecular Biology - Mitochondrial tRNA gene translocations in highly eusocial bees	Silvestre	2006	1		
593	chrIII	1169094	1169126	3500254945	26		1169094	1169126	8421504	3	11,4,11	0,16,21	g	350025494500000331	9-35						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
594	chrIII	1196268	1197691	3500075386	40		1196268	1197691	8421504	2	20,20	0,1403	c,g	350007538600000003,350007538600000002,350007538600000002	0-20,0-20,0-20		15944183	10.1242/dev.01895	0950-1991	Development	Control of body size by SMA-5, a homolog of MAP kinase BMK1/ERK5, in C. elegans	Watanabe	2005	7		
594	chrIII	1243212	1243238	3500362686	23		1243212	1243238	8421504	2	16,7	0,19	g	350036268600002021	24-48						<HTML> <TITLE>BLAST Search Results  Complet list of 1a5y hssp file Complet list of	cnptia.embrapa.br	0	0		
595	chrIII	1357684	1357710	3500058176	23		1357684	1357710	8421504	3	12,4,7	0,14,19	c	350005817600000003	11-34						Branching of the p-nitrophenol (PNP) degradation pathway in burkholderia sp. Strain SJ98: Evidences from genetic characterization of PNP gene cluster	w.amb-express.com	0	0		
595	chrIII	1412580	1412608	3500122515	23		1412580	1412608	8421504	2	16,7	0,21	c	350012251500000007	1-28						perl - How could I iterate in a nested array if a different conditions are TRUE? - Stack Overflow	stackoverflow.com	0	0		
596	chrIII	1539438	1539474	3500249686	36		1539438	1539474	8421504	1	36	0	c	350024968600000004	0-36						SourceForge.net: Mapping and Assembly with Qualities: maq-help	sourceforge.net	0	0		
596	chrIII	1561989	1562016	3500214872	24		1561989	1562016	8421504	2	8,16	0,11	g	350021487200000580	19-43						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
597	chrIII	1576010	1576039	3500006669	23		1576010	1576039	8421504	3	13,5,5	0,16,24	g	350000666900000050	13-36						<Html><Title> Complet list of 1vly hssp file Complet list of	cnptia.embrapa.br	0	0		
597	chrIII	1584657	1589394	3500461784	828		1584657	1589394	8421504	8	96,42,79,11,210,87,69,234	0,99,144,1181,1195,3143,3233,4503	p	350046178400015024,350046178400015023	0-594,0-234						Newly identified cholinephosphotransferases and ethanolaminephosphotransferases	Huitema	2005	0		
597	chrIII	1589259	1589286	3500336276	24		1589259	1589286	8421504	2	6,18	0,9	c	350033627600001334	3-27						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
597	chrIII	1589259	1589286	3500209433	24		1589259	1589286	8421504	2	6,18	0,9	c	350020943300001352	3-27						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
597	chrIII	1598569	1598605	3500304073	28		1598569	1598605	8421504	3	12,7,9	0,15,27	g	350030407300000058	13-41						<Html><Title> Complet list of 2abm hssp file Complet list of	cnptia.embrapa.br	0	0		
597	chrIII	1604572	1604634	3500386452	62		1604572	1604634	8421504	1	62	0	c	350038645200000528	0-62						NEUROPROTECTIVE MOLECULES AND METHODS OF TREATING NEUROLOGICAL DISORDERS AND INDUCING STRESS GRANULES	Anderson	2011	0		
597	chrIII	1604572	1604634	3500235647	62		1604572	1604634	8421504	1	62	0	c	350023564700000528,350023564700001321	0-62,0-62						NEUROPROTECTIVE MOLECULES AND METHODS OF TREATING NEUROLOGICAL DISORDERS AND INDUCING STRESS GRANULES - Patent application	www.faqs.org	0	0		
597	chrIII	1604572	1604612	3500450260	40		1604572	1604612	8421504	1	40	0	c	350045026000000022	0-40		18729214	10.1002/dvdy.21666	1097-0177	Developmental Dynamics	Determination of microRNAs in mouse preimplantation embryos by microarray - Yang - 2008 - Developmental Dynamics - Wiley Online Library	Yang	2008	0		
597	chrIII	1604572	1604612	3500110852	40		1604572	1604612	8421504	1	40	0	c	350011085200000002	0-40						miRNA 芯片使用指南	load.bioon.com.cn	0	0		
597	chrIII	1607677	1607703	3500052689	23		1607677	1607703	8421504	2	15,8	0,18	c	350005268900000005	1-25		16723499	10.1091/mbc.E06-03-0192	1059-1524	Molecular Biology of the Cell	ATP-binding Cassette Transporters Are Required for Efficient RNA Interference in Caenorhabditis elegans	Sundaram	2006	5		
597	chrIII	1610589	1610615	3500227264	23		1610589	1610615	8421504	2	17,6	0,20	g	350022726400000093,350022726400000109	0-23,0-19						ORFeome-based arrays in eukaryotic expression vectors - a new approach to screen for the function of viral proteins (LANA-1 meets the mediator)	b.uni-muenchen.de	0	0		
597	chrIII	1623421	1624478	3500219569	60		1623421	1624478	8421504	2	6,54	0,1003	p	350021956900015010	0-60						Compositions of Hsp60 Peptides and Viral Antigens for Vaccination and Diagnosis - Patent application	www.faqs.org	0	0		
597	chrIII	1623421	1624478	3500119922	60		1623421	1624478	8421504	2	6,54	0,1003	p	350011992200015002	0-60						COMPOSITIONS OF HSP60 PEPTIDES AND VIRAL ANTIGENS FOR VACCINATION AND DIAGNOSIS - Patent application	www.faqs.org	0	0		
597	chrIII	1627225	1627254	3500207599	25		1627225	1627254	8421504	2	19,6	0,23	g	350020759900000217	15-40							shfieldclinic.org	0	0		
597	chrIII	1637341	1637367	3500153813	23		1637341	1637367	8421504	2	17,6	0,20	c	350015381300000007	0-23						分子生物学第二章 基因与基因_百度文库	wenku.baidu.com	0	0		
597	chrIII	1665293	1665321	3500145362	26		1665293	1665321	8421504	2	21,5	0,23	g	350014536200000076	0-29						ANTI-SERUM ALBUMIN BINDING VARIANTS - Patent application	www.faqs.org	0	0		
598	chrIII	1723355	1733079	3500173272	40		1723355	1733079	8421504	2	21,19	0,9705	c,g	350017327200000031,350017327200000029,350017327200000029	10-31,12-31,12-31						Methods For Improving The Function Of Heterlogous G Protein-coupled Receptors 	.freshpatents.com	0	0		
598	chrIII	1723355	1733079	3500110940	40		1723355	1733079	8421504	2	21,19	0,9705	c	350011094000000031,350011094000000029	10-31,12-31						Methods for improving the function of heterologous g protein-coupled receptors	Pausch	2001	0		
598	chrIII	1723355	1733079	3500100325	40		1723355	1733079	8421504	2	21,19	0,9705	c,g	350010032500000031,350010032500000029,350010032500000029	10-31,12-31,12-31						Methods for improving the function of heterologous g protein-coupled receptors	Pausch	2000	0		
598	chrIII	1729333	1737157	3500156990	46		1729333	1737157	8421504	2	24,22	0,7802	c,g	350015699000000021,350015699000000020	14-38,0-22						ScienceDirect.com - Developmental Biology - LIM homeobox gene-dependent expression of biogenic amine receptors in restricted regions of the C. elegans nervous system	sciencedirect.com	0	0		
598	chrIII	1741450	1741475	3500292172	23		1741450	1741475	8421504	2	7,16	0,9	g	350029217200000035	7-30						柱状黄杆菌乙酰辅酶A 合成酶基因及其上游调控序列分析 - 豆丁网	www.docin.com	0	0		
598	chrIII	1769878	1769906	3500128414	24		1769878	1769906	8421504	3	5,5,14	0,6,14	g	350012841400000018	23-47						Recombinant restriction enzyme Sau3AI	Gotz	1991	0		
598	chrIII	1772249	1772276	3500341750	24		1772249	1772276	8421504	2	18,6	0,21	g	350034175000000006	0-24						Combinatorial QTL-Related To Tomato Fruit Firmness	.plantphysiol.org	0	0		
598	chrIII	1785857	1788332	3500020523	40		1785857	1788332	8421504	2	19,21	0,2454	g	350002052300000007,350002052300000008	0-19,0-21						8. Nature Neuroscience August 2009	www.scribd.com	0	0		
598	chrIII	1795913	1795939	3500242967	24		1795913	1795939	8421504	2	19,5	0,21	c	350024296700000027	7-31						<Html><Title> Complet list of 1j2p hssp file Complet list of	cnptia.embrapa.br	0	0		
598	chrIII	1804809	1804835	3500388920	23		1804809	1804835	8421504	2	10,13	0,13	c	350038892000000036	25-48						Recombinant infectious bovine rhinotracheitis virus s-ibr-052 and uses thereof	Cochran	1996	0		
598	chrIII	1804809	1804835	3500069576	23		1804809	1804835	8421504	2	10,13	0,13	c	350006957600000036	25-48						Recombinant infectious bovine rhinotracheitis virus s-ibr-052 and uses thereof	Cochran	1995	0		
598	chrIII	1814083	1814110	3500028321	23		1814083	1814110	8421504	2	8,15	0,12	c	350002832100000022	0-23						<Html><Title> Complet list of 3o4s hssp file Complet list of	cnptia.embrapa.br	0	0		
599	chrIII	1856942	1856968	3500168119	23		1856942	1856968	8421504	2	5,18	0,8	g	350016811900000184	5-28						<Html><Title> Complet list of 2yvg hssp file Complet list of	cnptia.embrapa.br	0	0		
599	chrIII	1902184	1908505	3500344389	40		1902184	1908505	8421504	4	4,17,6,13	0,5,6299,6308	c,g	350034438900001669,350034438900000573	0-21,24-43						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
599	chrIII	1919013	1919039	3500371708	25		1919013	1919039	8421504	2	11,14	0,12	g	350037170800000080,350037170800000081	9-34,8-33						tool=tbl id=jbc;279/32 key=First page Table ID Table Comments hidErr keephtml=2 warning=Warning cond	ke.sciencemag.org	0	0		
599	chrIII	1929231	1929258	3500326993	25		1929231	1929258	8421504	3	12,5,8	0,13,19	c	350032699300000170	10-48						Nucleic Acid, Polypeptide and Its Use - Patent application	www.faqs.org	0	0		
599	chrIII	1930890	1930920	3500274936	30		1930890	1930920	8421504	1	30	0	c	350027493600000050	1-37						Rice Gene, GS3, Exerting Primary Control Over Grain Length and Grain Weight - Patent application	www.faqs.org	0	0		
599	chrIII	1930897	1930921	3500144391	24		1930897	1930921	8421504	1	24	0	c	350014439100000435,350014439100000580,350014439100000576,350014439100000623	0-22,12-35,12-33,24-45						SPIDER SILK DRAGLINE POLYNUCLEOTIDES, POLYPEPTIDES AND METHODS OF USE THEREOF - Patent application	www.faqs.org	0	0		
599	chrIII	1934256	1937931	3500157696	89		1934256	1937931	8421504	8	15,6,3,5,7,24,18,11	0,18,33,177,185,204,2188,3664	c	350015769600000066	211-300						<!DOCTYPE HTML PUBLIC i3/4-//IETF//DTD HTML 3.0//ENi3/4> <!- SPECIFICATION OF LANGUAGE-> <HTML> 	wheat.pw.usda.gov	0	0		
599	chrIII	1934431	1937828	3500355739	48		1934431	1937828	8421504	4	8,3,24,13	0,11,29,3384	c	350035573900000049	15-114						Social Amoebas Comparative Genome Browser	Suhnel		0		
599	chrIII	1946825	1946853	3500336276	23		1946825	1946853	8421504	2	9,14	0,14	g	350033627600001126	5-28						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
599	chrIII	1946825	1946853	3500209433	23		1946825	1946853	8421504	2	9,14	0,14	g	350020943300001194	5-28						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
600	chrIII	1974865	1974891	3500022904	25		1974865	1974891	8421504	2	15,10	0,16	c	350002290400000197	17-42						Assays and methods for determining activity of a therapeutic agent in a subject	Sah	2012	0		
600	chrIII	1978364	1978388	3500043484	23		1978364	1978388	8421504	2	10,13	0,11	c	350004348400000010	1-24						使用含有弱化的aspA基因的肠细菌科菌株制备L-氨基酸的方法	Tuo Ma Si *He Er Man 	2004	0		
600	chrIII	1986754	1986782	3500395446	25		1986754	1986782	8421504	2	11,14	0,14	g	350039544600004130,350039544600004129	1-34,2-35						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
600	chrIII	2011010	2016006	3500063695	1475		2011010	2016006	8421504	37	42,42,48,42,42,45,27,15,45,23,23,42,43,2,42,35,10,49,45,42,45,42,42,45,45,30,15,93,37,8,45,41,4,141,9,84,45	0,48,96,240,288,336,384,1401,1422,1469,1548,1574,1622,1717,1722,1770,2389,2401,2498,2546,2594,2642,2690,2738,2786,2834,3537,3555,3651,4110,4121,4169,4430,4437,4581,4864,4951	c,g	350006369500000857,350006369500000856,350006369500000855,350006369500000852,350006369500000852,350006369500000851,350006369500000851,350006369500000850,350006369500000850,350006369500000849,350006369500000848,350006369500000848,350006369500000847,350006369500000846,350006369500000846,350006369500000845,350006369500000844,350006369500000844,350006369500000843,350006369500000842,350006369500000842,350006369500000840,350006369500000840,350006369500000839,350006369500000839,350006369500000838,350006369500000838,350006369500000837,350006369500000837,350006369500000836,350006369500000836,350006369500000835,350006369500000835,350006369500000834,350006369500000834,350006369500000833,350006369500000832,350006369500000832,350006369500000831,350006369500000831,350006369500000830,350006369500000829,350006369500000829,350006369500000828,350006369500000827,350006369500000826,350006369500000825,350006369500000825,350006369500000824,350006369500000823,350006369500000822,350006369500000822	0-42,0-42,0-48,0-42,0-42,0-42,0-42,0-45,0-45,0-42,0-45,0-45,0-46,0-42,0-42,0-45,0-42,0-42,0-45,0-49,0-49,0-45,0-45,0-42,0-42,0-45,0-45,0-42,0-42,0-42,0-42,0-45,0-45,0-45,0-45,0-45,0-48,0-48,0-45,0-45,0-45,0-45,0-45,0-45,0-48,0-48,0-45,0-45,0-48,0-45,0-45,0-45						G protein-coupled receptor-like receptors and modulators thereof - US Patent 7208591 Description	ww.patentstorm.us	0	0		
600	chrIII	2020000	2020031	3500335263	25		2020000	2020031	8421504	3	12,4,9	0,13,22	g	350033526300000181	11-36						Parasitic nematode transglutaminase proteins, nucleic acid molecules, and uses thereof	Chandrashekar	1999	0		
600	chrIII	2032682	2032711	3500439905	25		2032682	2032711	8421504	2	13,12	0,17	g	350043990500000047	0-25						Mehrfachpromotoren und deren Verwendung zur Genexpression	Haefner	2008	0		
600	chrIII	2032682	2032711	3500266610	25		2032682	2032711	8421504	2	13,12	0,17	g	350026661000000001	0-25						Fermentative Herstellung von Feinchemikalien - Dokument DE102004026152A1	www.patent-de.com	0	0		
600	chrIII	2032682	2032711	3500184464	25		2032682	2032711	8421504	2	13,12	0,17	g	350018446400000052	0-25						Mehrfachpromotoren - Dokument DE102004061846A1	www.patent-de.com	0	0		
600	chrIII	2032682	2032711	3500081421	25		2032682	2032711	8421504	2	13,12	0,17	g	350008142100000015	0-25						P ef-tu-expressionseinheiten	Haefner	2006	0		
600	chrIII	2032682	2032711	3500043375	25		2032682	2032711	8421504	2	13,12	0,17	g	350004337500000011	0-25						Verfahren zur fermentativen herstellung schwefelhaltiger feinchemikalien (mety)	Haefner	2004	0		
600	chrIII	2055219	2055244	3500141736	24		2055219	2055244	8421504	2	15,9	0,16	g	350014173600000324	23-47						US Patent # 6,497,882. Recombinant swinepox virus - Patents.com	www.patents.com	0	0		
601	chrIII	2116415	2116577	3500395114	41		2116415	2116577	8421504	2	21,20	0,142	c,g	350039511400000033,350039511400000033,350039511400000032,350039511400000032	0-21,0-21,0-20,0-20		23103171	10.1016/j.celrep.2012.09.019	2211-1247	Cell Reports	Cell Reports - Antagonism between MES-4 and Polycomb Repressive Complex 2 Promotes Appropriate Gene Expression in C. elegans Germ Cells	Gaydos	2012	0		
601	chrIII	2116415	2116577	3500150118	41		2116415	2116577	8421504	2	21,20	0,142	c,g	350015011800000033,350015011800000033,350015011800000032	0-21,0-21,0-20		23103171	10.1016/j.celrep.2012.09.019	2211-1247	Cell Reports	Cell Reports - Antagonism between MES-4 and Polycomb Repressive Complex 2 Promotes Appropriate Gene Expression in C. elegans Germ Cells	Gaydos	2012	0		
601	chrIII	2151346	2151373	3500115005	23		2151346	2151373	8421504	2	6,17	0,10	g	350011500500000199	20-45						<Html><Title> Complet list of 2x4z hssp file Complet list of	cnptia.embrapa.br	0	0		
601	chrIII	2172448	2173135	3500389139	88		2172448	2173135	8421504	4	22,22,22,22	0,410,560,665	c,g	350038913900000207,350038913900000207,350038913900000179,350038913900000179,350038913900000180,350038913900000181,350038913900000181	22-44,22-44,22-44,22-44,22-44,22-44,22-44						Anti-microrna oligonucleotide molecules	Tuschl	2006	0		
601	chrIII	2172448	2173135	3500306561	88		2172448	2173135	8421504	4	22,22,22,22	0,410,560,665	c,g	350030656100000206,350030656100000206,350030656100000178,350030656100000178,350030656100000179,350030656100000180	22-44,22-44,22-44,22-44,22-44,22-44						Anti-microRNA oligonucleotide molecules	Landthaler	2011	0		
601	chrIII	2172448	2173135	3500257436	88		2172448	2173135	8421504	4	22,22,22,22	0,410,560,665	c,g	350025743600000206,350025743600000206,350025743600000178,350025743600000179,350025743600000179,350025743600000180,350025743600000180	22-44,22-44,22-44,22-44,22-44,22-44,22-44						Anti-MicroRna Oligonucleotide Molecules	Tuschl	2007	0		
601	chrIII	2172448	2173135	3500232262	88		2172448	2173135	8421504	4	22,22,22,22	0,410,560,665	c,g	350023226200000206,350023226200000206,350023226200000178,350023226200000178,350023226200000179,350023226200000180	22-44,22-44,22-44,22-44,22-44,22-44					Patent	Anti-microRNA oligonucleotide molecules (Patent US:7772389)	Tuschl	2010	0		
601	chrIII	2172448	2172474	3500421940	26		2172448	2172474	8421504	1	26	0	c,g	350042194000000003,350042194000000003	0-26,0-26						ThemicroRNAs of Caenorhabditis elegans	cseweb.ucsd.edu	0	0		
601	chrIII	2172448	2172473	3500185748	25		2172448	2172473	8421504	1	25	0	c,g	350018574800000007,350018574800000007	0-25,0-25		16489184	10.1261/rna.2231506	1355-8382	RNA	Interacting endogenous and exogenous RNAi pathways in Caenorhabditis elegans	LEE	2006	5		
601	chrIII	2173008	2173136	3500011796	47		2173008	2173136	8421504	2	24,23	0,105	c,g	350001179600000027,350001179600000027,350001179600000028,350001179600000028	0-24,0-24,0-23,0-23						Wyman Supplemental Methods	genome.cshlp.org	0	0		
601	chrIII	2173113	2173137	3500356659	24		2173113	2173137	8421504	1	24	0	g	350035665900000005	4-28		21335607	10.1093/nar/gkr077		Nucleic Acids Research	The conformation of microRNA seed regions in native microRNPs is prearranged for presentation to mRNA targets	Nicole	June	0		
602	chrIII	2228544	2228567	3500461816	23		2228544	2228567	8421504	1	23	0	c	350046181600000690,350046181600000062	0-23,20-39						Transgenic plants expressing lepidopteran-active δ-endotoxins	Baum	1997	0		
602	chrIII	2275770	2275796	3500340685	25		2275770	2275796	8421504	2	12,13	0,13	c,g	350034068500000065,350034068500000065	0-34,0-34						新規アデノウイルス及びその測定方法 - 伊藤 典彦	www.patentjp.com	0	0		
602	chrIII	2314752	2316403	3500079579	40		2314752	2316403	8421504	2	20,20	0,1631	c,g	350007957900000004,350007957900000004,350007957900000003,350007957900000003	0-20,0-20,0-20,0-20						Eukaryotic translation initiation factor 5B activity regulates larval growth rate and germline development in Caenorhabditis elegans	biology.syr.edu	0	0		
602	chrIII	2332134	2332203	3500038735	24		2332134	2332203	8421504	2	10,14	0,55	c	350003873500000783	19-43						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
602	chrIII	2334259	2334285	3500308453	23		2334259	2334285	8421504	2	9,14	0,12	c	350030845300000002	0-24						By Clone or Sequence Name - BioInfo (public_page) [12 Sep 2013 22:47:35 ]	cs.nimr.mrc.ac.uk	0	0		
603	chrIII	2371923	2372380	3500210862	23		2371923	2372380	8421504	3	3,12,8	0,436,449	c	350021086200000000	0-23						 Saltatoria | Lugar de coincidencia en Internet | cyclopaedia.net	s.cyclopaedia.net	0	0		
603	chrIII	2385003	2390400	3500190843	41		2385003	2390400	8421504	4	7,3,11,20	0,318,325,5377	c	350019084300000704,350019084300000326	0-21,0-20						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
603	chrIII	2402067	2406246	3500266456	44		2402067	2406246	8421504	2	23,21	0,4158	c,g	350026645600000001,350026645600000003,350026645600000003	0-23,8-29,8-29						Novel anti-nematode therapies targetting STRM-1	Entchev	2011	0		
603	chrIII	2425571	2425601	3500162007	25		2425571	2425601	8421504	3	7,5,13	0,9,17	g	350016200700000007	11-36		15948955	10.1111/j.1365-2958.2005.04688.x	1365-2958	Molecular Microbiology	Mapping of essential replication functions of the linear plasmid lp17 of B. burgdorferi by targeted deletion walking - Beaurepaire - 2005 - Molecular Microbiology - Wiley Online Library	Beaurepaire	2005	0		
603	chrIII	2430993	2431017	3500103185	24		2430993	2431017	8421504	1	24	0	g	350010318500000013	1-25		10022876		0270-7306	Molecular and Cellular Biology	Alterations in the Conserved SL1trans-Spliced Leader of Caenorhabditis elegansDemonstrate Flexibility in Length and Sequence Requirements In Vivo	Ferguson	1999	6		
603	chrIII	2430996	2431019	3500447808	23		2430996	2431019	8421504	1	23	0	g	350044780800000000	19-42						Tyrosine-containing cyclophilin and related methods	Carlow	2000	0		
603	chrIII	2449522	2454774	3500273867	45		2449522	2454774	8421504	3	24,5,16	0,4321,5236	c	350027386700000005,350027386700000004	6-30,9-30						ScienceDirect.com - Biochemical and Biophysical Research Communications - Identification of an estrogenic hormone receptor in Caenorhabditis elegans	sciencedirect.com	0	0		
603	chrIII	2479323	2479351	3500196959	24		2479323	2479351	8421504	2	8,16	0,12	g	350019695900002061	1-25						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
604	chrIII	2530238	2530267	3500357068	24		2530238	2530267	8421504	2	16,8	0,21	c,g	350035706800000040,350035706800000040	0-24,0-24						BASES MOLÉCULAIRES DES DÉFAUTS SÉCRÉTOIRES DES CELLULES β	ai.u-bordeaux1.fr	0	0		
604	chrIII	2546200	2546233	3500223945	27		2546200	2546233	8421504	3	8,3,16	0,11,17	g	350022394500000012	0-27						<Html><Title> Complet list of 2ou2 hssp file Complet list of	cnptia.embrapa.br	0	0		
604	chrIII	2555552	2555577	3500346224	23		2555552	2555577	8421504	2	15,8	0,17	g	350034622400000001	10-33						Gene	005.pasteur.ac.ir	0	0		
604	chrIII	2563068	2563093	3500467331	23		2563068	2563093	8421504	2	18,5	0,20	c	350046733100000463,350046733100000464	5-28,5-28						Untitled Document	ver.niaid.nih.gov	0	0		
604	chrIII	2569594	2598849	3500394181	44		2569594	2598849	8421504	5	13,6,14,4,7	0,15,29220,29239,29248	g	350039418100000445,350039418100000217	23-42,20-45						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
604	chrIII	2573225	2575246	3500020616	786		2573225	2575246	8421504	4	153,121,318,194	0,1272,1451,1827	p	350002061600015022,350002061600015020,350002061600015017,350002061600015015,350002061600015011	0-90,0-165,0-180,0-180,9-180						Similarity	ww.slideshare.net	0	0		
75	chrIII	2593254	2641505	3500252866	44		2593254	2641505	8421504	3	8,16,20	0,10,48231	c	350025286600000074,350025286600000067	18-42,28-48						 Maize PR 	www.docstoc.com	0	0		
75	chrIII	2593254	2641505	3500032197	44		2593254	2641505	8421504	3	8,16,20	0,10,48231	c	350003219700000074,350003219700000067	18-42,28-48						Maize PR-1 gene promoters - US Patent 6429362 Description	ww.patentstorm.us	0	0		
604	chrIII	2619868	2620522	3500061532	40		2619868	2620522	8421504	2	20,20	0,634	c,g	350006153200000004,350006153200000005,350006153200000005	19-39,19-39,19-39					Patent	Use of eukaryotic genes affecting cell cycle control or cell cycle progression for diagnosis and treatment of proliferative diseases (Patent US:7648827)	Echeverri	2010	0		
604	chrIII	2619868	2620522	3500061021	40		2619868	2620522	8421504	2	20,20	0,634	c,g	350006102100000004,350006102100000005,350006102100000005	19-39,19-39,19-39						Use of eukaryotic genes affecting cell cycle control or cell cycle progression for diagnosis and treatment of proliferative diseases	Echeverri	2007	0		
605	chrIII	2622989	2623017	3500197929	26		2622989	2623017	8421504	3	6,8,12	0,7,16	g	350019792900001360	3-29						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
605	chrIII	2686438	2688541	3500257371	50		2686438	2688541	8421504	3	27,2,21	0,492,2082	c,g	350025737100000006,350025737100000005	21-48,0-23		21865588	10.1152/ajpcell.00139.2011		American Journal of Physiology - Cell Physiolog	A calcineurin homologous protein is required for sodium-proton exchange events in the C. elegans intestine	Wagner	2011	0		
75	chrIII	2723960	2772460	3500382122	60		2723960	2772460	8421504	6	13,8,14,6,7,12	0,15,14857,14873,47057,48488	c,g	350038212200001907,350038212200001655,350038212200000487	17-38,11-31,9-28						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
75	chrIII	2729464	2758150	3500315721	40		2729464	2758150	8421504	4	12,8,14,6	0,13,28665,28680	c	350031572100001806,350031572100002045	0-20,13-35						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
605	chrIII	2747149	2747172	3500224843	23		2747149	2747172	8421504	1	23	0	g	350022484300000109	0-23					Patent	Jeux de sondes à VIH utilisées dans des procédés d'hybridation en sandwich à phase en solution (Patent EP:0726962)	Irvine	2006	0		
605	chrIII	2747149	2747172	3500175231	23		2747149	2747172	8421504	1	23	0	g	350017523100000108	0-23					Patent	Sätze von HIV Sonden für Solution Sandwich Hybridationsverfahren (Patent EP:0726962)	Irvine	2006	0		
605	chrIII	2751621	2751650	3500140650	24		2751621	2751650	8421504	2	16,8	0,21	g	350014065000000001	10-34		19174521	10.1073/pnas.0810338106		Proceedings of the National Academy of Sciences of the United States of America	Biosynthesis of the Caenorhabditis elegans dauer pheromone	Rebecca	2009	0		
606	chrIII	2764438	2766158	3500288097	457		2764438	2766158	8421504	2	421,36	0,1684	g	350028809700000000	0-457						次世代ー解析ー - 豆丁网	www.docin.com	0	0		
606	chrIII	2764968	2765001	3500452606	27		2764968	2765001	8421504	3	7,9,11	0,9,22	g	350045260600000129	0-29						BsuisMicroarraySpreadsheet.xls	www.docstoc.com	0	0		
606	chrIII	2782038	2782070	3500125344	25		2782038	2782070	8421504	3	13,6,6	0,18,26	g	350012534400000010	1-26			10.2135/cropsci2010.05.0266	1435-0653	Crop Science	Diallelic Nuclear Microsatellites for Diversity and Population Analyses of the Allotetraploid Creeping Bentgrass ( )	Reichman	2011	0		
606	chrIII	2812358	2812436	3500020680	53		2812358	2812436	8421504	2	26,27	0,51	c,g	350002068000000019,350002068000000018,350002068000000020,350002068000000020,350002068000000021,350002068000000021	20-46,0-26,0-27,0-27,20-47,20-47			10.1042/BJ20060781		Biochemical Journal	A protein extension to shorten RNA: elongated elongation factor-Tu recognizes the D-arm of T-armless tRNAs in nematode mitochondria	Masayuki	2006	0		
606	chrIII	2813605	2813986	3500240460	369		2813605	2813986	8421504	10	57,41,23,97,24,44,16,44,14,9	0,58,100,124,222,247,292,310,357,372	g	350024046000000001	0-370						Mascot_NA_example.axml - psi-pi - PSI Protein Informatics Working Group Repository - Google Project Hosting 	code.google.com	0	0		
606	chrIII	2815094	2815120	3500458978	26		2815094	2815120	8421504	1	26	0	g	350045897800000229	8-34						<Html><Title> Complet list of 1v9n hssp file Complet list of	cnptia.embrapa.br	0	0		
606	chrIII	2857773	2865773	3500157934	8000		2857773	2865773	8421504	1	8000	0	g	350015793400000000	0-8000						>F56F11.4 TTGAATTCAATTAAAACATGCTTTTTTGGGGGTAAAAAGAGCAACAAAAAATTTTTTCAAACTGGGGAAA TCCGTCTTGGGCTCAATTT	vision.ime.usp.br	0	0		
606	chrIII	2874905	2877704	3500461285	40		2874905	2877704	8421504	2	20,20	0,2779	c,g	350046128500000087,350046128500000087,350046128500000001,350046128500000001,350046128500000088,350046128500000088,350046128500000002,350046128500000002	0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20						KRUPPEL-LIKE FACTORS AND FAT REGULATION - Patent application	www.faqs.org	0	0		
607	chrIII	2899953	2899977	3500331688	23		2899953	2899977	8421504	2	10,13	0,11	c	350033168800000003	9-36						プロテインＡのＩｇＧ結合ドメインを含むキメラ・エンベロープタンパ	astamuse.com	0	0		
607	chrIII	2899997	2900031	3500144391	33		2899997	2900031	8421504	2	7,26	0,8	g	350014439100000646	0-37						SPIDER SILK DRAGLINE POLYNUCLEOTIDES, POLYPEPTIDES AND METHODS OF USE THEREOF - Patent application	www.faqs.org	0	0		
607	chrIII	2946038	2946064	3500207123	24		2946038	2946064	8421504	2	8,16	0,10	c	350020712300000002	0-24						常用实验方法_百度文库	wenku.baidu.com	0	0		
607	chrIII	2955461	2955485	3500088013	23		2955461	2955485	8421504	2	16,7	0,17	c	350008801300001373	4-34						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
607	chrIII	2960352	2960376	3500236716	23		2960352	2960376	8421504	2	4,19	0,5	c	350023671600000045	0-23						ETUDE DU ROLE DE GENES CONTROLANT LE CYCLE CELLULAIRE AU COURS DU DEVELOPPEMENT RACINAIRE DE	eo.univ-lille1.fr	0	0		
75	chrIII	2995754	3028799	3500116523	5407		2995754	3028799	8421504	111	51,55,56,55,16,39,55,56,52,56,55,59,55,57,55,54,56,56,55,55,54,57,55,55,55,55,55,56,57,57,57,55,55,56,55,55,55,56,29,27,54,53,57,57,54,4,53,57,57,59,53,52,4,53,56,56,55,33,22,55,26,29,56,55,55,55,57,57,50,58,58,58,58,58,58,58,58,58,118,59,57,59,57,39,19,58,55,28,28,56,13,40,56,54,12,45,55,13,42,38,17,24,32,55,19,36,56,59,54,40,4	0,56,115,176,236,1297,1341,1401,1461,1518,2907,2967,3029,4091,4151,4211,4270,4331,4391,4451,4511,4570,4632,4691,4751,4811,4871,4931,4991,5051,5111,5171,5231,5290,5351,5411,5471,5531,5591,8803,8835,8894,8952,9014,9075,9134,9929,9985,10045,10105,10167,10225,10368,12858,12916,12977,13037,13097,14648,14675,14735,16423,16457,16517,16577,16637,16697,16757,16817,16877,16937,16997,17057,17117,17177,17237,17297,17357,17417,17537,17598,17657,17718,17777,18825,18846,18906,18966,19600,19632,19693,20403,20448,20509,20568,21158,21207,21267,23407,23454,23493,23515,23796,23833,23892,27315,27356,32879,32941,33000,33041	c,g	350011652300000023,350011652300000009,350011652300000009,350011652300000003,350011652300000003,350011652300000016,350011652300000016,350011652300000000,350011652300000000,350011652300000021,350011652300000021,350011652300000020,350011652300000020,350011652300000007,350011652300000007,350011652300000022,350011652300000005,350011652300000005,350011652300000018,350011652300000018,350011652300000015,350011652300000015	0-3490,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-21,0-21,0-21,0-21,12-1929,0-20,0-20,0-20,0-20,0-20,0-20						Therapeutic and diagnostic tools for impaired glucose tolerance conditions - US Patent 7414169 Description	ww.patentstorm.us	0	0		
75	chrIII	2995754	3028799	3500023596	5407		2995754	3028799	8421504	111	51,55,56,55,16,39,55,56,52,56,55,59,55,57,55,54,56,56,55,55,54,57,55,55,55,55,55,56,57,57,57,55,55,56,55,55,55,56,29,27,54,53,57,57,54,4,53,57,57,59,53,52,4,53,56,56,55,33,22,55,26,29,56,55,55,55,57,57,50,58,58,58,58,58,58,58,58,58,118,59,57,59,57,39,19,58,55,28,28,56,13,40,56,54,12,45,55,13,42,38,17,24,32,55,19,36,56,59,54,40,4	0,56,115,176,236,1297,1341,1401,1461,1518,2907,2967,3029,4091,4151,4211,4270,4331,4391,4451,4511,4570,4632,4691,4751,4811,4871,4931,4991,5051,5111,5171,5231,5290,5351,5411,5471,5531,5591,8803,8835,8894,8952,9014,9075,9134,9929,9985,10045,10105,10167,10225,10368,12858,12916,12977,13037,13097,14648,14675,14735,16423,16457,16517,16577,16637,16697,16757,16817,16877,16937,16997,17057,17117,17177,17237,17297,17357,17417,17537,17598,17657,17718,17777,18825,18846,18906,18966,19600,19632,19693,20403,20448,20509,20568,21158,21207,21267,23407,23454,23493,23515,23796,23833,23892,27315,27356,32879,32941,33000,33041	c,g	350002359600000023,350002359600000009,350002359600000009,350002359600000016,350002359600000016,350002359600000003,350002359600000003,350002359600000000,350002359600000000,350002359600000021,350002359600000021,350002359600000007,350002359600000007,350002359600000020,350002359600000020,350002359600000022,350002359600000018,350002359600000018,350002359600000005,350002359600000005,350002359600000015,350002359600000015	0-3490,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-21,0-21,0-21,0-21,12-1929,0-20,0-20,0-20,0-20,0-20,0-20						US Patent # 7,414,169. Therapeutic and diagnostic tools for impaired glucose tolerance conditions - Patents.com	www.patents.com	0	0		
75	chrIII	2995910	3028637	3500276765	4362		2995910	3028637	8421504	34	33,18,117,24,21,120,240,45,90,405,270,45,45,90,96,180,48,1,283,31,34,590,240,336,83,169,106,177,122,15,69,115,97,7	0,78,1141,1393,2743,2809,3933,4218,4488,4623,5073,5388,8661,8751,8886,9773,10049,11305,12691,14492,14571,16267,16905,17193,17577,18669,19444,20247,21002,23251,23314,23640,27159,32720	c,g	350027676500000486,350027676500000484,350027676500000483,350027676500000482,350027676500000482,350027676500000478,350027676500000476,350027676500000475,350027676500000474,350027676500000473,350027676500000472,350027676500000472,350027676500000471,350027676500000471,350027676500000470,350027676500000469,350027676500000467,350027676500000461,350027676500000460,350027676500000460,350027676500000458,350027676500000458,350027676500000457,350027676500000456,350027676500000455,350027676500000455,350027676500000454,350027676500000454,350027676500000453,350027676500000452,350027676500000451,350027676500000451,350027676500000450,350027676500000448,350027676500000448,350027676500000447,350027676500000447,350027676500000446,350027676500000445,350027676500000445,350027676500000444,350027676500000443,350027676500000443,350027676500000441,350027676500000441,350027676500000439,350027676500000439,350027676500000437,350027676500000437,350027676500000436,350027676500000436,350027676500000434,350027676500000433,350027676500000432,350027676500000431,350027676500000431,350027676500000430,350027676500000430,350027676500000429,350027676500000426,350027676500000425,350027676500000424,350027676500000423,350027676500000422,350027676500000422,350027676500000421,350027676500000421,350027676500000420,350027676500000420,350027676500000419,350027676500000417,350027676500000416,350027676500000416,350027676500000415,350027676500000415,350027676500000414,350027676500000414,350027676500000413,350027676500000412,350027676500000412,350027676500000411,350027676500000410,350027676500000410,350027676500000409,350027676500000409,350027676500000408,350027676500000408,350027676500000407,350027676500000407,350027676500000406,350027676500000405,350027676500000405,350027676500000403,350027676500000402,350027676500000402,350027676500000401,350027676500000401,350027676500000400,350027676500000400,350027676500000399,350027676500000397,350027676500000397,350027676500000396,350027676500000396,350027676500000395,350027676500000395,350027676500000394,350027676500000393,350027676500000393,350027676500000392,350027676500000392,350027676500000391,350027676500000389,350027676500000388,350027676500000387,350027676500000386,350027676500000385,350027676500000385,350027676500000384,350027676500000383,350027676500000382,350027676500000381,350027676500000381,350027676500000380,350027676500000379,350027676500000379,350027676500000378,350027676500000377,350027676500000377,350027676500000376,350027676500000374,350027676500000373,350027676500000372,350027676500000371,350027676500000370,350027676500000369	0-33,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-48,0-48,0-48,0-48,0-27,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48						Products and Methods Related to Mono-Methyl Branched-Chain Fatty Acids - Patent application	www.faqs.org	0	0		
607	chrIII	2997141	3013553	3500088581	144		2997141	3013553	8421504	8	21,20,19,5,20,19,20,20	0,2703,3040,3061,3955,4050,15045,16392	c,g	350008858100000007,350008858100000007,350008858100000005,350008858100000005,350008858100000003,350008858100000003,350008858100000009,350008858100000009,350008858100000010,350008858100000004,350008858100000004,350008858100000006,350008858100000001,350008858100000001,350008858100000000,350008858100000000	16-37,16-37,6-27,6-27,0-20,0-20,15-34,15-34,4-27,8-28,8-28,10-29,0-20,0-20,0-20,0-20		22123849	10.1101/sqb.2011.76.010660	0091-7451	Cold Spring Harbor Symposia on Quantitative Biology	The C. elegans DAF-2 Insulin-Like Receptor is Abundantly Expressed in the Nervous System and Regulated by Nutritional Status	Kimura	2011	0		
607	chrIII	2997196	2997228	3500391832	32		2997196	2997228	8421504	1	32	0	c	350039183200000035	49-81						RNAcode: Robust Discrimination of Coding and Noncoding Regions in Comparative Sequence Data	www.santafe.edu	0	0		
607	chrIII	2999884	3001377	3500294144	71		2999884	3001377	8421504	3	20,20,31	0,34,1462	c,g	350029414400000003,350029414400000003,350029414400000001,350029414400000001,350029414400000000,350029414400000000,350029414400000002	0-20,0-20,0-20,0-20,0-20,0-20,0-20						ナショナルバイオリソースプロジェクト (NBRP) C.elegans Mutants	.shigen.nig.ac.jp	0	0		
607	chrIII	3000181	3001342	3500330042	40		3000181	3001342	8421504	2	20,20	0,1141	c,g	350033004200000006,350033004200000006,350033004200000005,350033004200000005	0-20,0-20,0-20,0-20						Clustering of Genetically Defined Allele Classes in the Caenorhabditis elegans DAF-2 Insulin/IGF-1 Receptor--《遗传学杂志》--医学期刊频道--首席医学ߵ	journal.9med.net	0	0		
607	chrIII	3000181	3001342	3500287802	40		3000181	3001342	8421504	2	20,20	0,1141	c,g	350028780200000006,350028780200000006,350028780200000005,350028780200000005	0-20,0-20,0-20,0-20						Clustering of Genetically Defined Allele Classes in the Caenorhabditis elegans DAF-2 Insulin/IGF-1 Receptor	www.genetics.org	0	0		
607	chrIII	3000270	3000554	3500168430	60		3000270	3000554	8421504	3	20,20,20	0,46,264	c,g	350016843000000002,350016843000000004,350016843000000004,350016843000000003	0-20,0-20,0-20,0-20						Role of hydrogen peroxide in the lifespan of C. elegans	uni-greifswald.de	0	0		
607	chrIII	3000977	3013202	3500447355	48		3000977	3013202	8421504	2	24,24	0,12201	c,g	350044735500000006,350044735500000006,350044735500000003,350044735500000003	0-24,0-24,0-24,0-24						Two Pleiotropic Classes of daf-2 Mutation Affect Larval Arrest, Adult Behavior, Reproduction and Longevity in Caenorhabditis elegans	www.genetics.org	0	0		
607	chrIII	3001349	3004629	3500259767	40		3001349	3004629	8421504	2	20,20	0,3260	c,g	350025976700000039,350025976700000039,350025976700000038,350025976700000038	0-20,0-20,0-20,0-20		18828672	10.1371/journal.pbio.0060233		PLoS Biology	Caenorhabditis elegans HCF-1 Functions in Longevity Maintenance as a DAF-16 Regulator	Ji	2008	0		
607	chrIII	3004799	3004831	3500232768	32		3004799	3004831	8421504	1	32	0	g	350023276800000000	7-39						Supporting Online Material	ww.sciencemag.org	0	0		
608	chrIII	3047893	3047917	3500274936	24		3047893	3047917	8421504	1	24	0	g	350027493600000047	12-36						Rice Gene, GS3, Exerting Primary Control Over Grain Length and Grain Weight - Patent application	www.faqs.org	0	0		
608	chrIII	3048034	3048060	3500005213	23		3048034	3048060	8421504	3	5,12,6	0,6,20	g	350000521300000179	5-28						<Html><Title> Complet list of 1a5c hssp file Complet list of	cnptia.embrapa.br	0	0		
608	chrIII	3055395	3055427	3500210353	23		3055395	3055427	8421504	3	11,6,6	0,16,26	g	350021035300000007	9-33						Phylogeny, gene structures, and expression patterns of the ERF gene family in soybean (Glycine max L.). - ResearchGate	.researchgate.net	0	0		
608	chrIII	3067925	3068488	3500386009	40		3067925	3068488	8421504	2	20,20	0,543	g	350038600900000004,350038600900000005	0-20,0-20						Supplemental Data Condensins Regulate Meiotic DNA Break Distribution, thus Crossover Frequency, by Controlling Chromosome Structure	mcb.berkeley.edu	0	0		
608	chrIII	3068350	3068425	3500083444	75		3068350	3068425	8421504	1	75	0	p	350008344400015003	0-75						NMT : CS 221 : test_MP1_s	ww.coursehero.com	0	0		
608	chrIII	3068654	3068690	3500088689	36		3068654	3068690	8421504	1	36	0	c	350008868900000882	8-44						 Galaxy | Dataset | spawned_eel_pituitary_sample29_2.fastq	ain.g2.bx.psu.edu	0	0		
608	chrIII	3078914	3089602	3500261505	41		3078914	3089602	8421504	4	13,9,6,13	0,14,10666,10675	g	350026150500002512,350026150500000096	8-40,20-39						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
608	chrIII	3083493	3089644	3500153784	80		3083493	3089644	8421504	4	20,20,20,20	0,89,5033,6131	c,g	350015378400000010,350015378400000010,350015378400000014,350015378400000014,350015378400000004,350015378400000004,350015378400000005,350015378400000005	0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20			10.1186/2046-2395-2-9	2046-2395	Longevity & Healthspan	The SFT-1 and OXA-1 respiratory chain complex assembly factors influence lifespan by distinct mechanisms in C. elegans	Maxwell	2013	0		
608	chrIII	3101393	3103930	3500194539	1023		3101393	3103930	8421504	5	303,264,214,104,138	0,930,1767,2241,2399	c,g	350019453900000096,350019453900000096	0-1023,0-1023						DIACYLGLYCEROL ACYL TRANSFERASE PROTEINS - Patent application	www.faqs.org	0	0		
608	chrIII	3112956	3112985	3500387859	23		3112956	3112985	8421504	3	12,4,7	0,13,22	c	350038785900000412	0-23						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
608	chrIII	3133946	3134731	3500152738	180		3133946	3134731	8421504	2	171,9	0,776	p	350015273800015042	0-180						Molecular genetic strategies to identify Obsessive-compulsive disorder (OCD) and schizophrenia candidate genes in a South African sub-population group	scholar.sun.ac.za	0	0		
608	chrIII	3135049	3135072	3500183722	23		3135049	3135072	8421504	1	23	0	c	350018372200000349	0-23						Heat Shock Rna From Various Species And Its Use In Activation Of Heat Shock Transcription Factor, In Treatment Of Various Diseases In Animals And In Generation Of Stress-resistant Plants 	.freshpatents.com	0	0		
608	chrIII	3135049	3135072	3500121689	23		3135049	3135072	8421504	1	23	0	c	350012168900000527	0-23						COMPOSITIONS AND METHODS FOR THE SUPPRESSION OF TARGET POLYNUCLEOTIDES - Patent application	www.faqs.org	0	0		
608	chrIII	3135049	3135072	3500068176	23		3135049	3135072	8421504	1	23	0	c	350006817600001030	0-23						COMPOSITIONS AND METHODS FOR THE SUPPRESSION OF TARGET POLYNUCLEOTIDES FROM LEPIDOPTERA - Patent application	www.faqs.org	0	0		
608	chrIII	3142096	3142119	3500389139	23		3142096	3142119	8421504	1	23	0	c,g	350038913900000191,350038913900000191	21-44,21-44						Anti-microrna oligonucleotide molecules	Tuschl	2006	0		
608	chrIII	3142096	3142119	3500306561	23		3142096	3142119	8421504	1	23	0	c,g	350030656100000190,350030656100000190	21-44,21-44						Anti-microRNA oligonucleotide molecules	Landthaler	2011	0		
608	chrIII	3142096	3142119	3500257436	23		3142096	3142119	8421504	1	23	0	g	350025743600000190	21-44						Anti-MicroRna Oligonucleotide Molecules	Tuschl	2007	0		
608	chrIII	3142096	3142119	3500232262	23		3142096	3142119	8421504	1	23	0	c,g	350023226200000190,350023226200000190	21-44,21-44					Patent	Anti-microRNA oligonucleotide molecules (Patent US:7772389)	Tuschl	2010	0		
609	chrIII	3153201	3153289	3500185748	40		3153201	3153289	8421504	2	19,21	0,67	c,g	350018574800000011,350018574800000011,350018574800000012,350018574800000012	0-19,0-19,0-21,0-21		16489184	10.1261/rna.2231506	1355-8382	RNA	Interacting endogenous and exogenous RNAi pathways in Caenorhabditis elegans	LEE	2006	5		
609	chrIII	3153293	3153319	3500213444	26		3153293	3153319	8421504	1	26	0	c,g	350021344400000002,350021344400000002	0-26,0-26		22829772	10.1371/journal.pgen.1002702	1553-7404	PLOS Genetics	PLOS Genetics: Differential Impact of the HEN1 Homolog HENN-1 on 21U and 26G RNAs in the Germline of Caenorhabditis elegans	Kamminga	2012	0		
609	chrIII	3169203	3199491	3500406288	40		3169203	3199491	8421504	4	7,12,13,8	0,12,30265,30280	c,g	350040628800000255,350040628800000109,350040628800000109	16-35,20-41,20-41						Corynebacterium glutamicum genes encoding phosphoenolpyruvate: sugar phosphotransferase system proteins - US Patent 6884614 Description	ww.patentstorm.us	0	0		
609	chrIII	3171203	3171232	3500396481	23		3171203	3171232	8421504	3	5,6,12	0,6,17	g	350039648100002063	7-31						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
609	chrIII	3175975	3176002	3500167682	24		3175975	3176002	8421504	3	13,5,6	0,14,21	g	350016768200000250	11-38						METHODS AND COMPOSITIONS FOR TARGETED POLYNUCLEOTIDE MODIFICATION - Patent application	www.faqs.org	0	0		
609	chrIII	3178384	3178414	3500318229	27		3178384	3178414	8421504	3	12,3,12	0,13,18	c	350031822900000106	0-27						METHODS OF IDENTIFYING AND CREATING RUBISCO LARGE SUBUNIT VARIANTS WITH IMPROVED RUBISCO ACTIVITY, COMPOSITIONS AND METHODS OF USE THEREOF - Patent application	www.faqs.org	0	0		
609	chrIII	3179190	3179213	3500360719	23		3179190	3179213	8421504	1	23	0	c	350036071900000013	13-36						Rath genes and polypeptides and methods for the treatment and diagnosis of immune disorders	Levinson	1997	0		
609	chrIII	3219178	3219202	3500158435	24		3219178	3219202	8421504	1	24	0	g	350015843500000241	19-43						<Html><Title> Complet list of 1ccg hssp file Complet list of	cnptia.embrapa.br	0	0		
609	chrIII	3233824	3233849	3500398582	25		3233824	3233849	8421504	1	25	0	c,g	350039858200002095,350039858200002095,350039858200001642	0-22,0-22,3-22						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
609	chrIII	3269636	3269663	3500015389	24		3269636	3269663	8421504	2	6,18	0,9	g	350001538900000028	1-25						Differentially methylated sequences in pancreatic cancer	Goggins	2005	0		
609	chrIII	3271820	3271848	3500208383	24		3271820	3271848	8421504	3	5,8,11	0,8,17	c	350020838300000005	1-25						somooscaretas - Fotolog	www.fotolog.com	0	0		
610	chrIII	3294178	3294206	3500399634	23		3294178	3294206	8421504	2	12,11	0,17	c	350039963400000211	0-24						Recombinant vesiculoviruses and their uses	Rose	1998	0		
610	chrIII	3294178	3294206	3500278645	23		3294178	3294206	8421504	2	12,11	0,17	c	350027864500000211	0-24						Recombinant vesiculoviruses and their uses		1997	0		
610	chrIII	3307585	3307608	3500176982	23		3307585	3307608	8421504	1	23	0	g	350017698200000018,350017698200000019	9-32,4-27						DNA molecule provides a computing machine with both data and fuel	www.pnas.org	0	0		
610	chrIII	3310656	3310681	3500127877	24		3310656	3310681	8421504	2	6,18	0,7	g	350012787700001375	17-41						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
610	chrIII	3312597	3312788	3500064021	41		3312597	3312788	8421504	3	18,2,21	0,93,170	c,g	350006402100000000,350006402100000001	0-20,0-21						ScienceDirect.com - Developmental Cell - Ras Effector Switching Promotes Divergent Cell Fates in C. elegans Vulval Patterning	sciencedirect.com	0	0		
610	chrIII	3319479	3319507	3500405107	23		3319479	3319507	8421504	2	17,6	0,22	g	350040510700000007	12-35						<Html><Title> Complet list of 1epx hssp file Complet list of	cnptia.embrapa.br	0	0		
610	chrIII	3319479	3319507	3500401199	23		3319479	3319507	8421504	2	17,6	0,22	g	350040119900000107,350040119900000172,350040119900000123,350040119900000093	10-33,7-30,26-49,18-41						<Html><Title> Complet list of 1i1n hssp file Complet list of	cnptia.embrapa.br	0	0		
610	chrIII	3319479	3319507	3500030592	23		3319479	3319507	8421504	2	17,6	0,22	g	350003059200000007,350003059200000037	11-34,2-25						<Html><Title> Complet list of 1slm hssp file Complet list of	cnptia.embrapa.br	0	0		
610	chrIII	3342154	3342178	3500370565	24		3342154	3342178	8421504	1	24	0	g	350037056500000033	24-48						Method of introducing pathogen resistance in plants	Hammond-Kosack	1997	0		
610	chrIII	3344866	3362993	3500446855	4533		3344866	3362993	8421504	26	103,140,128,78,70,177,81,158,125,200,58,72,137,45,161,81,132,125,343,185,907,112,227,387,183,118	0,173,632,1143,1573,1693,2140,2267,2549,2988,3235,5626,10136,10774,11372,11793,12018,12527,13049,13710,14294,15765,15923,16255,16714,18009	c,g	350044685500000004,350044685500000017,350044685500000055,350044685500000056,350044685500000056,350044685500000057,350044685500000057,350044685500000059,350044685500000059,350044685500000061,350044685500000061,350044685500000063,350044685500000063,350044685500000065,350044685500000065,350044685500000067,350044685500000067,350044685500000070,350044685500000069	0-4531,116-502,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-30						Étude de la fonction des Rho GAP au cours du développement embryonnaire du nématode caenorhabditis elegans	.archipel.uqam.ca	0	0		
610	chrIII	3363945	3366704	3500403182	45		3363945	3366704	8421504	2	23,22	0,2737	c,g	350040318200000015,350040318200000015,350040318200000014	14-37,14-37,13-35						Regulation of C elegans presynaptic differentiation and neurite branching via a novel signaling pathway initiated by	ev.biologists.org	0	0		
610	chrIII	3376739	3384188	3500316731	98		3376739	3384188	8421504	3	22,48,28	0,4173,7421	c,g	350031673100000003,350031673100000001,350031673100000000,350031673100000005	0-22,0-32,0-37,0-28		22089131	10.1038/nature10643	0028-0836	Nature	Natural polymorphisms in C. elegans HECW-1 E3 ligase affect pathogen avoidance behaviour	Chang	2011	36		
610	chrIII	3392525	3392548	3500227130	23		3392525	3392548	8421504	1	23	0	g	350022713000000000	21-44		19675126	10.1242/dev.039412	0950-1991	Development	Myosin II regulation during C. elegans embryonic elongation: LET-502/ROCK, MRCK-1 and PAK-1, three kinases with different roles	Gally	2009	7		
610	chrIII	3392525	3392548	3500182316	23		3392525	3392548	8421504	1	23	0	g	350018231600000000	21-44		19675126	10.1242/dev.039412	0950-1991	Development	Myosin II regulation during C. elegans embryonic elongation: LET-502/ROCK, MRCK-1 and PAK-1, three kinases with different roles	Gally	2009	7		
610	chrIII	3393523	3393737	3500264769	96		3393523	3393737	8421504	2	30,66	0,148	p	350026476900015123	36-132						Compositions and methods for treating and diagnosing irritable bowel syndrome	Pasricha	2005	0		
610	chrIII	3400982	3404252	3500291869	3270		3400982	3404252	8421504	1	3270	0	g	350029186900000122,350029186900000121	0-3270,0-3270						COMPOSITIONS AND METHODS FOR GENE EXPRESSION AND CHROMATIN PROFILING OF INDIVIDUAL CELL TYPES WITHIN A TISSUE - Patent application	www.faqs.org	0	0		
610	chrIII	3405413	3405436	3500311218	23		3405413	3405436	8421504	1	23	0	g	350031121800000201	17-40						<Html><Title> Complet list of 1lpb hssp file Complet list of	cnptia.embrapa.br	0	0		
611	chrIII	3411147	3411171	3500405107	23		3411147	3411171	8421504	2	14,9	0,15	c	350040510700000351	0-23						<Html><Title> Complet list of 1epx hssp file Complet list of	cnptia.embrapa.br	0	0		
611	chrIII	3442530	3442555	3500083577	23		3442530	3442555	8421504	2	7,16	0,9	g	350008357700000030	21-44						Cloning and Characterization of Protease Inhibitor from Latex of Rubber Tree (Hevea brasiliensis °“√‚§≈π·≈–»÷°…“ ¡∫ —µ‘¢Õ	anet.gs.kku.ac.th	0	0		
611	chrIII	3452173	3483764	3500082448	30099		3452173	3483764	8421504	2	30060,39	0,31552	p,c,g	350008244800000001,350008244800015000,350008244800000000,350008244800000000	0-30060,0-150,0-39,0-39						NCBI GenBank | Z46996 | Caenorhabditis elegans Cosmid C34C12, complete sequence.	metalife.com	0	0		
611	chrIII	3463965	3463994	3500003185	26		3463965	3463994	8421504	3	17,4,5	0,18,24	g	350000318500000047	0-26						Anti-bacterial methods and materials	Holden	2000	0		
611	chrIII	3502989	3503210	3500139202	40		3502989	3503210	8421504	2	20,20	0,201	c,g	350013920200000013,350013920200000013,350013920200000012,350013920200000012	0-20,0-20,0-20,0-20						Caenorhabditis elegans stress related gene responses to selected pesticides.	.nottingham.ac.uk	0	0		
76	chrIII	3537891	3541877	3500276476	3634		3537891	3541877	8421504	46	58,320,12,104,122,92,84,33,10,36,9,103,106,6,34,17,40,93,11,559,153,279,19,93,88,26,64,79,114,44,148,12,150,4,19,10,271,29,9,10,28,28,14,19,53,22	0,59,388,421,526,659,752,837,871,882,919,929,1033,1140,1147,1182,1202,1243,1337,1379,1947,2152,2491,2511,2605,2694,2721,2786,2866,2981,3062,3211,3224,3376,3381,3401,3484,3756,3787,3798,3810,3841,3870,3887,3908,3964	p,c,g	350027647600000034,350027647600000033,350027647600015032,350027647600000032,350027647600000031,350027647600000031,350027647600000030,350027647600000029,350027647600000028,350027647600000028,350027647600015030,350027647600000027,350027647600000026,350027647600015017,350027647600000025,350027647600015029,350027647600000024,350027647600000024,350027647600015015,350027647600000023,350027647600000022,350027647600000022,350027647600000021,350027647600000017,350027647600000017,350027647600000016,350027647600000015,350027647600015027,350027647600000014,350027647600000013,350027647600000013,350027647600000012,350027647600000012,350027647600000011,350027647600000011,350027647600000010,350027647600000008,350027647600015025,350027647600000006,350027647600000005,350027647600000005,350027647600000004,350027647600000004,350027647600000003	0-390,0-45,0-72,1-60,0-60,0-60,25-762,0-67,0-48,0-48,0-174,0-48,0-48,0-48,0-48,0-180,0-48,0-48,0-48,0-48,0-60,0-60,0-72,0-51,0-51,0-60,22-66,0-174,0-41,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-870,0-93,0-70,0-60,0-60,0-60,0-60,2-297						Genetic and Molecular Analysis of a Caenorhabditis elegans / -Tubulin That Conveys Benzimidazole Sensitivity	jcb.rupress.org	0	0		
611	chrIII	3538329	3538354	3500341764	25		3538329	3538354	8421504	1	25	0	c	350034176400000140	13-38						US Patent # 6,337,192. MMSC1-an MMAC1 interacting protein - Patents.com	www.patents.com	0	0		
76	chrIII	3538387	3540355	3500229748	621		3538387	3540355	8421504	6	101,13,93,108,12,294	0,910,926,1496,1656,1674	p	350022974800015006,350022974800015005,350022974800015002,350022974800015001	0-114,0-93,0-207,0-210						mec-7 production of 15-protofilament microtubules in Caenorhabditis elegans	enesdev.cshlp.org	0	0		
76	chrIII	3538411	3539694	3500318788	121		3538411	3539694	8421504	4	36,21,32,32	0,1076,1131,1251	c,g	350031878800000543,350031878800000554,350031878800000331,350031878800000615,350031878800000367,350031878800000553,350031878800000303,350031878800000612,350031878800000353,350031878800000353,350031878800000385,350031878800000486,350031878800000302,350031878800000326,350031878800000332,350031878800000339,350031878800000338,350031878800000564,350031878800000466,350031878800000423,350031878800000347,350031878800000544,350031878800000356,350031878800000335,350031878800000348,350031878800000337,350031878800000590,350031878800000549,350031878800000355,350031878800000336	0-21,0-23,0-26,0-26,0-32,0-32,0-23,0-26,0-21,0-21,0-26,0-23,0-29,0-28,0-30,0-32,0-32,0-21,6-38,6-38,0-25,0-26,6-35,0-21,1-30,0-27,0-26,0-21,6-31,0-24						Nematode Control 	.freshpatents.com	0	0		
76	chrIII	3538411	3539574	3500259202	53		3538411	3539574	8421504	2	21,32	0,1131	c	350025920200000605,350025920200000512,350025920200000435,350025920200000548	0-21,0-29,0-26,0-23						Nematode Control	Craen	2010	0		
612	chrIII	3539670	3543270	3500239726	42		3539670	3543270	8421504	2	21,21	0,3579	c,g	350023972600000000,350023972600000001	0-21,19-40						Single/low-copy integration of transgenes in Caenorhabditis elegans using an ultraviolet trimethylpsoralen method	biomedcentral.com	0	0		
612	chrIII	3539721	3540190	3500392330	360		3539721	3540190	8421504	3	50,163,147	0,107,322	p	350039233000015036,350039233000015026	0-180,0-180						Planaria EST Database	an.bio.keio.ac.jp	0	0		
612	chrIII	3539733	3539856	3500311730	66		3539733	3539856	8421504	2	38,28	0,95	p	350031173000015058	9-75						The Lewisx glycan in mice	ie.uni-hamburg.de	0	0		
612	chrIII	3540205	3541580	3500262958	360		3540205	3541580	8421504	2	194,166	0,1209	p	350026295800015006,350026295800015003	0-180,0-180						Expressed sequence tags: analysis and annotation	istry.utoronto.ca	0	0		
612	chrIII	3540334	3540379	3500137241	45		3540334	3540379	8421504	1	45	0	p	350013724100015064	0-45						Improved cancer therapeutics	Lewensohn	2009	0		TUBB8
612	chrIII	3540385	3541580	3500257192	180		3540385	3541580	8421504	2	14,166	0,1029	p	350025719200015003	0-180						Expressed sequence tags: analysis and annotation	compsysbio.org	0	0		
612	chrIII	3541441	3541492	3500400870	51		3541441	3541492	8421504	1	51	0	c,g	350040087000000111,350040087000000111	0-51,0-51						Novel DNA-binding proteins and uses thereof - Patent application	www.faqs.org	0	0		
612	chrIII	3541441	3541492	3500294657	51		3541441	3541492	8421504	1	51	0	c,g	350029465700000116,350029465700000116	0-51,0-51						Novel DNA-binding proteins and uses thereof	Gregory	2011	0		
612	chrIII	3541450	3579738	3500121931	80		3541450	3579738	8421504	4	40,20,13,7	0,341,38264,38281	c,g	350012193100000012,350012193100000012,350012193100000018,350012193100000018,350012193100000007,350012193100000017,350012193100000015	0-40,0-40,0-39,0-39,0-20,0-20,0-20						Supporting Online Material for	mcb.berkeley.edu	0	0		
612	chrIII	3541555	3541580	3500278120	25		3541555	3541580	8421504	1	25	0	c	350027812000000050	10-35						Methods of constructing biodiverse gene fragment libraries and biological modulators isolated therefrom	Watt	2004	0		
612	chrIII	3541555	3541580	3500218609	25		3541555	3541580	8421504	1	25	0	c	350021860900000050	10-35						Methods of construction biodiverse gene fragment libraries	Hopkins	2010	0		
612	chrIII	3541555	3541580	3500202317	25		3541555	3541580	8421504	1	25	0	c	350020231700000050	10-35						Methods of constructing biodiverse gene fragment libraries and biological modulators isolated therefrom	Hopkins	2004	0		
612	chrIII	3541555	3541580	3500151190	25		3541555	3541580	8421504	1	25	0	c	350015119000000050	10-35						Methods of constructing biodiverse gene fragment libraries and biological modulators isolated therefrom	Watt	2004	0		
612	chrIII	3556854	3556884	3500325166	23		3556854	3556884	8421504	3	6,12,5	0,10,25	g	350032516600000338	23-46						<Html><Title> Complet list of 4ccx hssp file Complet list of	cnptia.embrapa.br	0	0		
612	chrIII	3576423	3577879	3500416104	64		3576423	3577879	8421504	3	21,19,24	0,1277,1432	c,g	350041610400000008,350041610400000008,350041610400000006,350041610400000006,350041610400000007	3-24,3-24,3-22,3-22,0-24		10022975	10.1101/gr.9.2.103	1088-9051	Genome Research	The Nuclear Receptor Superfamily Has Undergone Extensive Proliferation and Diversification in Nematodes	Sluder	1999	14		
612	chrIII	3608340	3608365	3500452501	23		3608340	3608365	8421504	2	7,16	0,9	c	350045250100000361	0-23						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
612	chrIII	3611500	3624720	3500043919	215		3611500	3624720	8421504	8	30,28,24,23,31,24,28,27	0,106,4035,5443,6889,6981,13147,13193	c,g	350004391900000004,350004391900000004,350004391900000007,350004391900000000,350004391900000000,350004391900000001,350004391900000001,350004391900000002,350004391900000005,350004391900000005,350004391900000006,350004391900000003	0-30,0-30,0-28,0-24,0-24,0-23,0-23,0-31,0-24,0-24,0-28,0-27					Proceedings of the National Academy of Sciences of the United States of America	SEL-8, a nuclear protein required for LIN-12 and GLP-1 signaling in Caenorhabditis elegans	Timothy	July	0		
612	chrIII	3644665	3647771	3500345010	269		3644665	3647771	8421504	8	37,13,14,32,35,34,51,53	0,162,177,566,1551,1641,1915,3053	c,g	350034501000000017,350034501000000017,350034501000000026,350034501000000024,350034501000000025,350034501000000025,350034501000000000,350034501000000027,350034501000000001	0-84,0-84,4-36,5-40,6-40,6-40,0-51,3-36,0-53						Identificationofgenes thatprotectthe C. elegans genomeagainstmutations bygenome-wideRNAi	enesdev.cshlp.org	0	0		
612	chrIII	3651529	3651725	3500458479	40		3651529	3651725	8421504	2	20,20	0,176	c,g	350045847900000004,350045847900000004,350045847900000005,350045847900000005	0-20,0-20,0-20,0-20		23936512	10.1371/journal.pone.0071525		PLoS ONE	Deletion of Thioredoxin Reductase and Effects of Selenite and Selenate Toxicity in Caenorhabditis elegans	Christopher	2013	0		
613	chrIII	3699833	3701437	3500078828	1458		3699833	3701437	8421504	4	177,807,384,90	0,227,1084,1514	c	350007882800000007	0-1458						Methods For Enhancing A Secretion Efficiency Of Recombinant Foreign Protein In Yeast Expression System - Patent application	www.faqs.org	0	0		
613	chrIII	3704661	3704685	3500294850	23		3704661	3704685	8421504	2	5,18	0,6	c	350029485000000008	13-36						Research Journal of Pharmaceutical, Biological and Chemical Sciences	www.rjpbcs.com	0	0		
613	chrIII	3711152	3711221	3500338133	69		3711152	3711221	8421504	1	69	0	p	350033813300015006	0-69						UNIVERSITETET I OSLO	www.fuimbv.com	0	0		
613	chrIII	3743168	3778144	3500304073	42		3743168	3778144	8421504	3	8,13,21	0,12,34955	g	350030407300000432,350030407300000115	20-41,12-33						<Html><Title> Complet list of 2abm hssp file Complet list of	cnptia.embrapa.br	0	0		
613	chrIII	3768966	3769199	3500365620	177		3768966	3769199	8421504	3	54,34,89	0,60,144	p	350036562000015010,350036562000015011,350036562000015025	0-54,0-54,15-84						Splice variants of nuclear dot protein Sp100	cs.biologists.org	0	0		
613	chrIII	3784845	3784872	3500281934	27		3784845	3784872	8421504	1	27	0	c	350028193400000301	0-27						X1 ATACACACACACAC X2 GAAAAAAAAAAAAAAA X3 TATATATATATGT X4 AAAAAAAAAAAAAAAAAAAAAAAAAAAA X5 CTATCTATCT	www.ucl.ac.uk	0	0		
613	chrIII	3784845	3784872	3500102959	27		3784845	3784872	8421504	1	27	0	c	350010295900000301	0-27						X1 ATACACACACACAC X2 GAAAAAAAAAAAAAAA X3 TATATATATATGT X4 AAAAAAAAAAAAAAAAAAAAAAAAAAAA X5 CTATCTATCT	www.ucl.ac.uk	0	0		CD276
614	chrIII	3805798	3805823	3500256501	25		3805798	3805823	8421504	1	25	0	g	350025650100000003	2-47		21068836	10.1038/nature09553		Nature	Genetic dissection of an amygdala microcircuit that gates conditioned fear	Wulf	2010	0		
614	chrIII	3814060	3825757	3500136159	80		3814060	3825757	8421504	4	20,20,20,20	0,210,11500,11677	c,g	350013615900000015,350013615900000015,350013615900000014,350013615900000014,350013615900000018,350013615900000018,350013615900000019,350013615900000019	0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20						Supporting Information	www.pnas.org	0	0		
614	chrIII	3829365	3829391	3500370565	24		3829365	3829391	8421504	2	7,17	0,9	g	350037056500000044	7-38						Method of introducing pathogen resistance in plants	Hammond-Kosack	1997	0		
614	chrIII	3839305	3839330	3500352303	23		3839305	3839330	8421504	2	18,5	0,20	c	350035230300000607	1-25						Anti-bacterial methods and materials	Holden	2000	0		
614	chrIII	3843085	3843401	3500137430	40		3843085	3843401	8421504	2	20,20	0,296	c,g	350013743000000019,350013743000000019,350013743000000018,350013743000000018	0-20,0-20,0-20,0-20						Targeted gene deletions in C. elegans using transposon excision	logylabs.utah.edu	0	0		
614	chrIII	3845035	3859157	3500329235	40		3845035	3859157	8421504	4	16,5,13,6	0,19,14100,14116	c,g	350032923500000693,350032923500000693,350032923500001637	21-42,21-42,5-24						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
614	chrIII	3851835	3851861	3500443479	24		3851835	3851861	8421504	3	13,6,5	0,14,21	g	350044347900000002	7-33		22809629	10.1091/mbc.E12-05-0392	1059-1524	Molecular Biology of the Cell	Ndm, a coiled-coil domain protein that suppresses macropinocytosis and has effects on cell migration	Kelsey	2012	5		
614	chrIII	3867969	3868885	3500172658	114		3867969	3868885	8421504	2	54,60	0,856	p	350017265800015073,350017265800015093,350017265800015083,350017265800015103	6-60,6-60,0-60,0-60						Virus-resistant transgenic plants expressing L3	Tumer	2003	0		
614	chrIII	3870214	3871276	3500437709	42		3870214	3871276	8421504	2	20,22	0,1040	c,g	350043770900000006,350043770900000006,350043770900000005,350043770900000005	0-20,0-20,0-22,0-22		22577361	10.1371/journal.ppat.1002673	1553-7374	PLOS Pathogens	PLOS Pathogens: A Role for SKN-1/Nrf in Pathogen Resistance and Immunosenescence in Caenorhabditis elegans	Papp	2012	0		
614	chrIII	3870214	3871276	3500425078	42		3870214	3871276	8421504	2	20,22	0,1040	c,g	350042507800000006,350042507800000006,350042507800000005,350042507800000005	0-20,0-20,0-22,0-22						A Role for SKN-1/Nrf in Pathogen Resistance and Immunosenescence in Caenorhabditis elegans	roup.linkgroup.hu	0	0		
614	chrIII	3870214	3871276	3500420842	42		3870214	3871276	8421504	2	20,22	0,1040	c,g	350042084200000006,350042084200000006,350042084200000005,350042084200000005	0-20,0-20,0-22,0-22						A Role for SKN-1/Nrf in Pathogen Resistance and Immunosenescence in Caenorhabditis elegans	ww.bio-science.hu	0	0		
614	chrIII	3871000	3871029	3500413391	24		3871000	3871029	8421504	3	13,4,7	0,17,22	c	350041339100000503	22-46							.cottonmarker.org	0	0		
614	chrIII	3906251	3906296	3500158230	45		3906251	3906296	8421504	1	45	0	p	350015823000015013	0-45						MICROBIOLOGICAL PRODUCTION OF 3-HYDROXYISOBUTYRIC ACID - Patent application	www.faqs.org	0	0		
614	chrIII	3908908	3914109	3500147680	2636		3908908	3914109	8421504	28	34,7,25,12,31,15,33,42,15,8,21,60,13,11,96,78,71,6,98,488,326,409,90,273,119,78,123,54	0,35,43,71,84,116,162,196,239,257,266,288,349,363,376,525,629,703,714,1245,2292,3213,3734,3853,4743,4870,5003,5147	p,c,g	350014768000000035,350014768000000034,350014768000000033,350014768000015000,350014768000015026,350014768000000032,350014768000000030,350014768000015022,350014768000015021,350014768000000026,350014768000000026,350014768000015020,350014768000000025,350014768000000025,350014768000015019,350014768000000024,350014768000000024,350014768000015018,350014768000000023,350014768000015017,350014768000000022,350014768000015016,350014768000000021,350014768000000021,350014768000015015,350014768000000019,350014768000000019,350014768000015014,350014768000015012,350014768000015011,350014768000000014,350014768000000014,350014768000015010,350014768000000013,350014768000000013,350014768000015009,350014768000000012,350014768000000012,350014768000015007,350014768000000010,350014768000000008,350014768000000008,350014768000015006,350014768000000007,350014768000000006,350014768000000006,350014768000015005,350014768000000005,350014768000015004,350014768000000003,350014768000000003,350014768000015003,350014768000000002,350014768000000002,350014768000015002,350014768000015001	0-125,0-172,0-103,3-84,0-105,0-19,0-77,0-99,0-105,0-86,0-86,0-105,0-101,0-101,0-105,0-87,0-87,0-105,0-75,0-105,0-73,0-105,0-97,0-97,0-105,0-105,0-105,0-78,0-93,0-105,0-101,0-101,0-105,0-105,0-105,0-78,0-103,0-103,0-90,0-42,0-77,0-77,0-105,0-39,0-20,0-20,0-105,0-60,0-105,0-105,0-105,0-96,0-63,0-63,0-105,0-54						Characterization of/3pat-3 Heterodimers, a Family of Essential Integrin Receptors in C. elegans	jcb.rupress.org	0	0		
614	chrIII	3909308	3913708	3500275294	89		3909308	3913708	8421504	4	27,22,20,20	0,388,3681,4380	c,g	350027529400000003,350027529400000002,350027529400000002,350027529400000009,350027529400000009,350027529400000008	0-27,0-22,0-22,0-20,0-20,0-20			10.1242/jcs.00705	0021-9533	Journal of Cell Science	Talin loss-of-function uncovers roles in cell contractility and migration in C. elegans	Cram	2003	6		
614	chrIII	3911188	3911216	3500367251	23		3911188	3911216	8421504	2	12,11	0,17	g	350036725100001030	0-23						<HTML> <TITLE>BLAST Search Results  BLAST Search Results  BLAST Search Results  BLAST Search Results  Complet list of 3igz hssp file Complet list of	cnptia.embrapa.br	0	0		
615	chrIII	4003238	4003261	3500370449	23		4003238	4003261	8421504	1	23	0	c	350037044900000865	0-23						BLASTN 2.0.11 [Jan-20-2000] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaff	ath.lsa.umich.edu	0	0		
615	chrIII	4003238	4003261	3500161291	23		4003238	4003261	8421504	1	23	0	g	350016129100000865	0-23						BLASTN output - BioPerl	www.bioperl.org	0	0		
615	chrIII	4008103	4008189	3500026001	26		4008103	4008189	8421504	3	5,15,6	0,7,80	c	350002600100000314	3-30						US Patent # 6,887,988. Plant reproduction polynucleotides and methods of use - Patents.com	www.patents.com	0	0		
615	chrIII	4016047	4017334	3500276476	99		4016047	4017334	8421504	2	51,48	0,1239	p,c	350027647600015033,350027647600000009	0-51,12-60						Genetic and Molecular Analysis of a Caenorhabditis elegans / -Tubulin That Conveys Benzimidazole Sensitivity	jcb.rupress.org	0	0		
615	chrIII	4016658	4017553	3500223400	895		4016658	4017553	8421504	1	895	0	g	350022340000000015	0-895						pmk-1 | P38 Map Kinase family | genotype ID: 23190906 @ PhenomicDB	www.phenomicdb.de	0	0		
615	chrIII	4017190	4018001	3500355095	42		4017190	4018001	8421504	2	22,20	0,791	c,g	350035509500000003,350035509500000003,350035509500000002	0-22,0-22,0-20		20300184	10.1371/journal.pone.0009655		PLoS ONE	Motor Neuron Synapse and Axon Defects in a C. elegans Alpha-Tubulin Mutant	Renee	2010	0		
615	chrIII	4017190	4018001	3500351463	42		4017190	4018001	8421504	2	22,20	0,791	c,g	350035146300000003,350035146300000003,350035146300000002	0-22,0-22,0-20		20300184	10.1371/journal.pone.0009655	1932-6203	PLOS ONE	PLOS ONE: Motor Neuron Synapse and Axon Defects in a C. elegans Alpha-Tubulin Mutant	Baran	2010	4		
615	chrIII	4033753	4052372	3500285664	40		4033753	4052372	8421504	4	5,14,9,12	0,7,18595,18607	c,g	350028566400000109,350028566400000113	8-27,24-45						Herbicide-Resistant Plants, And Polynucleotides And Methods For Providing Same - Patent application	www.faqs.org	0	0		
615	chrIII	4057377	4057404	3500229353	26		4057377	4057404	8421504	2	21,5	0,22	g	350022935300000026	0-39						Regulating metabolism by modifying level of trehalose-6-phosphate	O*J*M*Ge Di Jin 	1999	0		
616	chrIII	4078649	4078674	3500299882	23		4078649	4078674	8421504	2	14,9	0,16	c	350029988200000000	11-38						Identification of Erythroxylum taxa by AFLP DNA analysis	ddr.nal.usda.gov	0	0		
616	chrIII	4115556	4115581	3500169378	23		4115556	4115581	8421504	2	7,16	0,9	g	350016937800000044	0-23						UNTERSUCHUNG DER INFORMATIVITÄT NEUER MIKROSATELLITENLOCI BEIM KAMEL	.uni-hohenheim.de	0	0		
616	chrIII	4140661	4144860	3500092739	132		4140661	4144860	8421504	4	60,30,20,22	0,290,3426,4177	c,g	350009273900000011,350009273900000010,350009273900000013,350009273900000014,350009273900000014,350009273900000015	0-29,0-31,0-30,0-20,0-20,0-22		22174070	10.1534/genetics.111.137455		Genetics	Cell Excitability Necessary for Male Mating Behavior in Caenorhabditis elegans Is Coordinated by Interactions Between Big Current and Ether-A-Go-Go Family K+ Channels	Brigitte	2012	0		
616	chrIII	4159510	4159535	3500120987	23		4159510	4159535	8421504	3	12,7,4	0,13,21	g	350012098700000118	10-33						MOLECULAR ANALYSIS OF VIBRIO VULNIFICUS PHASE VARIANTS AND CHARACTERIZATION OF A NEW BIOFILM-PROFICIENT RUGOSE PHENOTYPE	etd.lsu.edu	0	0		
616	chrIII	4164519	4164542	3500117533	23		4164519	4164542	8421504	1	23	0	c,g	350011753300000001,350011753300000001	0-23,0-23		12861019	10.1128/MCB.23.15.5331-5345.2003	0270-7306	Molecular and Cellular Biology	RNF5, a RING Finger Protein That Regulates Cell Motility by Targeting Paxillin Ubiquitination and Altered Localization	Didier	2003	6		
9	chrIII	4167321	4203711	3500254418	39		4167321	4203711	8421504	4	13,6,11,9	0,14,36369,36381	c,g	350025441800000043,350025441800000031,350025441800000019,350025441800000510	15-34,15-34,15-34,23-43						Lipid Formulated Compositions and Methods for Inhibiting Expression of a Gene from the Ebola Virus	Fougerolles	2010	0		
616	chrIII	4173309	4173333	3500241007	23		4173309	4173333	8421504	2	15,8	0,16	c,g	350024100700002889,350024100700002889	0-34,0-34						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
616	chrIII	4177611	4177635	3500127578	24		4177611	4177635	8421504	1	24	0	g	350012757800000212	8-32						<Html><Title> Complet list of 3d9c hssp file Complet list of	cnptia.embrapa.br	0	0		
616	chrIII	4183645	4183674	3500211468	24		4183645	4183674	8421504	2	10,14	0,15	g	350021146800000047	10-34						Insect-specific paralytic neurotoxin genes for use in biological insect control: methods and compositions	Tomalski	1990	0		
616	chrIII	4183959	4183983	3500003185	23		4183959	4183983	8421504	2	14,9	0,15	c	350000318500000495	11-35						Anti-bacterial methods and materials	Holden	2000	0		
616	chrIII	4185353	4185398	3500447877	45		4185353	4185398	8421504	1	45	0	p	350044787700015132	0-45						BORON-CONTAINING SMALL MOLECULES - Patent application	www.faqs.org	0	0		
616	chrIII	4185353	4185398	3500374501	45		4185353	4185398	8421504	1	45	0	p	350037450100015132	0-45						BORON-CONTAINING SMALL MOLECULES - Patent application	www.faqs.org	0	0		
9	chrIII	4194104	4194380	3500422359	44		4194104	4194380	8421504	2	23,21	0,255	c,g	350042235900000000,350042235900000000,350042235900000002,350042235900000002	0-23,0-23,0-21,0-21						>gi|32564853|ref|NM_181924	.buffalostate.edu	0	0		
617	chrIII	4194425	4194659	3500246874	50		4194425	4194659	8421504	2	26,24	0,210	c,g	350024687400000000,350024687400000000,350024687400000001,350024687400000001	0-26,0-26,0-24,0-24						Supporting Information	www.pnas.org	0	0		
617	chrIII	4194426	4194559	3500268702	42		4194426	4194559	8421504	3	21,11,10	0,89,123	c,g	350026870200000002,350026870200000002,350026870200000003	0-21,0-21,0-21		20011506	10.1371/journal.ppat.1000689		PLoS Pathogens	Hypoxia and the Hypoxic Response Pathway Protect against Pore-Forming Toxins in C. elegans	Audrey	2009	0		
617	chrIII	4194449	4194698	3500189696	41		4194449	4194698	8421504	2	21,20	0,229	c,g	350018969600000000,350018969600000000,350018969600000001,350018969600000001	0-21,0-21,0-20,0-20		24068943	10.1371/journal.pgen.1003714		PLoS Genetics	A Shift to Organismal Stress Resistance in Programmed Cell Death Mutants	Meredith	2013	0		
617	chrIII	4194498	4194579	3500387183	42		4194498	4194579	8421504	2	19,23	0,58	c,g	350038718300000004,350038718300000004,350038718300000005,350038718300000005	0-19,0-19,0-23,0-23		20733002	10.1128/MCB.00922-10	0270-7306	Molecular and Cellular Biology	Protein Misfolding Induces Hypoxic Preconditioning via a Subset of the Unfolded Protein Response Machinery	Mao	2010	6		
617	chrIII	4194513	4194902	3500331115	45		4194513	4194902	8421504	3	13,12,20	0,36,369	c,g	350033111500000000,350033111500000001,350033111500000001	0-25,0-20,0-20						IRE-1 and HSP-4 Contribute to Energy Homeostasis via Fasting-Induced Lipases in C. elegans	download.cell.com	0	0		
617	chrIII	4194513	4194563	3500068944	50		4194513	4194563	8421504	1	50	0	c,g	350006894400000045,350006894400000044,350006894400000046	0-25,0-48,0-50						Novel Genes, Compositions, and Methods for Modulating the Unfolded Protein Response - Patent application	www.faqs.org	0	0		
617	chrIII	4195003	4195026	3500038099	23		4195003	4195026	8421504	1	23	0	c	350003809900000021	2-25						Fatty Acid Hydroxylases and Uses Thereof - Patent application	www.faqs.org	0	0		
617	chrIII	4216736	4227941	3500123215	1796		4216736	4227941	8421504	24	37,31,18,73,43,14,65,7,29,45,338,36,100,289,27,191,84,56,127,26,32,69,11,48	0,38,70,89,163,207,222,288,296,330,376,715,752,1317,1607,1635,1833,2314,2424,2701,2728,2811,11145,11157	p,c,g	350012321500000021,350012321500000020,350012321500000019,350012321500000019,350012321500000018,350012321500000017,350012321500000017,350012321500015007,350012321500000016,350012321500000015,350012321500000015,350012321500015006,350012321500000007,350012321500000014,350012321500000013,350012321500000013,350012321500015005,350012321500015004,350012321500000012,350012321500000011,350012321500000011,350012321500000010,350012321500000010,350012321500000009,350012321500000009,350012321500015022,350012321500000008,350012321500000008,350012321500015001,350012321500000006,350012321500000006,350012321500000005,350012321500000004,350012321500000004,350012321500000003,350012321500000003,350012321500000002,350012321500015000,350012321500000001,350012321500000001,350012321500000000,350012321500000000	0-568,0-60,0-60,0-60,0-58,0-60,0-60,0-300,0-58,0-60,0-60,0-300,2-56,0-55,0-58,0-58,0-60,0-60,0-59,0-58,0-58,0-60,0-60,0-60,0-60,0-60,0-59,0-59,180-1167,0-59,0-59,0-56,0-59,0-59,0-58,0-58,0-56,180-459,18-59,18-59,0-59,0-59						A MAP kinase homolog, mpk-1, is involved in rfls-mediated induction of vulval cell fates in Caenorhabditis elegans	enesdev.cshlp.org	0	0		
617	chrIII	4218370	4218418	3500210212	48		4218370	4218418	8421504	1	48	0	p	350021021200015002	0-48						Specific oligobodies against ERK-2 that recognize both the native and the denatured state of the protein. - ResearchGate	.researchgate.net	0	0		MAPK1
617	chrIII	4230635	4232546	3500416104	43		4230635	4232546	8421504	2	21,22	0,1889	c,g	350041610400000016,350041610400000016,350041610400000017,350041610400000017	0-21,0-21,0-22,0-22		10022975	10.1101/gr.9.2.103	1088-9051	Genome Research	The Nuclear Receptor Superfamily Has Undergone Extensive Proliferation and Diversification in Nematodes	Sluder	1999	14		
617	chrIII	4262197	4296662	3500304073	44		4262197	4296662	8421504	3	11,14,19	0,12,34446	c,g	350030407300000183,350030407300000303	8-33,0-19						<Html><Title> Complet list of 2abm hssp file Complet list of	cnptia.embrapa.br	0	0		
617	chrIII	4266641	4267275	3500272551	120		4266641	4267275	8421504	4	55,5,23,37	0,459,524,597	p	350027255100015031,350027255100015029	0-60,0-60						Mus musculus splicing factor 3b, subunit 1 (Sf3b1), mRNA. , NM_031179.1 - GenScript	www.genscript.com	0	0		
617	chrIII	4278696	4281312	3500270920	167		4278696	4281312	8421504	4	69,39,28,31	0,210,507,2585	p,c,g	350027092000015016,350027092000015013,350027092000000001,350027092000000000	0-51,0-57,31-59,28-59						Somatic sex determination in Caenorhabditis elegans is modulated by SUP-26 repression of tra-2 translation	mcdb.colorado.edu	0	0		
617	chrIII	4279121	4279210	3500027162	50		4279121	4279210	8421504	4	8,15,4,23	0,29,59,66	c	350002716200000067	10-60						<!DOCTYPE HTML PUBLIC A-//IETF//DTD HTML 3.0//ENA> <!- SPECIFICATION OF LANGUAGE-> <HTML> 	wheat.pw.usda.gov	0	0		
617	chrIII	4291659	4293230	3500213647	738		4291659	4293230	8421504	6	126,206,199,93,78,36	0,171,425,927,1067,1535	p	350021364700015010,350021364700015007	0-768,597-2799						oxidative Base pyrimidineDNA Saccharomyces DNA Escherichia III	www.pnas.org	0	0		
617	chrIII	4315294	4316499	3500361572	70		4315294	4316499	8421504	3	32,19,19	0,1125,1186	c,g	350036157200000016,350036157200000016,350036157200000004,350036157200000004,350036157200000014,350036157200000014,350036157200000017,350036157200000017,350036157200000005,350036157200000005,350036157200000015,350036157200000003	0-19,0-19,0-19,0-19,0-19,0-19,0-19,0-19,0-19,0-19,0-19,0-19						EUKARYOTIC CELL DIVISION GENES AND THEIR USE IN DIAGNOSIS AND TREATMENT OF PROLIFERATIVE DISEASES	Echeverri	2001	0		
77	chrIII	4324774	4327914	3500461794	1623		4324774	4327914	8421504	10	42,123,150,108,96,500,144,268,66,126	0,237,404,733,1357,1497,2180,2500,2901,3014	p	350046179400015062,350046179400015050,350046179400015037,350046179400015024,350046179400015013	0-246,228-405,0-423,0-411,0-366						galactosaminyl-transferase with an unusual lectin domain from the platyhelminth parasite Echinococcus granulosus	www.biochemj.org	0	0		
618	chrIII	4330752	4356507	3500343811	43		4330752	4356507	8421504	3	20,19,4	0,25731,25751	g	350034381100001330,350034381100000275	6-26,5-28						1531 26.93 2.31 1.16 sequence_4 1 432 (149568) + Gypsy12-ZM_I LTR/Gypsy 	nomics.purdue.edu	0	0		
618	chrIII	4336871	4339591	3500393813	822		4336871	4339591	8421504	9	3,180,219,74,40,92,28,75,111	0,60,903,1180,1515,1579,1921,2240,2609	p	350039381300015045,350039381300015057,350039381300015063,350039381300015064,350039381300015073	0-183,0-243,0-90,0-120,0-186						A novel cdc2-related kinase	cs.biologists.org	0	0		
618	chrIII	4348663	4348692	3500238225	25		4348663	4348692	8421504	3	6,5,14	0,7,15	g	350023822500000044	12-37						Index Seq ID Count Primer type Orientation Start Len tm GC% Any compl 3' compl Seq Prod size Seq len	openwetware.org	0	0		
618	chrIII	4362499	4362610	3500235647	61		4362499	4362610	8421504	2	39,22	0,89	c	350023564700001262,350023564700001263,350023564700001260,350023564700000470,350023564700000469,350023564700000467,350023564700000466,350023564700001259	4-101,4-100,4-102,4-100,4-101,4-102,4-101,4-101						NEUROPROTECTIVE MOLECULES AND METHODS OF TREATING NEUROLOGICAL DISORDERS AND INDUCING STRESS GRANULES - Patent application	www.faqs.org	0	0		
618	chrIII	4378402	4378431	3500262179	24		4378402	4378431	8421504	2	12,12	0,17	g	350026217900000011	18-46						 <HTML> <HEAD><TITLE>aua$?a-aaaa-aa-a!aaaaaa1aa,a"a1aa(c)a1/4a1/4eoa1/4a -	www.j-tokkyo.com	0	0		
618	chrIII	4406328	4407046	3500358534	38		4406328	4407046	8421504	2	19,19	0,699	c,g	350035853400000010,350035853400000010,350035853400000011,350035853400000011	0-19,0-19,0-19,0-19			10.1261/rna.5420503		RNA	The Ref/Aly proteins are dispensable for mRNA export and development in Caenorhabditis elegans	DASA	July	0		
618	chrIII	4414162	4414241	3500138837	57		4414162	4414241	8421504	2	35,22	0,57	c	350013883700000000,350013883700000001	0-35,0-22		20585459	10.1371/journal.pone.0011217		PLoS ONE	Small DNA Pieces in C. elegans Are Intermediates of DNA Fragmentation during Apoptosis	P.	2010	0		
618	chrIII	4414164	4414217	3500449374	53		4414164	4414217	8421504	1	53	0	c	350044937400000020	0-55						The C. elegans Heterochronic Gene lin-4 Encodes Small RNAs with Antisense Complementarity to &II-14	quantification.de	0	0		
618	chrIII	4414164	4414217	3500218021	53		4414164	4414217	8421504	1	53	0	c	350021802100000020	0-55						The C. elegans Heterochronic Gene lin-4 Encodes Small RNAs with Antisense Complementarity to &II-14	www.qpcrupdate.eu	0	0		
618	chrIII	4414172	4414248	3500297711	45		4414172	4414248	8421504	2	25,20	0,56	c	350029771100000030,350029771100000029	0-25,0-20						MicroRNA let 7 Regulates 3T3-L1 Adipogenesis	.endojournals.org	0	0		
618	chrIII	4414175	4414226	3500103185	51		4414175	4414226	8421504	1	51	0	c,g	350010318500000022,350010318500000022,350010318500000004,350010318500000004	0-22,0-22,0-32,0-32		10022876		0270-7306	Molecular and Cellular Biology	Alterations in the Conserved SL1trans-Spliced Leader of Caenorhabditis elegansDemonstrate Flexibility in Length and Sequence Requirements In Vivo	Ferguson	1999	6		TMEM222
618	chrIII	4414187	4414217	3500423931	30		4414187	4414217	8421504	1	30	0	c	350042393100000000	23-53		19804757	10.1016/j.cell.2009.06.044		Cell	Phosphorylation of the human micro-RNA generating complex mediates MAPK/Erk signaling	Zain	2009	0		TMEM222
618	chrIII	4414187	4414217	3500394033	30		4414187	4414217	8421504	1	30	0	g	350039403300000006	0-30						letters to nature	web.mit.edu	0	0		TMEM222
618	chrIII	4414187	4414217	3500392693	30		4414187	4414217	8421504	1	30	0	c	350039269300000005	0-30		22498306	10.1111/j.1742-4658.2012.08589.x	1742-4658	FEBS Journal	MicroRNA-199a targets CD44 to suppress the tumorigenicity and multidrug resistance of ovarian cancer-initiating cells - Cheng - 2012 - FEBS Journal - Wiley Online Library	Cheng	2012	0		
618	chrIII	4414187	4414217	3500232186	30		4414187	4414217	8421504	1	30	0	c	350023218600000001	0-30						let-7 Regulates Self Renewal and Tumorigenicity of Breast Cancer Cells	www.uni-lj.si	0	0		TMEM222
618	chrIII	4414187	4414217	3500161338	30		4414187	4414217	8421504	1	30	0	c	350016133800000000	23-53						Phosphorylation of the Human MicroRNA-Generating Complex Mediates MAPK/Erk Signaling	www.nibs.ac.cn	0	0		TMEM222
618	chrIII	4414187	4414217	3500138766	30		4414187	4414217	8421504	1	30	0	c	350013876600000000	0-30		23937650	10.1186/1471-2164-14-543		BMC Genomics	Genome-wide analyses of Epstein-Barr virus reveal conserved RNA structures and a novel stable intronic sequence RNA	WalN	2013	0		TMEM222
618	chrIII	4414187	4414217	3500115785	30		4414187	4414217	8421504	1	30	0	c	350011578500000000	0-30		23937650	10.1186/1471-2164-14-543	1471-2164	BMC Genomics	Genome-wide analyses of Epstein-Barr virus reveal conserved RNA structures and a novel stable intronic sequence RNA	Moss	2013	4		
618	chrIII	4414187	4414217	3500057491	30		4414187	4414217	8421504	1	30	0	c	350005749100000010	0-30		19211677	10.1242/dev.029868	0950-1991	Development	Requirement for Sun1 in the expression of meiotic reproductive genes and piRNA	Chi	2009	7		
618	chrIII	4414187	4414217	3500026141	30		4414187	4414217	8421504	1	30	0	c	350002614100000003	0-30						MicroRNA gene expression deregulation in human breast cancer. - ResearchGate	.researchgate.net	0	0		TMEM222
618	chrIII	4414187	4414217	3500024844	30		4414187	4414217	8421504	1	30	0	g	350002484400000001	0-30		17699775	10.1158/0008-5472.CAN-07-1083	0008-5472	Cancer Research	The let-7 MicroRNA Represses Cell Proliferation Pathways in Human Cells	Johnson	2007	8		
618	chrIII	4414190	4414213	3500193537	23		4414190	4414213	8421504	1	23	0	c	350019353700000002	0-23			10.1371/journal.pbio.0030235	1545-7885	PLOS Biology	PLOS Biology: Processing of Pre-microRNAs by the Dicer-1–Loquacious Complex in Drosophila Cells	Saito	2005	0		
618	chrIII	4414197	4414241	3500299303	41		4414197	4414241	8421504	2	19,22	0,22	g	350029930300000019,350029930300000054	0-19,0-22						Table S1 Primers for miRNAs quantification, expressing vectors, luciferase reporter plasmids	www.nature.com	0	0		
618	chrIII	4414198	4414258	3500224092	55		4414198	4414258	8421504	2	34,21	0,39	c	350022409200000019,350022409200000018,350022409200000009	0-21,0-20,0-21			10.1186/1471-2199-6-20	1471-2199	BMC Molecular Biology	Pseudouridine modification in Caenorhabditis elegans spliceosomal snRNAs: unique modifications are found in regions involved in snRNA-snRNA interactions	Patton	2005	3		
618	chrIII	4414201	4414238	3500001126	37		4414201	4414238	8421504	1	37	0	c,g	350000112600000054,350000112600000054	0-37,0-37						Nucleotide Motifs Providing Localization Elements and Methods of Use	Mendell	2007	0		
618	chrIII	4414208	4414241	3500266313	33		4414208	4414241	8421504	1	33	0	g	350026631300000014	0-33						Ruolo di miR-221 e miR-222 in modelli cellulari di adenocarcinoma prostatico	space.uniroma2.it	0	0		
618	chrIII	4414208	4414241	3500038487	31		4414208	4414241	8421504	2	7,24	0,9	c	350003848700000004	0-31						Role of the AKT pathway in microRNA expression of human U251 glioblastoma cells	-publications.com	0	0		
618	chrIII	4414213	4414248	3500117689	35		4414213	4414248	8421504	1	35	0	c	350011768900000010	0-35			10.1002/jgm.860	1521-2254	The Journal of Gene Medicine	Stable RNA interference: comparison of U6 and H1 promoters in endothelial cells and in mouse brain - Mäkinen - 2006 - The Journal of Gene Medicine - Wiley Online Library	Makinen	2006	0		TRMT5
618	chrIII	4414214	4414237	3500385668	23		4414214	4414237	8421504	1	23	0	g	350038566800000006	0-23		22427970	10.1371/journal.pone.0033144		PLoS ONE	Polypyrimidine Tract Binding Protein (hnRNP I) Is Possibly a Conserved Modulator of miRNA-Mediated Gene Regulation	Bart	2012	0		TRMT5
618	chrIII	4414214	4414237	3500149550	23		4414214	4414237	8421504	1	23	0	c,g	350014955000000022,350014955000000022	0-23,0-23						Antibodies against gene products related to Werner's Syndrome	Fu	2003	0		TRMT5
618	chrIII	4414214	4414237	3500048116	23		4414214	4414237	8421504	1	23	0	g	350004811600000022	0-23						 Antibodies Against Gene Products Related To Werner's Syndrome 	www.docstoc.com	0	0		TRMT5
618	chrIII	4414214	4414237	3500014443	23		4414214	4414237	8421504	1	23	0	c	350001444300000022	0-23						Genes and gene products related to Werner's syndrome - US Patent 6090620 Description	ww.patentstorm.us	0	0		TRMT5
618	chrIII	4414214	4414237	3500000908	23		4414214	4414237	8421504	1	23	0	c	350000090800000022	0-23						Genes and gene products related to Werner's syndrome	Fu	1996	0		TRMT5
618	chrIII	4414216	4414258	3500280470	42		4414216	4414258	8421504	1	42	0	c	350028047000000042	11-53						NUCLEIC ACID DETECTION AND QUANTIFICATION BY POST-HYBRIDIZATION LABELING AND UNIVERSAL ENCODING - Patent application	www.faqs.org	0	0		
618	chrIII	4414216	4414248	3500450260	32		4414216	4414248	8421504	1	32	0	c	350045026000000021,350045026000000024	0-20,0-20		18729214	10.1002/dvdy.21666	1097-0177	Developmental Dynamics	Determination of microRNAs in mouse preimplantation embryos by microarray - Yang - 2008 - Developmental Dynamics - Wiley Online Library	Yang	2008	0		
618	chrIII	4414216	4414240	3500351709	24		4414216	4414240	8421504	1	24	0	c	350035170900000006	0-24		21683814	10.1016/j.bbagrm.2011.05.015		Biochimica et biophysica acta	Drosha processing controls the specificity and efficiency of global microRNA expression	Yong	2011	0		TRMT5
618	chrIII	4414220	4414245	3500048539	25		4414220	4414245	8421504	1	25	0	g	350004853900000003	0-25						DGCR8 is essential for microRNA biogenesis and silencing of embryonic stem cell self-renewal	bms.ucsf.edu	0	0		TRMT5
618	chrIII	4414221	4414245	3500293810	24		4414221	4414245	8421504	1	24	0	c	350029381000000009	0-24			10.1038/sj.emboj.7601484		The EMBO Journal	Foxo and Fos regulate the decision between cell death and survival in response to UV irradiation	Luo	2006	0		
618	chrIII	4414221	4414245	3500290273	24		4414221	4414245	8421504	1	24	0	c	350029027300000016	0-24			10.1038/sj.emboj.7601484	ERROR! NO ISSN	The EMBO Journal	Foxo and Fos regulate the decision between cell death and survival in response to UV irradiation	Luo	2006	0		
618	chrIII	4414223	4414246	3500178379	23		4414223	4414246	8421504	1	23	0	g	350017837900000001	0-23		21742974	10.4049/jimmunol.1001937	0022-1767	The Journal of Immunology	Inhibition of MicroRNA let-7i Depresses Maturation and Functional State of Dendritic Cells in Response to Lipopolysaccharide Stimulation via Targeting Suppressor of Cytokine Signaling 1	Zhang	2011	6		TRMT5
618	chrIII	4414226	4414250	3500327218	24		4414226	4414250	8421504	1	24	0	c	350032721800000002	0-24						Total RNA purified from cytosolic and nuclear fractions	www.eurasnet.info	0	0		TRMT5
618	chrIII	4414229	4414257	3500421627	28		4414229	4414257	8421504	1	28	0	c	350042162700000001	0-28						Identification of a micro-rna that activates expression of beta-myosin heavy chain	Olson	2009	0		
618	chrIII	4414229	4414257	3500311906	28		4414229	4414257	8421504	1	28	0	c	350031190600000001	0-28						Identification of a micro-rna that activates expression of beta-myosin heavy chain	Olson	2008	0		
618	chrIII	4414229	4414257	3500091981	28		4414229	4414257	8421504	1	28	0	c	350009198100000001	0-28						Descripción y reivindicaciones de la patente: identificación de un microarn que activa la expresión de la cadena pesada beta de la miosina (7 de marzo de 2013).	patentados.com	0	0		
618	chrIII	4414229	4414253	3500380004	24		4414229	4414253	8421504	1	24	0	c	350038000400000041	0-24						NOVEL METHODS FOR QUANTIFICATION OF MICRORNAS AND SMALL INTERFERING RNAS - Patent application	www.faqs.org	0	0		
618	chrIII	4414230	4414253	3500187052	23		4414230	4414253	8421504	1	23	0	c	350018705200000018	0-23						www.stemcell8.cn ←点击进入	www.bjcancer.org	0	0		TMEM222
618	chrIII	4416848	4416871	3500194350	23		4416848	4416871	8421504	1	23	0	c	350019435000000061	4-27						Soybean peroxidase gene family and an assay for detecting soybean peroxidase activity	Vierling	1998	0		
619	chrIII	4456725	4456749	3500408588	23		4456725	4456749	8421504	2	13,10	0,14	g	350040858800000081	0-23						 Modified Luciferase 	www.docstoc.com	0	0		
619	chrIII	4476886	4477541	3500226123	557		4476886	4477541	8421504	2	358,199	0,456	p,c,g	350022612300000024,350022612300000023,350022612300000006,350022612300000006,350022612300000031,350022612300000031,350022612300015011,350022612300000022,350022612300000005,350022612300000005,350022612300000007,350022612300000007,350022612300000030,350022612300000030,350022612300000032,350022612300000032,350022612300000029,350022612300000029,350022612300000004,350022612300000004,350022612300015010,350022612300000021,350022612300015023,350022612300000020,350022612300015009,350022612300015021,350022612300015008,350022612300000019,350022612300015007,350022612300000018,350022612300000018,350022612300015019,350022612300000017	0-149,0-54,0-23,0-23,0-23,0-23,0-45,0-48,0-21,0-21,0-21,0-21,0-21,0-21,0-21,0-21,0-20,0-20,0-20,0-20,0-45,0-48,0-45,0-48,0-45,0-45,0-45,0-48,0-45,0-48,0-48,0-45,0-114						インスリン様ペプチド - サントリー株式会社	www.patentjp.com	0	0		
619	chrIII	4494289	4498554	3500154339	107		4494289	4498554	8421504	2	55,52	0,4213	c,g	350015433900000093,350015433900000122	45-100,0-52							biomedcentral.com	0	0		
619	chrIII	4499369	4499419	3500350443	50		4499369	4499419	8421504	1	50	0	g	350035044300000170	0-50						OLIGONUCLEOTIDE ANALOGUES FOR DETECTING AND ANALYZING NUCLEIC ACIDS - Exiqon, A/s	www.sumobrain.com	0	0		
619	chrIII	4562789	4566121	3500324718	248		4562789	4566121	8421504	5	51,59,4,114,20	0,119,234,2584,3312	p,g	350032471800015000,350032471800015001,350032471800000002	0-114,0-114,0-20		23682709	10.1186/1471-213X-13-21	1471-213X	BMC Developmental Biology	The C. elegans gene pan-1 encodes novel transmembrane and cytoplasmic leucine-rich repeat proteins and promotes molting and the larva to adult transition	Gissendanner	2013	3		
619	chrIII	4562789	4566121	3500187660	248		4562789	4566121	8421504	5	51,59,4,114,20	0,119,234,2584,3312	p,g	350018766000015001,350018766000015002,350018766000000002	0-114,0-114,0-20						The C. elegans gene pan-1 encodes novel transmembrane and cytoplasmic leucine-rich repeat proteins and promotes molting and the larva to adult transition	biomedcentral.com	0	0		
620	chrIII	4588647	4588717	3500076679	23		4588647	4588717	8421504	3	10,5,8	0,56,62	c	350007667900000470,350007667900000104,350007667900000387	0-23,0-23,0-21						Genes at your fingertips - molecular diagnostic software that works for you!	GmbH	2003	0		
620	chrIII	4616244	4616268	3500276636	23		4616244	4616268	8421504	2	17,6	0,18	g	350027663600000000	0-24						KEGG T00217: GK0625	www.genome.jp	0	0		
620	chrIII	4637249	4637273	3500083577	23		4637249	4637273	8421504	2	7,16	0,8	c	350008357700000004	3-26						Cloning and Characterization of Protease Inhibitor from Latex of Rubber Tree (Hevea brasiliensis °“√‚§≈π·≈–»÷°…“ ¡∫ —µ‘¢Õ	anet.gs.kku.ac.th	0	0		
620	chrIII	4638723	4638750	3500367239	23		4638723	4638750	8421504	2	15,8	0,19	g	350036723900000580	0-23						Compositions and Methods for Inhibiting Expression of the PCSK9 Gene	Tan	2011	0		
620	chrIII	4659539	4662386	3500061179	45		4659539	4662386	8421504	2	20,25	0,2822	c,g	350006117900000010,350006117900000010,350006117900000011,350006117900000011	14-34,14-34,12-37,12-37						Two Cyclin-Dependent Kinase Pathways Are Essential for Polarized Trafficking of Presynaptic Components	logylabs.utah.edu	0	0		
620	chrIII	4682748	4682782	3500383726	25		4682748	4682782	8421504	3	14,3,8	0,19,26	g	350038372600000096	23-48						COMPOSITIONS AND METHODS FOR INCREASING CELLULOSE PRODUCTION - Patent application	www.faqs.org	0	0		
620	chrIII	4689598	4689735	3500288532	137		4689598	4689735	8421504	1	137	0	c	350028853200000031	2-139						ScienceDirect.com - Genomics - A combined computational and experimental analysis of two families of snoRNA genes from Caenorhabditis elegans, revealing the expression and evolution pattern of snoRNAs in nematodes	sciencedirect.com	0	0		
620	chrIII	4690070	4690094	3500297500	23		4690070	4690094	8421504	2	4,19	0,5	c,g	350029750000001575,350029750000001575	12-35,12-35						Marshfield Set 12 Screening	www.cstl.nist.gov	0	0		
620	chrIII	4693200	4693226	3500395514	23		4693200	4693226	8421504	2	10,13	0,13	c	350039551400000000	7-30						Methods for developing animal models	Nomura	2008	0		
620	chrIII	4696197	4696245	3500377416	48		4696197	4696245	8421504	1	48	0	p	350037741600015067	0-48						Novel starches via modification of expression of starch biosynthetic enzyme genes	Broglie	1997	0		
620	chrIII	4696938	4696986	3500268981	48		4696938	4696986	8421504	1	48	0	p	350026898100015246	0-48						PLANT CELLS AND PLANTS WHICH SYNTHESIZE A STARCH WITH AN INCREASED FINAL VISCOSITY - Patent application	www.faqs.org	0	0		
620	chrIII	4696950	4696995	3500389820	45		4696950	4696995	8421504	1	45	0	p	350038982000015094	0-45						WHEAT WITH ALTERED BRANCHING ENZYME ACTIVITY AND STARCH AND STARCH CONTAINING PRODUCTS DERIVED THEREFROM - Patent application	www.faqs.org	0	0		
621	chrIII	4720048	4720071	3500212070	23		4720048	4720071	8421504	1	23	0	g	350021207000000109	22-45							biomedcentral.com	0	0		
621	chrIII	4723947	4723971	3500057006	23		4723947	4723971	8421504	2	6,17	0,7	g	350005700600000885	6-29						<HTML><HEAD><meta http-equiv="Content-Type" content="text/html; charset=ISO-8859-1"><LINK REL="SHORT	.economie.fgov.be	0	0		
621	chrIII	4727541	4731687	3500262986	80		4727541	4731687	8421504	4	20,20,20,20	0,53,3929,4126	c,g	350026298600000000,350026298600000000,350026298600000002,350026298600000002,350026298600000003,350026298600000001	0-20,0-20,0-20,0-20,0-20,0-20		12019229		0016-6731	Genetics	Functional Characterization of the Adenylyl Cyclase Gene sgs-1 by Analysis of a Mutational Spectrum in Caenorhabditis elegans	Moorman	2002	4		
621	chrIII	4745588	4745614	3500197957	23		4745588	4745614	8421504	3	4,13,6	0,5,20	c	350019795700000013	2-28						MOLECULAR MARKERS ASSOCIATED WITH SOYBEAN ROOT-KNOT NEMATODE TOLERANCE AND METHODS OF THEIR USE	Klaiber	2012	0		
621	chrIII	4749404	4756742	3500099218	93		4749404	4756742	8421504	4	24,24,23,22	0,5691,6635,7316	c,g	350009921800000014,350009921800000017,350009921800000017,350009921800000018,350009921800000018,350009921800000015,350009921800000015	0-24,0-24,0-24,0-23,0-23,24-46,24-46						CiteULike: regulates life span and fat storage by two independent mechanisms	www.citeulike.org	0	0		
621	chrIII	4749404	4756062	3500274120	71		4749404	4756062	8421504	3	24,24,23	0,5691,6635	c,g	350027412000000014,350027412000000017,350027412000000017,350027412000000018,350027412000000018	0-24,0-24,0-24,0-23,0-23						C. elegans tubby regulates life span and fat storage by two independent mechanisms 10.1016/j.cmet.2005.06.004 : Cell Metabolism | ScienceDirect.com	sciencedirect.com	0	0		
621	chrIII	4753014	4754011	3500195362	831		4753014	4754011	8421504	4	333,102,263,133	0,380,529,864	c	350019536200000001	47-878						在NCBI进行序列比对时出现“No significant similarity found”是怎么回事？ | 云生物	yunbio.com/1013	0	0		
621	chrIII	4753297	4753928	3500339057	300		4753297	4753928	8421504	6	50,50,50,50,50,50	0,97,149,246,459,581	c,g	350033905700000005,350033905700000005,350033905700000003,350033905700000003,350033905700000001,350033905700000001,350033905700000013	0-100,0-100,0-100,0-100,0-100,0-100,0-26						学生物信息学的帮我看看，改下程序-Perl-ChinaUnix.net	bbs.chinaunix.net	0	0		
621	chrIII	4753756	4753928	3500439139	100		4753756	4753928	8421504	2	50,50	0,122	c,g	350043913900000003,350043913900000003,350043913900000005,350043913900000005	0-100,0-100,0-26,0-26						该怎么处理？-Perl-ChinaUnix.net	bbs.chinaunix.net	0	0		
621	chrIII	4780985	4781009	3500274581	23		4780985	4781009	8421504	2	11,12	0,12	c	350027458100000599	0-23							n.biotec.uiuc.edu	0	0		
621	chrIII	4805171	4808674	3500129913	44		4805171	4808674	8421504	2	22,22	0,3481	g	350012991300000017,350012991300000016	14-36,10-32			10.1186/gb-2000-2-1-research0002	1465-6906	Genome Biology	Effectiveness of specific RNA-mediated interference through ingested double-stranded RNA in Caenorhabditis elegans	Kamath	2000	0		
621	chrIII	4805189	4808668	3500125252	40		4805189	4808668	8421504	2	20,20	0,3459	c,g	350012525200000003,350012525200000003,350012525200000002,350012525200000002	20-40,20-40,20-40,20-40						Supporting Information 	www.pnas.org	0	0		
621	chrIII	4810430	4813380	3500209231	54		4810430	4813380	8421504	2	27,27	0,2923	c,g	350020923100000001,350020923100000001,350020923100000000,350020923100000000	0-27,0-27,0-27,0-27						A C. elegans mediator protein confers regulatory selectivity on lineage-specific expression of a transcription factor gene	orms.aecom.yu.edu	0	0		
621	chrIII	4810634	4845346	3500269550	45		4810634	4845346	8421504	4	12,11,7,15	0,15,34688,34697	c,g	350026955000000400,350026955000000237	1-24,12-34						MARCADORES MOLECULARES PARA IDENTIFICAÇÃO DE CARRAPATOS VETORES DE AGENTES RICKETTSIAIS	www.tede.ufv.br	0	0		
622	chrIII	4849795	4860884	3500285774	93		4849795	4860884	8421504	3	21,45,27	0,5102,11062	c,g	350028577400000000,350028577400000001,350028577400000001,350028577400000002,350028577400000003	12-33,12-33,12-33,12-36,10-37		21886181	10.1038/cdd.2011.104	1350-9047	Cell Death & Differentiation	Evidence that CED-9/Bcl2 and CED-4/Apaf-1 localization is not consistent with the current model for C. elegans apoptosis induction	Pourkarimi	2011	9		
622	chrIII	4852419	4853611	3500326409	46		4852419	4853611	8421504	2	23,23	0,1169	c,g	350032640900000002,350032640900000002,350032640900000003,350032640900000003	0-23,0-23,0-23,0-23		15238520	10.1534/genetics.103.020503	0016-6731	Genetics	The Caenorhabditis elegans pvl-5 Gene Protects Hypodermal Cells From ced-3-Dependent, ced-4-Independent Cell Death	Joshi	2004	4		
622	chrIII	4852419	4853611	3500078908	46		4852419	4853611	8421504	2	23,23	0,1169	c,g	350007890800000002,350007890800000002,350007890800000003	0-23,0-23,0-23		15238520	10.1534/genetics.103.020503	0016-6731	Genetics	The Caenorhabditis elegans pvl-5 Gene Protects Hypodermal Cells From ced-3-Dependent, ced-4-Independent Cell Death	Joshi	2004	4		
622	chrIII	4853580	4853609	3500044376	29		4853580	4853609	8421504	1	29	0	c,g	350004437600000014,350004437600000014	0-29,0-29						Tc4, a Caenorhabditis elegans Transposable Element with an Unusual Fold- Back Structure	www.jstor.org	0	0		
622	chrIII	4854219	4854957	3500350443	100		4854219	4854957	8421504	2	50,50	0,688	c,g	350035044300000154,350035044300000154,350035044300000153	0-50,0-50,0-50						OLIGONUCLEOTIDE ANALOGUES FOR DETECTING AND ANALYZING NUCLEIC ACIDS - Exiqon, A/s	www.sumobrain.com	0	0		
622	chrIII	4854626	4854722	3500439957	50		4854626	4854722	8421504	2	21,29	0,67	c,g	350043995700000000,350043995700000000	0-50,0-50						Homology cloning	Marchionni	1992	0		
622	chrIII	4854626	4854722	3500057924	50		4854626	4854722	8421504	2	21,29	0,67	c,g	350005792400000000,350005792400000000	0-50,0-50						Homology cloning	www.devileye.net	0	0		
622	chrIII	4861449	4861474	3500422541	23		4861449	4861474	8421504	2	13,10	0,15	c	350042254100000174	15-38						COMPOSITIONS AND METHODS FOR SILENCING GENES EXPRESSED IN CANCER - Patent application	www.faqs.org	0	0		
622	chrIII	4862143	4896061	3500361613	38		4862143	4896061	8421504	4	8,11,14,5	0,12,33896,33913	c,g	350036161300001102,350036161300001729	4-23,3-22						<HTML> <TITLE>BLAST Search Results  BLAST Search Results  BLAST Search Results  BLAST Search Results  BLAST Search Results  BLAST Search Results  BLAST Search Results  BLAST Search Results  Complet list of 1mpf hssp file Complet list of	cnptia.embrapa.br	0	0		
623	chrIII	5028871	5028894	3500199761	23		5028871	5028894	8421504	1	23	0	c,g	350019976100000010,350019976100000010	0-23,0-23			10.1186/1471-2164-8-403	1471-2164	BMC Genomics	Poly-G/poly-C tracts in the genomes of Caenorhabditis	Zhao	2007	4		
623	chrIII	5041197	5041222	3500169356	23		5041197	5041222	8421504	2	15,8	0,17	g	350016935600000021	0-23						T E S I S	zamna.bnct.ipn.mx	0	0		
623	chrIII	5047050	5058981	3500178220	40		5047050	5058981	8421504	4	11,9,6,14	0,16,11909,11917	c,g	350017822000002056,350017822000001826,350017822000001826	15-35,13-34,13-34						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
623	chrIII	5055151	5056879	3500323108	39		5055151	5056879	8421504	3	20,6,13	0,1706,1715	c,g	350032310800000860,350032310800000332	2-22,10-29						Plant genes and uses thereof	J*M*Sa Er Mi Long 	2002	0		
623	chrIII	5093106	5093132	3500338809	23		5093106	5093132	8421504	2	15,8	0,18	g	350033880900000094	7-30						Methylotroph Producing Mammalian Type Sugar Chain 	.freshpatents.com	0	0		
623	chrIII	5095948	5095971	3500362686	23		5095948	5095971	8421504	1	23	0	g	350036268600000335,350036268600000334	0-24,0-23						<HTML> <TITLE>BLAST Search Results  BLAST Search Results  BLAST Search Results  Complet list of 3ihg hssp file Complet list of	cnptia.embrapa.br	0	0		
627	chrIII	5627560	5627708	3500398407	148		5627560	5627708	8421504	1	148	0	c	350039840700000038	0-148						MINIATURE INVERTED REPEAT TRANSPOSABLE ELEMENTS IN RICE !!! ORIGIN AND FUNCTION	pository.tamu.edu	0	0		
627	chrIII	5632352	5632378	3500343811	23		5632352	5632378	8421504	2	17,6	0,20	g	350034381100001032	20-43						1531 26.93 2.31 1.16 sequence_4 1 432 (149568) + Gypsy12-ZM_I LTR/Gypsy 	nomics.purdue.edu	0	0		
628	chrIII	5639140	5659930	3500167682	40		5639140	5659930	8421504	3	20,14,6	0,20768,20784	c,g	350016768200000272,350016768200000339,350016768200000339	27-47,9-30,9-30						METHODS AND COMPOSITIONS FOR TARGETED POLYNUCLEOTIDE MODIFICATION - Patent application	www.faqs.org	0	0		
628	chrIII	5669840	5669891	3500279808	51		5669840	5669891	8421504	1	51	0	p	350027980800015000	0-51						Proteome identification of binding-partners interacting with cell polarity protein Par3 in Jurkat cells	www.abbs.info	0	0		
628	chrIII	5670428	5671389	3500453426	40		5670428	5671389	8421504	2	20,20	0,941	c,g	350045342600000014,350045342600000014,350045342600000015,350045342600000015	0-20,0-20,0-20,0-20						PAR-6 is a conserved PDZ domain-containing protein that colocalizes with PAR-3 in Caenorhabditis elegans embryos. - ResearchGate	.researchgate.net	0	0		
628	chrIII	5670428	5671389	3500068797	40		5670428	5671389	8421504	2	20,20	0,941	c,g	350006879700000014,350006879700000014,350006879700000015,350006879700000015	0-20,0-20,0-20,0-20						PAR-6 is a conserved PDZ domain-containing protein that colocalizes with PAR-3 in Caenorhabditis elegans embryos	ev.biologists.org	0	0		
628	chrIII	5670697	5671763	3500129913	38		5670697	5671763	8421504	2	19,19	0,1047	c,g	350012991300000004,350012991300000004,350012991300000005,350012991300000005	0-19,0-19,0-19,0-19			10.1186/gb-2000-2-1-research0002	1465-6906	Genome Biology	Effectiveness of specific RNA-mediated interference through ingested double-stranded RNA in Caenorhabditis elegans	Kamath	2000	0		
628	chrIII	5679701	5679830	3500288532	129		5679701	5679830	8421504	1	129	0	c,g	350028853200000030,350028853200000030	3-132,3-132						ScienceDirect.com - Genomics - A combined computational and experimental analysis of two families of snoRNA genes from Caenorhabditis elegans, revealing the expression and evolution pattern of snoRNAs in nematodes	sciencedirect.com	0	0		
628	chrIII	5690316	5691052	3500430936	52		5690316	5691052	8421504	2	26,26	0,710	c	350043093600000003,350043093600000002	0-52,0-52		19402756	10.1371/journal.pbio.1000099	1545-7885	PLOS Biology	PLOS Biology: Abl Kinase Inhibits the Engulfment of Apopotic Cells in Caenorhabditis elegans	Hurwitz	2009	0		
628	chrIII	5690316	5691052	3500256768	52		5690316	5691052	8421504	2	26,26	0,710	c	350025676800000002,350025676800000003	0-52,0-52		19402756	10.1371/journal.pbio.1000099		PLoS Biology	Abl Kinase Inhibits the Engulfment of Apopotic Cells in Caenorhabditis elegans	MichaE	2009	0		
628	chrIII	5696027	5696567	3500309883	267		5696027	5696567	8421504	2	78,189	0,351	p	350030988300015150	0-267						THAP1, UN REGULATEUR CLE DE LA PROLIFERATION DES CELLULES ENDOTHELIALES : RELATIONS STRUCTURE/FONCTION ET GENES CIBLES	esups.ups-tlse.fr	0	0		
628	chrIII	5697515	5697956	3500212106	38		5697515	5697956	8421504	2	19,19	0,422	c,g	350021210600000005,350021210600000005,350021210600000004,350021210600000004	0-19,0-19,0-19,0-19						Supplementary Information	ans.imbb.forth.gr	0	0		
628	chrIII	5711540	5711767	3500237513	180		5711540	5711767	8421504	2	59,121	0,106	p	350023751300015161	0-180						50 human secreted proteins	Komatsoulis	2000	0		
628	chrIII	5713991	5716902	3500044932	103		5713991	5716902	8421504	5	19,20,19,25,20	0,2077,2127,2854,2891	c,g	350004493200000019,350004493200000019,350004493200000023,350004493200000020,350004493200000020,350004493200000024,350004493200000021	0-19,0-19,12-32,0-19,0-19,18-43,0-20						Functional genomic analysis of the ADP-ribosylation factor family of GTPases: phylogeny among diverse eukaryotes and function in C. elegans	biology.uiowa.edu	0	0		
628	chrIII	5730029	5730053	3500262398	24		5730029	5730053	8421504	1	24	0	g	350026239800000015	0-24						RNA TAGGING METHOD - MONASH UNIVERSITY	www.sumobrain.com	0	0		
628	chrIII	5733950	5737019	3500374866	1437		5733950	5737019	8421504	13	120,94,2,83,76,144,134,173,131,94,219,91,76	0,169,414,798,927,1148,1412,1735,2011,2187,2408,2799,2993	p	350037486600015000	411-1884						Code Snippet | Bioinformatics.be	bioinformatics.be	0	0		
628	chrIII	5733950	5737019	3500329401	1437		5733950	5737019	8421504	13	120,94,2,83,76,144,134,173,131,94,219,91,76	0,169,414,798,927,1148,1412,1735,2011,2187,2408,2799,2993	p	350032940100015002	201-1674						Bioinformatica p2-p3-introduction	ww.slideshare.net	0	0		
628	chrIII	5733950	5737019	3500029105	1437		5733950	5737019	8421504	13	120,94,2,83,76,144,134,173,131,94,219,91,76	0,169,414,798,927,1148,1412,1735,2011,2187,2408,2799,2993	p	350002910500015002	411-1884						Bioinformatica 06-10-2011-p2 introduction	ww.slideshare.net	0	0		
628	chrIII	5733950	5737019	3500018178	1437		5733950	5737019	8421504	13	120,94,2,83,76,144,134,173,131,94,219,91,76	0,169,414,798,927,1148,1412,1735,2011,2187,2408,2799,2993	p	350001817800015000	411-1884						admin | Bioinformatics.be | Page 6	bioinformatics.be	0	0		
628	chrIII	5761842	5763977	3500383643	100		5761842	5763977	8421504	4	37,24,19,20	0,626,2076,2115	c,g	350038364300000000,350038364300000000,350038364300000002,350038364300000002,350038364300000004,350038364300000004,350038364300000003,350038364300000001,350038364300000001	0-20,0-20,0-20,0-20,0-24,0-24,0-19,0-20,0-20						Cellular/Molecular Insulinoma-Associated Protein IA-2, a Vesicle Transmembrane Protein, Genetically Interacts with UNC-31/ CAPS and Affects Neurosecretion in Caenorhabditis elegans	www.jneurosci.org	0	0		
628	chrIII	5761842	5763977	3500202125	100		5761842	5763977	8421504	4	37,24,19,20	0,626,2076,2115	c,g	350020212500000000,350020212500000000,350020212500000002,350020212500000002,350020212500000004,350020212500000004,350020212500000003,350020212500000001,350020212500000001	0-20,0-20,0-20,0-20,0-24,0-24,0-19,0-20,0-20		15044551	10.1523/JNEUROSCI.0101-04.2004	0270-6474	The Journal of Neuroscience	Insulinoma-Associated Protein IA-2, a Vesicle Transmembrane Protein, Genetically Interacts with UNC-31/CAPS and Affects Neurosecretion in Caenorhabditis elegans	Cai	2004	7		
629	chrIII	5782419	5790251	3500386452	63		5782419	5790251	8421504	2	23,40	0,7792	c,g	350038645200000035,350038645200000400,350038645200000394,350038645200000131,350038645200000033,350038645200000038,350038645200000027,350038645200000150	0-24,0-63,0-63,0-24,0-22,6-28,1-29,0-30						NEUROPROTECTIVE MOLECULES AND METHODS OF TREATING NEUROLOGICAL DISORDERS AND INDUCING STRESS GRANULES	Anderson	2011	0		
629	chrIII	5782419	5790251	3500235647	63		5782419	5790251	8421504	2	23,40	0,7792	c	350023564700000131,350023564700000035,350023564700000027,350023564700000038,350023564700000150,350023564700000808	0-24,0-24,1-29,6-28,0-30,0-30						NEUROPROTECTIVE MOLECULES AND METHODS OF TREATING NEUROLOGICAL DISORDERS AND INDUCING STRESS GRANULES - Patent application	www.faqs.org	0	0		
629	chrIII	5782691	5782715	3500439861	23		5782691	5782715	8421504	2	11,12	0,12	c	350043986100000264,350043986100000347	7-27,0-20						<Html><Title> Complet list of 1nis hssp file Complet list of	cnptia.embrapa.br	0	0		
629	chrIII	5782692	5782719	3500130734	23		5782692	5782719	8421504	2	7,16	0,11	c	350013073400000410,350013073400000215	9-29,4-27						<Html><Title> Complet list of 3igz hssp file Complet list of	cnptia.embrapa.br	0	0		
629	chrIII	5793827	5793852	3500383726	24		5793827	5793852	8421504	2	4,20	0,5	c	350038372600000368	5-29						COMPOSITIONS AND METHODS FOR INCREASING CELLULOSE PRODUCTION - Patent application	www.faqs.org	0	0		
629	chrIII	5819832	5819943	3500058474	63		5819832	5819943	8421504	2	48,15	0,96	p	350005847400015007	0-63						Genetic Characterization and Cloning of Mothers against dpp, a Gene Required for decapentuplegic Function in DrosqPhila melanogaster	www.genetics.org	0	0		
629	chrIII	5819992	5820018	3500051745	26		5819992	5820018	8421504	1	26	0	c	350005174500000013,350005174500000012,350005174500000014	17-37,17-37,17-37						C-terminal mutants of C. elegansSmads reveal tissue-specific requirements for protein activation by TGF- signaling	ev.biologists.org	0	0		
629	chrIII	5831233	5831958	3500182734	40		5831233	5831958	8421504	2	20,20	0,705	c,g	350018273400000001,350018273400000001,350018273400000000,350018273400000000	0-20,0-20,0-20,0-20		18454197	10.1371/journal.pgen.1000021	1553-7404	PLOS Genetics	PLOS Genetics: The Mediator Subunit MDT-15 Confers Metabolic Adaptation to Ingested Material	Taubert	2008	0		
629	chrIII	5833284	5833307	3500368793	23		5833284	5833307	8421504	1	23	0	g	350036879300000001	0-23						R12B2.5 (mdt-15): raIs11928 | Flickr - Photo Sharing!	www.flickr.com	0	0		
629	chrIII	5857164	5858902	3500020417	1593		5857164	5858902	8421504	4	207,458,726,202	0,256,762,1536	p	350002041700015009,350002041700015022,350002041700015035,350002041700015048,350002041700015061	0-297,0-330,0-327,0-327,0-312						PDF hosted at the Radboud Repository of the Radboud University Nijmegen	ository.ubn.ru.nl	0	0		
629	chrIII	5859587	5861749	3500124733	1770		5859587	5861749	8421504	9	359,334,51,108,3,240,284,103,288	0,416,753,807,1052,1061,1385,1723,1874	p	350012473300015009,350012473300015112,350012473300015113,350012473300015114,350012473300015012,350012473300015116,350012473300015117,350012473300015015,350012473300015118,350012473300015018,350012473300015119,350012473300015022,350012473300015123,350012473300015023,350012473300015125,350012473300015026,350012473300015128,350012473300015029,350012473300015033,350012473300015036,350012473300015135,350012473300015137,350012473300015039,350012473300015042,350012473300015142,350012473300015144	0-162,9-54,0-48,0-45,0-165,0-48,0-66,0-180,18-147,0-180,3-93,0-75,0-45,0-69,0-45,0-144,0-45,0-93,0-168,0-180,0-45,0-45,0-75,0-177,0-45,0-45						US Patent # 7,078,214. Aspergillus phenylalanine aminopeptidase - Patents.com	www.patents.com	0	0		
629	chrIII	5859587	5861749	3500049500	1770		5859587	5861749	8421504	9	359,334,51,108,3,240,284,103,288	0,416,753,807,1052,1061,1385,1723,1874	p	350004950000015013,350004950000015116,350004950000015117,350004950000015118,350004950000015016,350004950000015120,350004950000015121,350004950000015019,350004950000015122,350004950000015022,350004950000015123,350004950000015026,350004950000015127,350004950000015027,350004950000015129,350004950000015030,350004950000015132,350004950000015033,350004950000015037,350004950000015040,350004950000015139,350004950000015141,350004950000015043,350004950000015046,350004950000015146,350004950000015148	0-162,9-54,0-48,0-45,0-165,0-48,0-66,0-180,18-147,0-180,3-93,0-75,0-45,0-69,0-45,0-144,0-45,0-93,0-168,0-180,0-45,0-45,0-75,0-177,0-45,0-45						Aspergillus phenylalanine aminopeptidase - US Patent 7078214 Description	ww.patentstorm.us	0	0		
629	chrIII	5859587	5861713	3500285877	1743		5859587	5861713	8421504	11	162,191,334,51,24,66,3,237,284,139,252	0,168,416,753,807,849,1052,1064,1385,1723,1874	p	350028587700015009,350028587700015012,350028587700015015,350028587700015018,350028587700015022,350028587700015023,350028587700015026,350028587700015029,350028587700015033,350028587700015036,350028587700015039,350028587700015040,350028587700015043	0-162,0-165,0-180,0-180,0-75,0-69,0-144,0-93,0-168,0-180,0-75,0-75,0-177					Patent	Aspergillus phenylalanine aminopeptidase (Patent US:7078214)	Basten	2006	0		
629	chrIII	5859587	5861713	3500151160	1743		5859587	5861713	8421504	11	162,191,334,51,24,66,3,237,284,139,252	0,168,416,753,807,849,1052,1064,1385,1723,1874	p	350015116000015009,350015116000015012,350015116000015015,350015116000015018,350015116000015022,350015116000015023,350015116000015026,350015116000015029,350015116000015033,350015116000015036,350015116000015039,350015116000015040,350015116000015043	0-162,0-165,0-180,0-180,0-75,0-69,0-144,0-93,0-168,0-180,0-75,0-75,0-177						Aspergillus phenylalanine aminopeptidase	Basten	2001	0		
629	chrIII	5877553	5878374	3500449733	540		5877553	5878374	8421504	3	151,245,144	0,195,677	p,c,g	350044973300000008,350044973300015008,350044973300000007,350044973300015007,350044973300015006,350044973300000006,350044973300000006,350044973300015005,350044973300000005,350044973300000005,350044973300015004,350044973300000004,350044973300000004,350044973300000003,350044973300000003,350044973300015003,350044973300000002,350044973300000002,350044973300015002,350044973300015001,350044973300000001,350044973300015000,350044973300000000,350044973300000000	0-60,0-60,0-62,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60						Caenorhabditis elegans thrombospondin, type I (3G966), mRNA. , NM_065871.2 - GenScript	www.genscript.com	0	0		
629	chrIII	5882825	5882848	3500128449	23		5882825	5882848	8421504	1	23	0	c	350012844900000252	0-23						<Html><Title> Complet list of 1hak hssp file Complet list of	cnptia.embrapa.br	0	0		TMPO
630	chrIII	5911375	5911445	3500153532	23		5911375	5911445	8421504	2	9,14	0,56	c	350015353200000005	2-25		18344368	10.1128/JB.01978-07	0021-9193	Journal of Bacteriology	Regulation of the Bacillus subtilis yciC Gene and Insights into the DNA-Binding Specificity of the Zinc-Sensing Metalloregulator Zur	Gabriel	2008	4		
630	chrIII	5924169	5924343	3500422961	129		5924169	5924343	8421504	2	84,45	0,129	p	350042296100015004	0-129						Boulder::Blast - search.cpan.org	search.cpan.org	0	0		
630	chrIII	5926950	5930970	3500105248	129		5926950	5930970	8421504	6	21,24,21,19,24,20	0,104,240,843,3798,4000	c,g	350010524800000000,350010524800000001,350010524800000001,350010524800000005,350010524800000005,350010524800000003,350010524800000003,350010524800000004,350010524800000002	9-30,0-24,0-24,0-21,0-21,11-30,11-30,0-24,0-20						Supplemental Data FOS-1 Promotes Basement-Membrane Removal during Anchor-Cell Invasion in C. elegans	download.cell.com	0	0		
630	chrIII	5927082	5927116	3500341764	29		5927082	5927116	8421504	2	23,6	0,28	c	350034176400000100	2-31						US Patent # 6,337,192. MMSC1-an MMAC1 interacting protein - Patents.com	www.patents.com	0	0		
630	chrIII	5931318	5931342	3500436798	24		5931318	5931342	8421504	1	24	0	g	350043679800000004	0-24						MicroRNA-21 and microRNA-148a contribute to DNA hypomethylation in lupus CD4+ T cells by directly and indirectly targeting DNA methyltransferase 1. - ResearchGate	.researchgate.net	0	0		
630	chrIII	5931318	5931342	3500366451	24		5931318	5931342	8421504	1	24	0	c,g	350036645100000002,350036645100000002	0-24,0-24						Endothelial Dysfunction in Patients with Chronic Kidney Disease Results from Advanced Glycation End Products (AGE)-Mediated Inhibition of Endothelial Nitric Oxide Synthase through RAGE Activation	n.asnjournals.org	0	0		
630	chrIII	5931318	5931342	3500354653	24		5931318	5931342	8421504	1	24	0	g	350035465300000000,350035465300000029	0-24,0-24						COMPOSITIONS AND METHODS RELATED TO MIRNA IN DIABETIC CONDITIONS - Patent application	www.faqs.org	0	0		
630	chrIII	5931318	5931342	3500328325	24		5931318	5931342	8421504	1	24	0	g	350032832500000008	0-24						miR-24 inhibits apoptosis and represses Bim in mouse cardiomyocytes	jem.rupress.org	0	0		
630	chrIII	5931318	5931342	3500236345	24		5931318	5931342	8421504	1	24	0	g	350023634500000012	0-24		21383058	10.1084/jem.20101547	0022-1007	The Journal of Experimental Medicine	miR-24 inhibits apoptosis and represses Bim in mouse cardiomyocytes	Qian	2011	14		
630	chrIII	5940807	5941212	3500009376	33		5940807	5941212	8421504	2	8,25	0,380	g	350000937600002870	18-51						 Galaxy | Dataset | FASTQ Groomer on data 2	popgenie.org:8080	0	0		
630	chrIII	5941003	5942203	3500060639	96		5941003	5942203	8421504	4	11,35,33,17	0,33,111,1183	c	350006063900000206,350006063900000122	64-132,187-261						>1365507|EST00001|2604045|AA660114|Citrullus lanatus subsp. vulgaris|LIBEST_001031 watermelon lambda	icr.kyoto-u.ac.jp	0	0		
630	chrIII	5941112	5941993	3500338097	87		5941112	5941993	8421504	4	25,4,17,41	0,97,307,840	c	350033809700005408,350033809700002337	1-47,0-41						 Galaxy | Dataset | FASTQ Groomer on data 1	popgenie.org:8080	0	0		
630	chrIII	5941144	5941274	3500052159	40		5941144	5941274	8421504	2	20,20	0,110	c,g	350005215900000004,350005215900000004,350005215900000005,350005215900000005	0-20,0-20,0-20,0-20		21124968	10.1371/journal.pone.0014052		PLoS ONE	Metallothioneins Are Required for Formation of Cross-Adaptation Response to Neurobehavioral Toxicity from Lead and Mercury Exposure in Nematodes	Boping	2010	0		
630	chrIII	5941445	5941472	3500446273	27		5941445	5941472	8421504	1	27	0	c	350044627300000014	7-34						Methods and compositions for protein expression and purification	Butt	2003	0		
630	chrIII	5941445	5941472	3500364523	27		5941445	5941472	8421504	1	27	0	c	350036452300000015	7-34						Methods and compositions for protein expression and purification	Butt	2003	0		
630	chrIII	5941445	5941472	3500356867	27		5941445	5941472	8421504	1	27	0	c	350035686700000013,350035686700000091	7-34,7-34						<HTML><HEAD><meta http-equiv="Content-Type" content="text/html; charset=ISO-8859-1"><LINK REL="SHORT	.economie.fgov.be	0	0		
630	chrIII	5941445	5941472	3500150884	27		5941445	5941472	8421504	1	27	0	c	350015088400000015	7-34						Methods and compositions for protein expression and purification	Butt	2004	0		
630	chrIII	5941445	5941472	3500020738	27		5941445	5941472	8421504	1	27	0	c	350002073800000015	7-34						Methods and compositions for protein expression and purification	Butt	2004	0		
630	chrIII	5941445	5941472	3500000786	27		5941445	5941472	8421504	1	27	0	c	350000078600000013,350000078600000053	7-34,7-34						Methods And Compositions For Protein Expression And Purification 	.freshpatents.com	0	0		
630	chrIII	5941506	5941790	3500181312	46		5941506	5941790	8421504	2	20,26	0,258	c	350018131200000010	48-104					Patent	Ubiquitin or gamma-crystalline conjugates for use in therapy, diagnosis and chromatography (Patent US:7838629)	Ebersbach	2010	0		
630	chrIII	5941635	5943493	3500003004	270		5941635	5943493	8421504	6	45,45,28,17,45,90	0,1574,1622,1700,1720,1768	p	350000300400015015,350000300400015192	0-45,0-225						Compositions and methods for the modification of gene expression - Patent # 7211711 - PatentGenius	.patentgenius.com	0	0		
630	chrIII	5941644	5941982	3500446093	114		5941644	5941982	8421504	2	69,45	0,293	p	350044609300015033,350044609300015038,350044609300015035	0-45,0-45,0-45						Diagnostic Transcript and Splice Patterns of HR-HPV in Different Cervical Lesions - Patent application	www.faqs.org	0	0		UBB
630	chrIII	5941677	5942508	3500428895	40		5941677	5942508	8421504	2	20,20	0,811	c	350042889500000006,350042889500000014	7-27,0-20						Switchgrass Promoter and Uses Thereof	Stewart	2010	0		
630	chrIII	5942510	5943493	3500413355	90		5942510	5943493	8421504	2	21,69	0,914	p,c	350041335500000008,350041335500015021	19-40,30-99						Stricto Sensu” em Ciências Genômicas e Biotecnologia	www.bdtd.ucb.br	0	0		
630	chrIII	5943553	5943582	3500153848	29		5943553	5943582	8421504	1	29	0	c,g	350015384800000011,350015384800000011	36-66,36-66						SNPs_from_T3.txt	ticeaetoolbox.org	0	0		
630	chrIII	5960606	5960635	3500310144	23		5960606	5960635	8421504	3	12,7,4	0,17,25	c	350031014400000003	0-23							biomedcentral.com	0	0		
630	chrIII	5977050	6014774	3500144883	43		5977050	6014774	8421504	3	17,6,20	0,21,37704	c,g	350014488300000476,350014488300000356,350014488300000356	3-26,11-32,11-32						Method for producing polyunsaturated fatty acids in transgenic plants - Patent application	www.faqs.org	0	0		
630	chrIII	5979669	5979697	3500076462	25		5979669	5979697	8421504	2	17,8	0,20	c	350007646200000001,350007646200000002	17-38,0-21						核酸を含有する肺高血圧症治療剤	Yagi	2010	0		
630	chrIII	5979669	5979697	3500046085	25		5979669	5979697	8421504	2	17,8	0,20	c	350004608500000001,350004608500000002	17-38,0-21						核酸を含有する肺高血圧症治療剤 - IP.com	ip.com/patfam/ja/	0	0		
630	chrIII	5985695	5985740	3500373709	45		5985695	5985740	8421504	1	45	0	p	350037370900015234	0-45						Cdk4 (cyclin dependent kinase 4) binding proteins	Draetta	1995	0		
630	chrIII	5996555	5996581	3500017068	23		5996555	5996581	8421504	2	14,9	0,17	g	350001706800000122	9-45						Neutrophil inhibitors	Moyle	1995	0		
631	chrIII	6049367	6049393	3500446311	23		6049367	6049393	8421504	2	10,13	0,13	c	350044631100000037	0-23						Evolution of gene expression and gene-regulatory sequences in Drosophila melanogaster	b.uni-muenchen.de	0	0		
631	chrIII	6056299	6056325	3500386452	26		6056299	6056325	8421504	1	26	0	c	350038645200000060	4-30						NEUROPROTECTIVE MOLECULES AND METHODS OF TREATING NEUROLOGICAL DISORDERS AND INDUCING STRESS GRANULES	Anderson	2011	0		
631	chrIII	6056299	6056325	3500235647	26		6056299	6056325	8421504	1	26	0	c	350023564700000060	4-30						NEUROPROTECTIVE MOLECULES AND METHODS OF TREATING NEUROLOGICAL DISORDERS AND INDUCING STRESS GRANULES - Patent application	www.faqs.org	0	0		
631	chrIII	6066052	6066095	3500036675	35		6066052	6066095	8421504	4	6,14,8,7	0,9,27,36	c	350003667500000140,350003667500000077	0-20,10-36						<Html><Title> Complet list of 1gpd hssp file Complet list of	cnptia.embrapa.br	0	0		
631	chrIII	6066053	6066095	3500126508	36		6066053	6066095	8421504	3	5,15,16	0,7,26	c	350012650800000302,350012650800000034	5-25,0-22						<Html><Title> Complet list of 3ccx hssp file Complet list of	cnptia.embrapa.br	0	0		
631	chrIII	6066060	6066096	3500406671	32		6066060	6066096	8421504	3	15,5,12	0,18,24	c	350040667100000635	1-33						<Html><Title> Complet list of 3eew hssp file Complet list of	cnptia.embrapa.br	0	0		
631	chrIII	6066064	6066095	3500226963	24		6066064	6066095	8421504	3	11,6,7	0,15,24	c	350022696300000313	0-24						<Html><Title> Complet list of 1juk hssp file Complet list of	cnptia.embrapa.br	0	0		
631	chrIII	6066064	6066095	3500143070	25		6066064	6066095	8421504	3	11,7,7	0,15,24	c	350014307000000368	23-48						<Html><Title> Complet list of 3a2p hssp file Complet list of	cnptia.embrapa.br	0	0		
631	chrIII	6066066	6066097	3500029769	27		6066066	6066097	8421504	2	9,18	0,13	c	350002976900000131	9-36						<Html><Title> Complet list of 1aye hssp file Complet list of	cnptia.embrapa.br	0	0		
631	chrIII	6066068	6066103	3500458978	30		6066068	6066103	8421504	3	7,16,7	0,11,28	c	350045897800000223	0-30						<Html><Title> Complet list of 1v9n hssp file Complet list of	cnptia.embrapa.br	0	0		
631	chrIII	6066068	6066095	3500412506	23		6066068	6066095	8421504	2	8,15	0,12	c	350041250600000274	0-23						<Html><Title> Complet list of 1cyf hssp file Complet list of	cnptia.embrapa.br	0	0		
631	chrIII	6066069	6066097	3500114040	24		6066069	6066097	8421504	2	6,18	0,10	c	350011404000000036	0-24						<Html><Title> Complet list of 1dan hssp file Complet list of	cnptia.embrapa.br	0	0		
631	chrIII	6083425	6083594	3500093126	23		6083425	6083594	8421504	2	6,17	0,152	c	350009312600000159	10-33						Production of 3-hydroxypropionic acid using beta-alanine/pyruvate aminotransferase - US Patent 7700319 Description	ww.patentstorm.us	0	0		
631	chrIII	6086914	6086939	3500326488	23		6086914	6086939	8421504	2	16,7	0,18	c	350032648800000006	0-23						Poster Presentations	ecmm.eu/files/TIM	0	0		
631	chrIII	6086914	6086939	3500326361	23		6086914	6086939	8421504	2	16,7	0,18	c	350032636100000009	0-23						grecia	www.scribd.com	0	0		
631	chrIII	6118689	6118713	3500167682	23		6118689	6118713	8421504	2	12,11	0,13	g	350016768200000156	0-23						METHODS AND COMPOSITIONS FOR TARGETED POLYNUCLEOTIDE MODIFICATION - Patent application	www.faqs.org	0	0		
631	chrIII	6120932	6120958	3500347444	24		6120932	6120958	8421504	2	8,16	0,10	c	350034744400000011,350034744400000010	0-24,4-28						Green fluorescent proteins and blue fluorescent proteins	Osumi	1998	0		
631	chrIII	6120932	6120958	3500180403	24		6120932	6120958	8421504	2	8,16	0,10	c	350018040300000011,350018040300000010	0-24,4-28					Patent	Green fluorescent proteins and blue fluorescent proteins (Patent US:6194548)	Osumi	2001	0		
631	chrIII	6147424	6147450	3500252890	23		6147424	6147450	8421504	2	8,15	0,11	c,g	350025289000000432,350025289000000432	0-34,0-34						Neisseria meningitidis antigens and compositions	Fraser	2012	0		
631	chrIII	6159356	6159381	3500183987	23		6159356	6159381	8421504	2	6,17	0,8	g	350018398700000151	13-36						Eubacterial minicells and their use as vectors for nucleic acid delivery and expression - Patent # 7183105 - PatentGenius	.patentgenius.com	0	0		
632	chrIII	6162997	6167128	3500394430	41		6162997	6167128	8421504	2	20,21	0,4110	c	350039443000000509,350039443000000272	12-32,2-23						1. INTRODUÇÃO 1.1- O parasita	www.bdtd.ucb.br	0	0		
632	chrIII	6165236	6168478	3500183389	2307		6165236	6168478	8421504	6	265,145,24,736,1077,60	0,862,1152,1230,2019,3182	c,g	350018338900000013,350018338900000013	0-2307,0-2307						Mammalian Alpha-kinase Proteins, Nucleic Acids And Diagnostic And Therapeutic Uses Thereof 	.freshpatents.com	0	0		
632	chrIII	6172362	6172387	3500322748	23		6172362	6172387	8421504	3	13,4,6	0,14,19	c	350032274800001995	20-43						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
632	chrIII	6191103	6191127	3500311218	24		6191103	6191127	8421504	1	24	0	c	350031121800000046	3-27						<Html><Title> Complet list of 1lpb hssp file Complet list of	cnptia.embrapa.br	0	0		
632	chrIII	6206742	6207878	3500027005	752		6206742	6207878	8421504	6	8,120,141,150,133,200	0,30,198,384,633,936	g	350002700500000000	162-914						blast序列比对怎么条参数，总出现No significant similarity found?_百度知道	zhidao.baidu.com	0	0		
632	chrIII	6281179	6281300	3500335263	23		6281179	6281300	8421504	3	6,4,13	0,99,108	c	350033526300000162	15-42						Parasitic nematode transglutaminase proteins, nucleic acid molecules, and uses thereof	Chandrashekar	1999	0		
632	chrIII	6281179	6281300	3500008109	23		6281179	6281300	8421504	3	6,4,13	0,99,108	c	350000810900000163	15-42						Parasitic nematode transglutaminase proteins and uses thereof	Chandrashekar	1997	0		
633	chrIII	6335202	6335230	3500414846	23		6335202	6335230	8421504	2	11,12	0,16	c	350041484600001031	5-30						Rank Transcription unit Names NtcA site Downstream of ntcA site Position of ntcA site Score -10 like	coitweb.uncc.edu	0	0		
633	chrIII	6335271	6335295	3500238921	24		6335271	6335295	8421504	1	24	0	c	350023892100000001	10-34		19047463	10.1083/jcb.200806088		The Journal of Cell Biology	μ2 adaptin facilitates but is not essential for synaptic vesicle recycling in Caenorhabditis elegans	Mingyu	2008	0		
633	chrIII	6339574	6339602	3500417701	24		6339574	6339602	8421504	2	12,12	0,16	g	350041770100000002	10-42						Structure, Vol. 9, 1225–1236, December, 2001, Crystallographic and Modeling Studies of RNase III Suggest a Mechanism for Double-Stranded RNA Cleavage	mcl1.ncifcrf.gov	0	0		
633	chrIII	6374361	6374495	3500288532	134		6374361	6374495	8421504	1	134	0	c,g	350028853200000022,350028853200000022	0-134,0-134						ScienceDirect.com - Genomics - A combined computational and experimental analysis of two families of snoRNA genes from Caenorhabditis elegans, revealing the expression and evolution pattern of snoRNAs in nematodes	sciencedirect.com	0	0		
633	chrIII	6395650	6395698	3500342283	48		6395650	6395698	8421504	1	48	0	p	350034228300015005	0-48						Stress Tolerant Transgenic Wheat Plant 	.freshpatents.com	0	0		
633	chrIII	6397714	6397740	3500336276	23		6397714	6397740	8421504	2	7,16	0,10	g	350033627600002907	3-26						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
633	chrIII	6397714	6397740	3500209433	23		6397714	6397740	8421504	2	7,16	0,10	g	350020943300002829	3-26						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
633	chrIII	6402605	6402633	3500377845	23		6402605	6402633	8421504	3	6,12,5	0,9,23	g	350037784500000019	1-24		20197377	10.1261/rna.2013110	1355-8382	RNA	Four exons of the serotonin receptor 4 gene are associated with multiple distant branch points	Hallegger	2010	5		
79	chrIII	6403897	6464366	3500057948	63		6403897	6464366	8421504	7	15,4,4,12,9,8,11	0,16,21,28508,28524,60447,60458	g	350005794800000092,350005794800000066,350005794800000031,350005794800000398	0-23,0-20,12-33,6-25						Nucleic Acid Molecules Encoding Fatty Acid Desaturase Genes from Plants and Methods of Use - Patent application	www.faqs.org	0	0		
633	chrIII	6403897	6403922	3500228214	23		6403897	6403922	8421504	3	15,4,4	0,16,21	g	350022821400000133	0-23						Method To Develop High Oleic Acid Soybeans Using Conventional Soybean Breeding Techniques - Patent application	www.faqs.org	0	0		
634	chrIII	6423845	6424170	3500384752	279		6423845	6424170	8421504	3	33,63,183	0,36,142	p	350038475200015122,350038475200015120	0-105,0-174						48 human secreted proteins	Komatsoulis	2002	0		
634	chrIII	6423845	6424170	3500375425	279		6423845	6424170	8421504	3	33,63,183	0,36,142	p	350037542500015122,350037542500015120	0-105,0-174						48 human secreted proteins	Komatsoulis	2000	0		
634	chrIII	6427227	6435566	3500178220	38		6427227	6435566	8421504	3	19,7,12	0,8318,8327	c,g	350017822000001774,350017822000001774,350017822000002096	10-29,10-29,4-23						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
634	chrIII	6441519	6441545	3500413736	26		6441519	6441545	8421504	1	26	0	c	350041373600000047	9-35						Serine Hydroxymethyltransferase as Target for Herbicides - Patent application	www.faqs.org	0	0		
634	chrIII	6447683	6447707	3500180164	24		6447683	6447707	8421504	1	24	0	g	350018016400000018,350018016400000017	0-24,0-24		17660295	10.1074/jbc.M703305200	0021-9258	Journal of Biological Chemistry	Transcriptional Regulation of AQP-8, a Caenorhabditis elegans Aquaporin Exclusively Expressed in the Excretory System, by the POU Homeobox Transcription Factor CEH-6	Mah	2007	5		
634	chrIII	6449342	6449372	3500290366	24		6449342	6449372	8421504	3	4,13,7	0,5,23	c	350029036600000210	21-48						FUNGUS RESISTANT PLANTS AND THEIR USES - Patent application	www.faqs.org	0	0		
634	chrIII	6457666	6457690	3500461534	24		6457666	6457690	8421504	1	24	0	c	350046153400000012	6-30						Staphylococcus epidermidis saeR Is an Effector of Anaerobic Growth and a Mediator of Acute Inflammation	iai.asm.org	0	0		
634	chrIII	6492428	6492454	3500228395	24		6492428	6492454	8421504	2	18,6	0,20	c	350022839500000103	4-28						<Html><Title> Complet list of 1hxt hssp file Complet list of	cnptia.embrapa.br	0	0		
634	chrIII	6506272	6506307	3500323108	28		6506272	6506307	8421504	3	8,5,15	0,13,20	c	350032310800000209	12-47						Plant genes and uses thereof	J*M*Sa Er Mi Long 	2002	0		
634	chrIII	6514647	6519088	3500337592	50		6514647	6519088	8421504	2	25,25	0,4416	c,g	350033759200000016,350033759200000015	0-25,0-25		19432959	10.1186/1749-8104-4-16	1749-8104	Neural Development	Interactions between innexins UNC-7 and UNC-9 mediate electrical synapse specificity in the Caenorhabditis elegans locomotory nervous system	Starich	2009	4		
634	chrIII	6519324	6519353	3500361132	29		6519324	6519353	8421504	1	29	0	c,g	350036113200000031,350036113200000031	16-45,16-45		16911797	10.1186/1741-7007-4-26	1741-7007	BMC Biology	Initiation of male sperm-transfer behavior in Caenorhabditis elegans requires input from the ventral nerve cord	Schindelman	2006	6		
634	chrIII	6542097	6542121	3500272859	23		6542097	6542121	8421504	2	14,9	0,15	g	350027285900000082	16-39						Her4 human receptor tyrosine kinase or the epidermal growth factor receptor family		1996	0		
635	chrIII	6607460	6607484	3500178361	24		6607460	6607484	8421504	1	24	0	c	350017836100000005	22-46						 SpringerImages - Primer sequences for candidate normalization genes. 	pringerimages.com	0	0		
635	chrIII	6607460	6607484	3500140879	24		6607460	6607484	8421504	1	24	0	c	350014087900000005	22-46						BMC Molecular Biology BioMed Central	biomedcentral.com	0	0		
635	chrIII	6607780	6607825	3500029357	45		6607780	6607825	8421504	1	45	0	p	350002935700015079	0-45						Polypeptides having C4 Dicarboxylic Acid Transporter Activity and Polynucleotides Encoding Same - Patent application	www.faqs.org	0	0		
635	chrIII	6633364	6642032	3500005682	170		6633364	6642032	8421504	8	37,9,20,20,20,20,24,20	0,38,1504,1741,3076,3268,5383,8648	c,g	350000568200000002,350000568200000009,350000568200000011,350000568200000011,350000568200000013,350000568200000013,350000568200000014,350000568200000014,350000568200000012,350000568200000008,350000568200000008,350000568200000003	0-21,0-25,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-24,0-24,0-20						PDF receptor signaling in Caenorhabditis elegans modulates locomotion and egg-laying. - ResearchGate	.researchgate.net	0	0		
635	chrIII	6633385	6633411	3500340282	25		6633385	6633411	8421504	2	16,9	0,17	g	350034028200000001	0-25						FUNCTIONAL CHARACTERIZATION OF THREE G PROTEIN-COUPLED RECEPTORS CAENORHABDITIS ELEGANS	digilabglobal.com	0	0		
635	chrIII	6646560	6646592	3500344284	27		6646560	6646592	8421504	3	6,16,5	0,8,27	g	350034428400000398	2-29						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
635	chrIII	6678309	6678333	3500274581	24		6678309	6678333	8421504	1	24	0	g	350027458100000211	17-41							n.biotec.uiuc.edu	0	0		
635	chrIII	6682171	6682194	3500100486	23		6682171	6682194	8421504	1	23	0	g	350010048600000005	13-36						Cytoplasmic inhibition of gene expression and expression of a foreign protein in a monocot plant by a plant viral vector	Holzberg	2003	0		
636	chrIII	6692985	6699693	3500240414	186		6692985	6699693	8421504	9	20,19,22,23,19,19,19,26,19	0,683,3714,3822,4383,4470,4968,6219,6689	c,g	350024041400000011,350024041400000013,350024041400000007,350024041400000009,350024041400000002,350024041400000002,350024041400000014,350024041400000014,350024041400000012,350024041400000012,350024041400000006,350024041400000008,350024041400000008	0-20,0-19,7-29,0-23,0-19,0-19,0-19,0-19,0-19,0-19,0-26,0-19,0-19		11717359		0270-6474	The Journal of Neuroscience	Rabphilin Potentiates Soluble N-Ethylmaleimide Sensitive Factor Attachment Protein Receptor Function Independently of rab3	Staunton	2001	7		
636	chrIII	6703189	6703221	3500238225	25		6703189	6703221	8421504	3	5,6,14	0,8,18	c	350023822500000086	4-29						Index Seq ID Count Primer type Orientation Start Len tm GC% Any compl 3' compl Seq Prod size Seq len	openwetware.org	0	0		
636	chrIII	6721644	6721673	3500466671	24		6721644	6721673	8421504	2	16,8	0,21	c,g	350046667100000003,350046667100000003	6-30,6-30						Molecular analysis of the anaerobic rumen fungus Orpinomyces – insights into an AT-rich genome	c.sgmjournals.org	0	0		
636	chrIII	6732137	6732160	3500342384	23		6732137	6732160	8421504	1	23	0	c	350034238400000402,350034238400000403	18-41,18-41						Compositions and methods for inhibiting expression of a gene from the JC virus	Tan	2007	0		
636	chrIII	6732137	6732160	3500323036	23		6732137	6732160	8421504	1	23	0	c	350032303600000402,350032303600000401	18-41,18-41						COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF A GENE FROM THE JC VIRUS - Patent application	www.faqs.org	0	0		
636	chrIII	6736903	6796932	3500336433	1612		6736903	6796932	8421504	71	23,23,23,24,23,23,23,23,23,23,23,24,23,26,23,23,23,23,22,22,23,23,23,23,23,20,23,20,23,23,23,23,22,20,4,24,22,19,19,24,20,37,22,22,22,23,21,23,22,23,32,21,20,23,21,24,20,23,23,20,22,21,23,20,23,23,23,23,39,23,23	0,581,5752,8163,11272,11647,12025,12177,12215,12568,12772,12869,13112,14262,14309,14984,15029,15248,15760,16260,17937,18870,19656,20670,21715,23049,24808,25009,25278,25622,26034,26460,27345,27395,27416,27754,30059,30243,31512,31613,31939,35586,35868,36079,36291,36597,36782,37053,37974,38067,38997,39075,39387,40179,40697,42958,48983,49839,50955,52545,53428,54023,54392,54504,55714,56299,56631,56702,56851,57465,60006	c,g	350033643300000001,350033643300000115,350033643300000115,350033643300000002,350033643300000003,350033643300000004,350033643300000005,350033643300000006,350033643300000007,350033643300000008,350033643300000009,350033643300000010,350033643300000010,350033643300000011,350033643300000011,350033643300000012,350033643300000012,350033643300000013,350033643300000013,350033643300000014,350033643300000014,350033643300000019,350033643300000019,350033643300000018,350033643300000020,350033643300000020,350033643300000021,350033643300000021,350033643300000022,350033643300000022,350033643300000023,350033643300000023,350033643300000024,350033643300000024,350033643300000026,350033643300000025,350033643300000025,350033643300000027,350033643300000027,350033643300000028,350033643300000028,350033643300000029,350033643300000029,350033643300000030,350033643300000031,350033643300000031,350033643300000033,350033643300000033,350033643300000035,350033643300000035,350033643300000036,350033643300000034,350033643300000037,350033643300000037,350033643300000038,350033643300000038,350033643300000039,350033643300000039,350033643300000040,350033643300000054,350033643300000054,350033643300000041,350033643300000041,350033643300000042,350033643300000042,350033643300000059,350033643300000059,350033643300000046,350033643300000046,350033643300000047,350033643300000047,350033643300000048,350033643300000048,350033643300000049,350033643300000052,350033643300000052,350033643300000069,350033643300000069,350033643300000053,350033643300000053,350033643300000068,350033643300000070,350033643300000070,350033643300000060,350033643300000060,350033643300000061,350033643300000061,350033643300000050,350033643300000050,350033643300000062,350033643300000062,350033643300000066,350033643300000066,350033643300000067,350033643300000067,350033643300000072,350033643300000072,350033643300000073,350033643300000073,350033643300000074,350033643300000055,350033643300000055,350033643300000057,350033643300000051,350033643300000051,350033643300000058,350033643300000076,350033643300000076,350033643300000077,350033643300000077,350033643300000078,350033643300000078,350033643300000079,350033643300000079,350033643300000093,350033643300000093,350033643300000080,350033643300000080,350033643300000081,350033643300000081,350033643300000083,350033643300000083,350033643300000084,350033643300000084,350033643300000086,350033643300000086,350033643300000085,350033643300000085,350033643300000087,350033643300000087,350033643300000088,350033643300000088,350033643300000091,350033643300000091,350033643300000089,350033643300000089,350033643300000090,350033643300000090,350033643300000092,350033643300000092,350033643300000116,350033643300000116	10-33,0-23,0-23,10-33,9-33,0-23,0-23,0-23,0-23,13-36,9-32,13-36,13-36,14-37,14-37,0-23,0-23,9-33,9-33,0-23,0-23,0-23,0-23,6-28,0-23,0-23,0-23,0-23,0-24,0-24,0-23,0-23,19-41,19-41,7-29,18-40,18-40,0-23,0-23,0-23,0-23,0-23,0-23,0-23,0-23,0-23,2-22,2-22,13-36,13-36,7-27,0-23,0-23,0-23,0-23,0-23,0-23,0-23,0-22,4-28,4-28,0-24,0-24,13-35,13-35,8-27,8-27,19-38,19-38,8-32,8-32,18-38,18-38,7-27,7-28,7-28,0-22,0-22,0-22,0-22,0-22,0-22,0-22,6-28,6-28,0-23,0-23,6-27,6-27,0-23,0-23,0-22,0-22,0-23,0-23,0-22,0-22,0-20,0-20,0-21,7-27,7-27,0-23,0-21,0-21,0-24,0-20,0-20,0-23,0-23,0-23,0-23,7-27,7-27,1-23,1-23,19-40,19-40,0-23,0-23,7-27,7-27,0-23,0-23,9-32,9-32,13-36,13-36,0-23,0-23,0-23,0-23,9-32,9-32,0-23,0-23,0-21,0-21,0-23,0-23,0-23,0-23						Two genes, dig-1 and mig-10, involved in nervous system development in C.elegans	www.wpi.edu	0	0		
636	chrIII	6747093	6749348	3500441714	228		6747093	6749348	8421504	5	41,18,78,53,38	0,1611,1632,2074,2217	c,g	350044171400000001,350044171400000009,350044171400000009	0-307,21-42,21-42						RASE: Recognition of alternatively Spliced Exons in C. elegans — Raetsch-Lab	raetschlab.org	0	0		
636	chrIII	6751240	6751264	3500007448	23		6751240	6751264	8421504	2	15,8	0,16	c	350000744800000572	7-30						<HTML><HEAD><meta http-equiv="Content-Type" content="text/html; charset=ISO-8859-1"><LINK REL="SHORT	.economie.fgov.be	0	0		
79	chrIII	6815554	6841002	3500141365	41		6815554	6841002	8421504	4	6,16,13,6	0,7,25426,25442	c,g	350014136500003308,350014136500000305,350014136500000305	13-38,19-38,19-38						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
637	chrIII	6815915	6815938	3500456286	23		6815915	6815938	8421504	1	23	0	g	350045628600000519	4-27						HWI-ST314_0077:4:1:20641:10005#0 0 gi|6322960|ref|NC_001144.1| 456546 0 101M * 0 0 CAAATTAAGCCGCAGGC	.toulouse.inra.fr	0	0		
637	chrIII	6824933	6848825	3500370302	479		6824933	6848825	8421504	21	20,22,23,23,20,24,24,21,23,24,22,22,22,25,24,22,23,23,24,24,24	0,190,3794,4246,5539,7470,7881,10284,11523,13371,13550,14038,14339,14677,15088,15750,16187,17195,18279,18690,23868	c,g	350037030200000019,350037030200000000,350037030200000002,350037030200000002,350037030200000001,350037030200000020,350037030200000020,350037030200000004,350037030200000003,350037030200000021,350037030200000005,350037030200000015,350037030200000022,350037030200000022,350037030200000012,350037030200000012,350037030200000018,350037030200000008,350037030200000008,350037030200000007,350037030200000007,350037030200000016,350037030200000016,350037030200000014,350037030200000014,350037030200000013,350037030200000010,350037030200000010,350037030200000009,350037030200000009,350037030200000011,350037030200000011	7-27,0-22,0-23,0-23,0-23,5-25,5-25,0-24,0-24,7-28,0-23,0-24,6-28,6-28,0-22,0-22,0-22,0-25,0-25,0-24,0-24,0-22,0-22,0-23,0-23,0-23,0-24,0-24,0-24,0-24,0-24,0-24		20497576	10.1186/1471-213X-10-55	1471-213X	BMC Developmental Biology	 C. elegans ten-1 is synthetic lethal with mutations in cytoskeleton regulators, and enhances many axon guidance defective mutants	MAPrck	2010	3		
637	chrIII	6830346	6846725	3500425381	263		6830346	6846725	8421504	10	20,14,46,21,20,20,20,22,20,60	0,55,114,3862,8207,8626,9832,10774,11587,16319	p,c,g	350042538100000012,350042538100000012,350042538100015000,350042538100000013,350042538100000013,350042538100000003,350042538100000003,350042538100000014,350042538100000015,350042538100000015,350042538100000001,350042538100000001,350042538100000000,350042538100000000,350042538100015001	0-20,0-20,0-60,0-21,0-21,0-20,0-20,0-20,0-20,0-20,21-43,21-43,0-20,0-20,0-60						ScienceDirect.com - Developmental Biology - ten-1, an essential gene for germ cell development, epidermal morphogenesis, gonad migration, and neuronal pathfinding in Caenorhabditis elegans	sciencedirect.com	0	0		
637	chrIII	6834868	6846725	3500349026	43		6834868	6846725	8421504	2	23,20	0,11837	c,g	350034902600000010,350034902600000011,350034902600000011	9-32,11-31,11-31		21795395	10.1091/mbc.E10-10-0853	1059-1524	Molecular Biology of the Cell	Genetic interaction between Caenorhabditis elegans teneurin ten-1 and prolyl 4-hydroxylase phy-1 and their function in collagen IV–mediated basement membrane integrity during late elongation of the embryo	Topf	2011	5		
637	chrIII	6857344	6872655	3500003185	49		6857344	6872655	8421504	3	18,8,23	0,23,15288	g	350000318500000213,350000318500000946	5-31,17-42						Anti-bacterial methods and materials	Holden	2000	0		
637	chrIII	6857344	6857375	3500352303	26		6857344	6857375	8421504	2	18,8	0,23	g	350035230300000195	5-31						Anti-bacterial methods and materials	Holden	2000	0		
637	chrIII	6861448	6861603	3500058474	63		6861448	6861603	8421504	2	51,12	0,143	p	350005847400015006	0-63						Genetic Characterization and Cloning of Mothers against dpp, a Gene Required for decapentuplegic Function in DrosqPhila melanogaster	www.genetics.org	0	0		
637	chrIII	6910044	6912082	3500197656	171		6910044	6912082	8421504	4	60,60,24,27	0,872,938,2011	p	350019765600015231,350019765600015230,350019765600015242,350019765600015243	0-60,0-60,0-51,0-57						Karakterisatie van neuromedine U-, tachykinine- en GnRH-verwante receptoren	w.scriptiebank.be	0	0		
637	chrIII	6915472	6915495	3500083511	23		6915472	6915495	8421504	1	23	0	g	350008351100000000	0-23						T07E3.1: sEx14642 | Flickr - Photo Sharing!	www.flickr.com	0	0		
637	chrIII	6928769	6928795	3500364807	26		6928769	6928795	8421504	1	26	0	g	350036480700000010	0-26			10.1371/journal.pgen.0030056		PLoS Genetics	Lifespan Regulation by Evolutionarily Conserved Genes Essential for Viability	Sean	2007	0		
637	chrIII	6930099	6931347	3500152586	45		6930099	6931347	8421504	3	21,6,18	0,1169,1230	c,g	350015258600000002,350015258600000002,350015258600000003	0-21,0-21,0-24		18298590	10.1111/j.1600-0854.2008.00712.x	1600-0854	Traffic	ITSN-1 Controls Vesicle Recycling at the Neuromuscular Junction and Functions in Parallel with DAB-1 - Wang - 2008 - Traffic - Wiley Online Library	Wang	2008	0		
637	chrIII	6931205	6931444	3500272700	49		6931205	6931444	8421504	2	24,25	0,214	c,g	350027270000000014,350027270000000014,350027270000000015,350027270000000015	0-24,0-24,0-25,0-25						The regulation of hypoxia-inducible factor (HIF-1) and the role of HIF-1 in C. elegans longevity	ib.dr.iastate.edu	0	0		
79	chrIII	6938430	6966415	3500179812	43		6938430	6966415	8421504	4	4,17,8,14	0,5,27962,27971	c,g	350017981200000543,350017981200000271	5-26,18-40						水稻常用SSR分子标记_稻田统计爱好者_新浪博客	blog.sina.com.cn	0	0		
638	chrIII	6952904	7002375	3500144391	45		6952904	7002375	8421504	2	23,22	0,49449	c	350014439100000408,350014439100001105	20-43,12-34						SPIDER SILK DRAGLINE POLYNUCLEOTIDES, POLYPEPTIDES AND METHODS OF USE THEREOF - Patent application	www.faqs.org	0	0		
638	chrIII	6959427	6959755	3500280352	249		6959427	6959755	8421504	2	96,153	0,175	p	350028035200015005	0-249							y.engin.umich.edu	0	0		
638	chrIII	6959427	6959755	3500051404	249		6959427	6959755	8421504	2	96,153	0,175	p	350005140400015004	0-249						README for stand-alone BLAST (last updated 7/30/99) This document provides information on s	io.lundberg.gu.se	0	0		
638	chrIII	6970012	6970039	3500262398	27		6970012	6970039	8421504	1	27	0	g	350026239800000017	0-27						RNA TAGGING METHOD - MONASH UNIVERSITY	www.sumobrain.com	0	0		
638	chrIII	6971207	6971364	3500304926	69		6971207	6971364	8421504	4	4,28,24,13	0,52,108,144	c	350030492600000002	0-169						 上海交通大学木霉菌菌种保藏管理中心 	ww.china-cctc.org	0	0		
638	chrIII	6971207	6971287	3500211483	32		6971207	6971287	8421504	2	4,28	0,52	c	350021148300000002	98-130						 上海交通大学木霉菌菌种保藏管理中心 	ww.china-cctc.org	0	0		
638	chrIII	6971207	6971287	3500180255	32		6971207	6971287	8421504	2	4,28	0,52	c	350018025500000002	93-125						 上海交通大学木霉菌菌种保藏管理中心 	ww.china-cctc.org	0	0		
638	chrIII	6971207	6971287	3500111424	32		6971207	6971287	8421504	2	4,28	0,52	c	350011142400000002	98-130						 上海交通大学木霉菌菌种保藏管理中心 	ww.china-cctc.org	0	0		
638	chrIII	6971207	6971287	3500000403	32		6971207	6971287	8421504	2	4,28	0,52	c	350000040300000002	97-129						 上海交通大学木霉菌菌种保藏管理中心 	ww.china-cctc.org	0	0		
638	chrIII	6971255	6971293	3500011181	38		6971255	6971293	8421504	1	38	0	g	350001118100000037	22-60							www.plosone.org	0	0		
638	chrIII	6971255	6971287	3500022068	32		6971255	6971287	8421504	1	32	0	g	350002206800000002	141-173						 上海交通大学木霉菌菌种保藏管理中心 	ww.china-cctc.org	0	0		
638	chrIII	6971258	6971283	3500153848	25		6971258	6971283	8421504	1	25	0	g	350015384800000220	78-103						SNPs_from_T3.txt	ticeaetoolbox.org	0	0		
638	chrIII	6971264	6971293	3500287409	29		6971264	6971293	8421504	1	29	0	c	350028740900000002	0-29			10.1098/rspb.2006.3718		Proceedings of the Royal Society B: Biological Sciences	Mating trials validate the use of DNA barcoding to reveal cryptic speciation of a marine bryozoan taxon	Africa	2007	0		
638	chrIII	6971624	6974477	3500285490	44		6971624	6974477	8421504	2	19,25	0,2828	c,g	350028549000000003,350028549000000000,350028549000000000,350028549000000002,350028549000000002	11-30,0-25,0-25,12-37,12-37						National BioResource Project (NBRP)::C.elegans Promoter/Marker	.shigen.nig.ac.jp	0	0		
638	chrIII	6981251	6981278	3500327851	23		6981251	6981278	8421504	2	9,14	0,13	c	350032785100000010	0-23						発酵法によるヌクレオシド－５’－リン酸エステルの製造法 - 味の素株	www.patentjp.com	0	0		
638	chrIII	7019701	7019730	3500096750	27		7019701	7019730	8421504	2	10,17	0,12	g	350009675000000050	3-30						Methods and compositions for RNA Interference - Patent application	www.faqs.org	0	0		
638	chrIII	7024927	7025754	3500129913	40		7024927	7025754	8421504	2	21,19	0,808	c,g	350012991300000009,350012991300000009,350012991300000008,350012991300000008	0-21,0-21,0-19,0-19			10.1186/gb-2000-2-1-research0002	1465-6906	Genome Biology	Effectiveness of specific RNA-mediated interference through ingested double-stranded RNA in Caenorhabditis elegans	Kamath	2000	0		
638	chrIII	7041452	7041478	3500200720	23		7041452	7041478	8421504	2	9,14	0,12	g	350020072000000011	10-33						Genetic networks regulated by attenuated gh/igf1 signaling and caloric restriction	Bartke	2005	0		
638	chrIII	7041452	7041478	3500011930	23		7041452	7041478	8421504	2	9,14	0,12	g	350001193000000011	10-33						GENETIC NETWORKS REGULATED BY ATTENUATED GH/IGF1 SIGNALING AND CALORIC RESTRICTION - THE REGENTS OF THE UNIVERSITY OF CALIFORNIA	www.sumobrain.com	0	0		
638	chrIII	7067650	7068510	3500314777	648		7067650	7068510	8421504	4	308,187,96,57	0,416,661,803	p,g	350031477700000017,350031477700015059,350031477700015058,350031477700015057,350031477700015056,350031477700015054,350031477700015053,350031477700015052	0-648,0-45,0-45,0-45,0-45,0-45,0-45,0-45						Increasing lifespan by modulation of WWP-1 and UBC-18 - Patent application	www.faqs.org	0	0		
638	chrIII	7067823	7067846	3500376967	23		7067823	7067846	8421504	1	23	0	c,g	350037696700000009,350037696700000009	0-23,0-23						Formation, regulation and evolution of Caenorhabditis elegans 3′UTRs	tellab.wi.mit.edu	0	0		
639	chrIII	7080680	7080707	3500242967	23		7080680	7080707	8421504	3	4,5,14	0,5,13	c	350024296700000048	0-23						<Html><Title> Complet list of 1j2p hssp file Complet list of	cnptia.embrapa.br	0	0		
639	chrIII	7083817	7083843	3500063703	23		7083817	7083843	8421504	2	8,15	0,11	c,g	350006370300000178,350006370300000178	0-25,0-25						抑制rna干扰脱靶效应的特异性修饰	Du	2012	0		
639	chrIII	7095507	7115356	3500416104	101		7095507	7115356	8421504	5	20,20,20,20,21	0,819,17162,18858,19828	c,g	350041610400000009,350041610400000009,350041610400000011,350041610400000011,350041610400000013,350041610400000013,350041610400000014,350041610400000014,350041610400000012,350041610400000012	0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-21,0-21		10022975	10.1101/gr.9.2.103	1088-9051	Genome Research	The Nuclear Receptor Superfamily Has Undergone Extensive Proliferation and Diversification in Nematodes	Sluder	1999	14		
639	chrIII	7102187	7102213	3500353725	23		7102187	7102213	8421504	2	12,11	0,15	c	350035372500000001	0-23						BIOMETRICAL AND TRANSFORMATION STUDIES IN TOMATO ( Solanum lycopersicum L.)	etd.uasd.edu	0	0		
639	chrIII	7103722	7103767	3500185504	45		7103722	7103767	8421504	1	45	0	p	350018550400015003	0-45						Methods and Compositions for Concentrating Secreted Recombinant Protein - Patent application	www.faqs.org	0	0		
639	chrIII	7103975	7104003	3500149344	25		7103975	7104003	8421504	2	19,6	0,22	g	350014934400000038	19-44						Gain of function mutations in ATP-dependent transposition proteins	Craig	1998	0		
639	chrIII	7116792	7142755	3500369768	41		7116792	7142755	8421504	5	6,14,10,2,9	0,7,25894,25947,25954	c,g	350036976800000164,350036976800000031	3-23,4-25						J. Lichtenzveig Æ C. Scheuring Æ H.-B. Zhang Construction of BAC and BIBAC libraries and their applications for generation of SSR markers for genome analysis of chickpea, Cicer arietinumL.	s.agri.huji.ac.il	0	0		
639	chrIII	7127266	7127291	3500023367	24		7127266	7127291	8421504	2	17,7	0,18	c	350002336700000004	18-42						【求助】关于BSP引物设计及Methyl Primer Express软件（ABI）使用中的一些问题 - PCR技术讨论ܤ	www.dxy.cn/bbs/to	0	0		
639	chrIII	7149153	7149180	3500227481	27		7149153	7149180	8421504	1	27	0	c	350022748100000002	0-27						Caenorhabditis elegansortholog of a diabetes susceptibility locus: oga-1(O-GlcNAcase) knockout impacts O-GlcNAc cycling, metabolism, and dauer	www.pnas.org	0	0		
639	chrIII	7169996	7170020	3500373949	23		7169996	7170020	8421504	2	15,8	0,16	c,g	350037394900000042,350037394900000042	0-36,0-36						Cellulases	Abad	1998	0		
639	chrIII	7180810	7181038	3500061039	23		7180810	7181038	8421504	4	6,11,1,5	0,9,220,223	c	350006103900000172	5-28						Identification of Candidate Vaccine Antigens from Dichelobacter Nodosus - Patent application	www.faqs.org	0	0		
639	chrIII	7182294	7183718	3500298220	675		7182294	7183718	8421504	18	18,27,45,45,45,45,45,45,45,45,29,16,45,45,27,18,45,45	0,208,238,286,427,475,523,571,717,765,813,1071,1090,1186,1234,1310,1331,1379	p	350029822000015070,350029822000015071,350029822000015072,350029822000015074,350029822000015075,350029822000015076,350029822000015077,350029822000015079,350029822000015080,350029822000015081,350029822000015082,350029822000015084,350029822000015085,350029822000015086,350029822000015087	0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45						Novel apoptosis gene EI24, compositions, and methods of use - Patent application	www.faqs.org	0	0		
639	chrIII	7197051	7197083	3500310197	32		7197051	7197083	8421504	1	32	0	g	350031019700000033	0-32						Novocraft Short Read Alignment Suite	ing.bio.cam.ac.uk	0	0		
639	chrIII	7204599	7204623	3500052099	23		7204599	7204623	8421504	2	18,5	0,19	g	350005209900000200	14-37						Card Domain Containing Polypeptides, Encoding Nucleic Acids, And Methods Of Use 	.freshpatents.com	0	0		
639	chrIII	7208471	7208798	3500354245	100		7208471	7208798	8421504	2	50,50	0,277	c,g	350035424500000014,350035424500000014,350035424500000016,350035424500000016,350035424500000018	0-100,0-100,0-21,0-21,0-22						perl程序提取数字和相应内容_百度知道	zhidao.baidu.com	0	0		
79	chrIII	7208959	7209091	3500288532	132		7208959	7209091	8421504	1	132	0	g	350028853200000019	0-132						ScienceDirect.com - Genomics - A combined computational and experimental analysis of two families of snoRNA genes from Caenorhabditis elegans, revealing the expression and evolution pattern of snoRNAs in nematodes	sciencedirect.com	0	0		
640	chrIII	7214360	7214386	3500284394	23		7214360	7214386	8421504	2	12,11	0,15	c	350028439400000356	6-31						RNAi INHIBITION OF INFLUENZA VIRUS REPLICATION	Fougerolles	2011	0		
640	chrIII	7214360	7214386	3500019915	23		7214360	7214386	8421504	2	12,11	0,15	g	350001991500000356	6-31						Rnai Inhibition Of Influenza Virus Replication 	.freshpatents.com	0	0		
640	chrIII	7216483	7216510	3500237532	24		7216483	7216510	8421504	3	12,5,7	0,14,20	c	350023753200000006	0-24						 Synthetic Insecticidal Crystal Protein Gene 	www.docstoc.com	0	0		
640	chrIII	7282402	7282426	3500466060	23		7282402	7282426	8421504	2	14,9	0,15	c	350046606000000025	21-44						Table S6: Leaderless mRNAs of C. jejuni NCTC 11168	biomedcentral.com	0	0		
640	chrIII	7336609	7338035	3500036764	363		7336609	7338035	8421504	12	1,44,45,37,8,45,31,17,45,45,12,33	0,57,104,152,315,374,515,604,768,1104,1152,1393	p	350003676400015120,350003676400015121,350003676400015122,350003676400015124,350003676400015215,350003676400015129,350003676400015135,350003676400015142,350003676400015143	0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45						COMPOUNDS, COMPOSITIONS AND METHODS FOR CONTROLLING INVERTEBRATE PESTS - Patent application	www.faqs.org	0	0		
641	chrIII	7360766	7360789	3500169448	23		7360766	7360789	8421504	1	23	0	c	350016944800000001	10-33						ROLE OF SUBCELLULAR DIFFERENTIATION IN PLANT DISEASE RESISTANCE Saara Susanna Lång DOCTOR OF PHILOSOPHY	cholar.lib.vt.edu	0	0		
641	chrIII	7456953	7456984	3500130734	29		7456953	7456984	8421504	3	14,10,5	0,15,26	c	350013073400000179	10-39						<Html><Title> Complet list of 3igz hssp file Complet list of	cnptia.embrapa.br	0	0		
642	chrIII	7496195	7497728	3500127924	42		7496195	7497728	8421504	2	21,21	0,1512	c,g	350012792400000002,350012792400000002,350012792400000001	9-30,9-30,12-33		11546739		0950-1991	Development	cgh-1, a conserved predicted RNA helicase required for gametogenesis and protection from physiological germline apoptosis in C. elegans	Navarro	2001	7		
642	chrIII	7510713	7510736	3500057006	23		7510713	7510736	8421504	1	23	0	c	350005700600000195,350005700600000079,350005700600000151	9-35,0-24,0-23						<HTML><HEAD><meta http-equiv="Content-Type" content="text/html; charset=ISO-8859-1"><LINK REL="SHORT	.economie.fgov.be	0	0		
642	chrIII	7522046	7522070	3500063657	23		7522046	7522070	8421504	2	7,16	0,8	c	350006365700000013	0-23						Universidade de Lisboa Faculdade de Medicina de Lisboa	repositorio.ul.pt	0	0		
642	chrIII	7528423	7535297	3500321934	140		7528423	7535297	8421504	5	24,27,21,45,23	0,603,1262,6185,6851	c,g	350032193400000007,350032193400000006,350032193400000004,350032193400000004,350032193400000002,350032193400000002,350032193400000001,350032193400000000	6-30,9-36,0-21,0-21,8-33,8-33,0-21,0-23						ScienceDirect.com - Mechanisms of Development - Transcriptional upregulation of the C. elegans Hox gene lin-39 during vulval cell fate specification	sciencedirect.com	0	0		
642	chrIII	7545005	7545029	3500421940	24		7545005	7545029	8421504	1	24	0	g	350042194000000005	0-24						ThemicroRNAs of Caenorhabditis elegans	cseweb.ucsd.edu	0	0		
642	chrIII	7549111	7558645	3500242592	77		7549111	7558645	8421504	3	37,20,20	0,5947,9514	g	350024259200000037,350024259200000036,350024259200000003,350024259200000004	0-24,0-37,0-20,0-20						Caenorhabditis elegansban - HOX kontroll?	teo.elte.hu	0	0		
642	chrIII	7556885	7556941	3500277311	56		7556885	7556941	8421504	1	56	0	g	350027731100000030	0-56						Open Access HOXB1 in autism spectrum disorder	lecularautism.com	0	0		
642	chrIII	7561747	7580884	3500168119	53		7561747	7580884	8421504	6	14,6,11,6,9,7	0,18,19098,19111,19119,19130	g	350016811900000110,350016811900000654	0-20,6-39						<Html><Title> Complet list of 2yvg hssp file Complet list of	cnptia.embrapa.br	0	0		
642	chrIII	7587747	7587785	3500121931	38		7587747	7587785	8421504	1	38	0	g	350012193100000034	0-38						Supporting Online Material for	mcb.berkeley.edu	0	0		
643	chrIII	7608375	7608407	3500173250	27		7608375	7608407	8421504	2	16,11	0,21	g	350017325000000221	0-27						Engineered Listeria and methods of use thereof	Dubensky	2006	0		
643	chrIII	7616494	7616518	3500172390	24		7616494	7616518	8421504	1	24	0	g	350017239000000001	0-24						T04A6.1: sIs12555 | Flickr - Photo Sharing!	www.flickr.com	0	0		
643	chrIII	7622580	7662580	3500208524	40000		7622580	7662580	8421504	1	40000	0	c,g	350020852400000000,350020852400000001,350020852400000001,350020852400000004,350020852400000002,350020852400000005,350020852400000003,350020852400000003,350020852400000011,350020852400000011,350020852400000012,350020852400000015,350020852400000007,350020852400000008,350020852400000017,350020852400000018,350020852400000009,350020852400000013,350020852400000019,350020852400000016,350020852400000016,350020852400000014,350020852400000010,350020852400000022,350020852400000020,350020852400000027,350020852400000033,350020852400000031,350020852400000029,350020852400000023,350020852400000030,350020852400000030,350020852400000032,350020852400000021,350020852400000025,350020852400000028,350020852400000034,350020852400000026	0-40000,0-360,0-360,0-356,0-356,0-355,0-360,0-360,0-373,0-373,0-377,0-297,0-300,0-291,0-369,0-791,0-231,0-300,20-632,0-280,0-280,3-358,17-380,0-327,0-763,26-739,0-298,0-299,0-299,0-351,0-360,0-360,0-237,0-338,0-633,0-549,0-358,43-597						SourceForge.net: Generic Model Organism Database Project: gmod-gbrowse-cmts	sourceforge.net	0	0		
643	chrIII	7639419	7639442	3500121430	23		7639419	7639442	8421504	1	23	0	c	350012143000000000	13-36						www.thyroidresearchjournal.com - Table 	searchjournal.com	0	0		
643	chrIII	7730730	7730757	3500158435	23		7730730	7730757	8421504	3	14,5,4	0,17,23	g	350015843500000033	7-30						<Html><Title> Complet list of 1ccg hssp file Complet list of	cnptia.embrapa.br	0	0		
644	chrIII	7737202	7780273	3500168684	38		7737202	7780273	8421504	4	5,14,5,14	0,7,43050,43057	g	350016868400001745,350016868400001047	1-20,16-35						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
644	chrIII	7766420	7766448	3500364807	28		7766420	7766448	8421504	1	28	0	c,g	350036480700000018,350036480700000018	0-28,0-28			10.1371/journal.pgen.0030056		PLoS Genetics	Lifespan Regulation by Evolutionarily Conserved Genes Essential for Viability	Sean	2007	0		
644	chrIII	7783192	7783217	3500183387	25		7783192	7783217	8421504	1	25	0	c	350018338700000162	10-35						Human Gene 	.freshpatents.com	0	0		
644	chrIII	7828522	7828549	3500364807	27		7828522	7828549	8421504	1	27	0	g	350036480700000003	0-27			10.1371/journal.pgen.0030056		PLoS Genetics	Lifespan Regulation by Evolutionarily Conserved Genes Essential for Viability	Sean	2007	0		
644	chrIII	7839137	7839860	3500263856	40		7839137	7839860	8421504	2	20,20	0,703	c,g	350026385600000002,350026385600000004	0-20,0-20		11493519		0950-1991	Development	A regulatory cascade of three homeobox genes, ceh-10, ttx-3 and ceh-23, controls cell fate specification of a defined interneuron class in C. elegans	Altun-Gultekin	2001	7		
644	chrIII	7859545	7859611	3500262826	66		7859545	7859611	8421504	1	66	0	p	350026282600015052	3-69						Untersuchungen zur Charakterisierung der Zusammensetzung, Biogenese und des Mechanismus der Proteintranslokase der mitochondrialen Außenmembran von Neurospora crassa	b.uni-muenchen.de	0	0		
644	chrIII	7860156	7860180	3500304045	24		7860156	7860180	8421504	1	24	0	c,g	350030404500000000,350030404500000000	0-24,0-24						ZK652.1 (snr-5): sEx16083 | Flickr - Photo Sharing!	www.flickr.com	0	0		
644	chrIII	7860540	7860784	3500083753	198		7860540	7860784	8421504	2	125,73	0,171	p	350008375300015123,350008375300015006	0-198,0-186						Isolierung und Charakterisierung von Kupferhomeostase-Faktoren aus Trametes versicolor und deren Einfluss auf die Laccase-Expression	b.uni-muenchen.de	0	0		
644	chrIII	7863256	7863279	3500426058	23		7863256	7863279	8421504	1	23	0	c	350042605800000077	1-24						<Html><Title> Complet list of 2v3z hssp file Complet list of	cnptia.embrapa.br	0	0		
645	chrIII	7868150	7868181	3500141880	31		7868150	7868181	8421504	1	31	0	g	350014188000000063	0-31						Caenorhabditis elegans: Molecular Genetics and Development	www.scribd.com	0	0		
645	chrIII	7895044	7928277	3500431125	40		7895044	7928277	8421504	4	7,14,6,13	0,11,33213,33220	c	350043112500000050,350043112500000098	13-34,0-19						Supplemental Table 1 Summary of Roche 454, Illumina GA, and ABI - 豆丁网	www.docin.com	0	0		
645	chrIII	7914688	7917693	3500461794	1830		7914688	7917693	8421504	7	126,78,66,873,386,155,146	0,238,322,1162,2218,2656,2859	p	350046179400015057,350046179400015045,350046179400015032,350046179400015019,350046179400015008	0-204,0-390,0-423,0-426,0-387						galactosaminyl-transferase with an unusual lectin domain from the platyhelminth parasite Echinococcus granulosus	www.biochemj.org	0	0		
645	chrIII	7928242	7928274	3500143070	27		7928242	7928274	8421504	3	5,5,17	0,8,15	c	350014307000000048	0-27						<Html><Title> Complet list of 3a2p hssp file Complet list of	cnptia.embrapa.br	0	0		
645	chrIII	7928249	7928277	3500451613	26		7928249	7928277	8421504	2	6,20	0,8	c	350045161300000126,350045161300000156	0-22,9-34						<Html><Title> Complet list of 3pmx hssp file Complet list of	cnptia.embrapa.br	0	0		
645	chrIII	7928249	7928274	3500008851	23		7928249	7928274	8421504	2	6,17	0,8	c	350000885100000244,350000885100000198	0-21,4-26						<Html><Title> Complet list of 1e32 hssp file Complet list of	cnptia.embrapa.br	0	0		
645	chrIII	7928257	7928281	3500306261	24		7928257	7928281	8421504	1	24	0	c	350030626100000628	16-40						<Html><Title> Complet list of 2b6p hssp file Complet list of	cnptia.embrapa.br	0	0		
645	chrIII	7945529	7948244	3500314727	162		7945529	7948244	8421504	6	21,29,42,22,20,28	0,1164,1304,1403,1801,2687	c,g	350031472700000001,350031472700000001,350031472700000003,350031472700000016,350031472700000016,350031472700000015,350031472700000011,350031472700000000,350031472700000000,350031472700000004,350031472700000008	9-30,9-30,8-37,0-22,0-22,0-42,8-30,9-29,9-29,9-29,0-28						Oxidative stress in Caenorhabditis elegans: protective effects of the Omega class glutathione transferase GSTO-1	www.fasebj.org	0	0		
645	chrIII	7962108	7962138	3500161875	26		7962108	7962138	8421504	2	16,10	0,20	c	350016187500000180	2-28						<Html><Title> Complet list of 6gpb hssp file Complet list of	cnptia.embrapa.br	0	0		
645	chrIII	7972658	7972681	3500249912	23		7972658	7972681	8421504	1	23	0	c,g	350024991200000003,350024991200000002,350024991200000002	2-25,0-22,0-22						 SOLiD SAGE v3 Analysis Software - SEQanswers	seqanswers.com	0	0		
645	chrIII	7981357	7981391	3500079184	31		7981357	7981391	8421504	2	25,6	0,28	c	350007918400000170	16-47						Histone Demethylation Mediated By The Nuclear Amine Oxidase Homolog LSD1 - Patent application	www.faqs.org	0	0		
645	chrIII	7981370	7982784	3500028396	43		7981370	7982784	8421504	3	17,5,21	0,1028,1393	c	350002839600000052	82-125						<!DOCTYPE HTML PUBLIC i3/4-//IETF//DTD HTML 3.0//ENi3/4> <!- SPECIFICATION OF LANGUAGE-> <HTML> 	wheat.pw.usda.gov	0	0		
645	chrIII	7983608	7984589	3500011898	40		7983608	7984589	8421504	2	20,20	0,961	c,g	350001189800000000,350001189800000000,350001189800000001,350001189800000001	0-20,0-20,0-20,0-20		22479198	10.1371/journal.pgen.1002602	1553-7404	PLOS Genetics	PLOS Genetics: The Atypical Calpains: Evolutionary Analyses and Roles in Caenorhabditis elegans Cellular Degeneration	Joyce	2012	0		
80	chrIII	7990837	7996367	3500063695	933		7990837	7996367	8421504	24	45,45,38,48,45,42,16,30,42,45,2,43,41,4,45,45,30,15,45,89,45,43,45,45	0,48,823,927,1023,1071,1118,1453,1486,1876,1924,2396,2442,2526,2581,2629,2677,3241,3259,3307,3529,3577,5437,5485	c,g	350006369500000712,350006369500000712,350006369500000711,350006369500000707,350006369500000706,350006369500000706,350006369500000704,350006369500000704,350006369500000703,350006369500000703,350006369500000791,350006369500000000,350006369500000702,350006369500000701,350006369500000701,350006369500000699,350006369500000698,350006369500000697,350006369500000695,350006369500000694,350006369500000694,350006369500000693,350006369500000692,350006369500000691,350006369500000691,350006369500000690,350006369500000689,350006369500000689,350006369500000688,350006369500000687,350006369500000686,350006369500000686	0-45,0-45,0-45,7-45,0-48,0-48,0-45,0-45,0-42,0-42,0-25,0-25,0-45,0-42,0-42,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-48,0-48,7-48,0-45,0-45,5-48,0-45,0-45,0-45						G protein-coupled receptor-like receptors and modulators thereof - US Patent 7208591 Description	ww.patentstorm.us	0	0		
645	chrIII	7991607	7991633	3500199912	24		7991607	7991633	8421504	2	10,14	0,12	g	350019991200000284	5-29						cons SSR Table ESM S2 primer seqs	wheat.pw.usda.gov	0	0		
646	chrIII	8017107	8017133	3500223858	26		8017107	8017133	8421504	1	26	0	c	350022385800000208	27-53							biomedcentral.com	0	0		
646	chrIII	8019921	8020191	3500309883	270		8019921	8020191	8421504	1	270	0	p	350030988300015145	0-270						THAP1, UN REGULATEUR CLE DE LA PROLIFERATION DES CELLULES ENDOTHELIALES : RELATIONS STRUCTURE/FONCTION ET GENES CIBLES	esups.ups-tlse.fr	0	0		
646	chrIII	8038785	8038808	3500250219	23		8038785	8038808	8421504	1	23	0	c	350025021900000022	9-32		17164292	10.1242/jcs.03313	0021-9533	Journal of Cell Science	A broad spectrum of actin paralogs in Paramecium tetraurelia cells display differential localization and function	Sehring	2007	6		
646	chrIII	8049596	8049635	3500121931	39		8049596	8049635	8421504	1	39	0	g	350012193100000031	0-39						Supporting Online Material for	mcb.berkeley.edu	0	0		
646	chrIII	8055533	8055556	3500141348	23		8055533	8055556	8421504	1	23	0	g	350014134800000007	6-29						ScienceDirect.com - Developmental Biology - Essential embryonic roles of the CKI-1 cyclin-dependent kinase inhibitor in cell-cycle exit and morphogenesis in C. elegans	sciencedirect.com	0	0		
646	chrIII	8061993	8068415	3500259118	48		8061993	8068415	8421504	2	24,24	0,6398	c,g	350025911800000001,350025911800000000,350025911800000000	8-32,24-48,24-48		12954713	10.1242/dev.00678	0950-1991	Development	Distinct roles of transcription factors EGL-46 and DAF-19 in specifying the functionality of a polycystin-expressing sensory neuron necessary for C. elegans male vulva location behavior	Yu	2003	7		
646	chrIII	8072466	8072490	3500018857	24		8072466	8072490	8421504	1	24	0	c	350001885700000001	20-44						 SpringerImages - PCR amplification primers used in this study 	pringerimages.com	0	0		
646	chrIII	8075981	8076167	3500273746	126		8075981	8076167	8421504	2	88,38	0,148	p	350027374600015017	0-126						Dicer recognizes the 5′ end of RNA for efficient and accurate processing	tbiotech.um.ac.ir	0	0		
646	chrIII	8079071	8080200	3500262760	42		8079071	8080200	8421504	2	21,21	0,1108	c,g	350026276000000005,350026276000000004,350026276000000004	0-21,0-21,0-21			10.1073/pnas.0508989102		Proceedings of the National Academy of Sciences of the United States of America	Negative regulation of nuclear divisions in Caenorhabditis elegans by retinoblastoma and RNA interference-related genes	Alla	2005	0		
646	chrIII	8079071	8080200	3500176962	42		8079071	8080200	8421504	2	21,21	0,1108	c,g	350017696200000001,350017696200000000,350017696200000000	0-21,0-21,0-21		15741313	10.1101/gad.1247705	0890-9369	Genes & Development	Transcriptional silencing of a transgene by RNAi in the soma of C. elegans	Grishok	2005	12		
646	chrIII	8079071	8080200	3500167276	42		8079071	8080200	8421504	2	21,21	0,1108	c,g	350016727600000001,350016727600000000,350016727600000000	0-21,0-21,0-21						Transcriptional silencing of a transgene by RNAi in the soma of C. elegans--《基因进展》医学期刊--医学期刊频道--首席医学网	journal.9med.net	0	0		
646	chrIII	8092419	8092442	3500197929	23		8092419	8092442	8421504	1	23	0	c	350019792900003959	6-29						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
646	chrIII	8104739	8104769	3500243691	23		8104739	8104769	8421504	3	8,10,5	0,12,25	g	350024369100003883	22-45						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
646	chrIII	8106593	8106650	3500235647	57		8106593	8106650	8421504	1	57	0	c	350023564700001334,350023564700000541,350023564700001336,350023564700000543	7-64,7-64,7-64,7-64						NEUROPROTECTIVE MOLECULES AND METHODS OF TREATING NEUROLOGICAL DISORDERS AND INDUCING STRESS GRANULES - Patent application	www.faqs.org	0	0		
647	chrIII	8134479	8134530	3500359816	51		8134479	8134530	8421504	1	51	0	p	350035981600015019	6-57						Molecular Cloning of a Putative Plant Endomembrane Protein Resembling Vertebrate Protein Disulfide-Isomerase and a Phosphatidylinositol-Specific Phospholipase C	www.jstor.org	0	0		
647	chrIII	8170727	8171753	3500438542	1026		8170727	8171753	8421504	1	1026	0	c,g	350043854200000007,350043854200000005,350043854200000008,350043854200000006	18-76,18-75,7-1030,7-825						F41G4.5 - CZlab@BIRM@CHINA	compute.bmi.ac.cn	0	0		
647	chrIII	8182807	8182834	3500416701	25		8182807	8182834	8421504	2	15,10	0,17	c	350041670100001989	17-42						Copyright by Joshua Robert McDill 2009	es.lib.utexas.edu	0	0		
647	chrIII	8184339	8184365	3500412738	25		8184339	8184365	8421504	2	21,4	0,22	c	350041273800000073	5-30							biomedcentral.com	0	0		
647	chrIII	8193123	8202944	3500448962	44		8193123	8202944	8421504	2	21,23	0,9798	c,g	350044896200000001,350044896200000001,350044896200000000	0-21,0-21,0-23		23663262	10.1186/1749-8104-8-10	1749-8104	Neural Development	The Caenorhabditis elegans voltage-gated calcium channel subunits UNC-2 and UNC-36 and the calcium-dependent kinase UNC-43/CaMKII regulate neuromuscular junction morphology	Caylor	2013	4		
647	chrIII	8193123	8202944	3500007980	44		8193123	8202944	8421504	2	21,23	0,9798	g	350000798000000001,350000798000000000	0-21,0-23						The Caenorhabditis elegans voltage-gated calcium channel subunits UNC-2 and UNC-36 and the calcium-dependent kinase UNC-43/CaMKII regulate neuromuscular junction morphology	aldevelopment.com	0	0		
647	chrIII	8196921	8197095	3500249133	100		8196921	8197095	8421504	2	50,50	0,124	c,g	350024913300000024,350024913300000024,350024913300000023,350024913300000023	0-50,0-50,0-50,0-50							roarrays.ucsd.edu	0	0		
647	chrIII	8213015	8216605	3500154339	100		8213015	8216605	8421504	2	50,50	0,3540	c,g	350015433900000112,350015433900000112,350015433900000096	0-50,0-50,0-50							biomedcentral.com	0	0		
647	chrIII	8213212	8213470	3500244493	117		8213212	8213470	8421504	4	18,51,13,35	0,30,87,223	p	350024449300015007	3-126						Identification comS, a srfA the in Bacillus subtilis	www.pnas.org	0	0		
647	chrIII	8232586	8232818	3500213444	45		8232586	8232818	8421504	2	42,3	0,229	p	350021344400015000	0-45		22829772	10.1371/journal.pgen.1002702	1553-7404	PLOS Genetics	PLOS Genetics: Differential Impact of the HEN1 Homolog HENN-1 on 21U and 26G RNAs in the Germline of Caenorhabditis elegans	Kamminga	2012	0		
647	chrIII	8246230	8246255	3500451094	23		8246230	8246255	8421504	2	12,11	0,14	g	350045109400000118,350045109400000012	0-24,0-24						LIVE GENETICALLY ATTENUATED MALARIA VACCINE - Patent application	www.faqs.org	0	0		
647	chrIII	8246230	8246255	3500431266	23		8246230	8246255	8421504	2	12,11	0,14	g	350043126600000012	0-24						Live genetically attenuated malaria vaccine	Kappe	2005	0		
647	chrIII	8253247	8254036	3500361572	38		8253247	8254036	8421504	2	19,19	0,770	c,g	350036157200000006,350036157200000006,350036157200000018,350036157200000018,350036157200000019	0-19,0-19,0-19,0-19,0-19						EUKARYOTIC CELL DIVISION GENES AND THEIR USE IN DIAGNOSIS AND TREATMENT OF PROLIFERATIVE DISEASES	Echeverri	2001	0		
80	chrIII	8254080	8265617	3500098056	3852		8254080	8265617	8421504	20	27,151,491,123,213,167,82,138,213,150,191,400,249,111,184,252,219,95,114,282	0,4193,4567,5119,5373,5634,5849,5977,6207,6466,6662,7079,7551,7842,8008,10030,10606,10952,11095,11255	p,c,g	350009805600000014,350009805600015006,350009805600000003,350009805600000003,350009805600015007,350009805600000024,350009805600000024,350009805600000025,350009805600000025	0-27,0-90,0-3788,0-3788,0-3690,0-23,0-23,0-28,0-28						Functional assays for cholesterol absorption inhibitors	Levitan	2005	0		
648	chrIII	8278772	8305497	3500371282	2233		8278772	8305497	8421504	8	840,250,124,96,110,418,147,248	0,3265,15193,21506,21726,25409,26283,26477	p,g	350037128200000002,350037128200015000	0-840,0-1467						Initiation à la Génomique	.igmors.u-psud.fr	0	0		
648	chrIII	8279036	8305500	3500204591	148		8279036	8305500	8421504	6	24,20,24,24,27,29	0,14941,21105,22966,25415,26435	c,g	350020459100000004,350020459100000004,350020459100000002,350020459100000002,350020459100000003,350020459100000003,350020459100000013,350020459100000013,350020459100000014,350020459100000005,350020459100000005	0-24,0-24,0-20,0-20,0-24,0-24,0-24,0-24,6-33,0-29,0-29						Four bait constructs, p32RAPH, p32M10A, p32M10B, and p32M10C were created for use in the yeast two-hybrid system all using the same bait vector, pDEST32™	www.wpi.edu	0	0		
648	chrIII	8299807	8300528	3500336433	47		8299807	8300528	8421504	2	24,23	0,698	c,g	350033643300000113,350033643300000114,350033643300000114	0-24,0-23,0-23						Two genes, dig-1 and mig-10, involved in nervous system development in C.elegans	www.wpi.edu	0	0		
648	chrIII	8300139	8305353	3500041248	190		8300139	8305353	8421504	8	24,24,22,24,24,24,24,24	0,426,941,1806,2743,3053,4972,5190	c,g	350004124800000002,350004124800000003,350004124800000003,350004124800000001,350004124800000005,350004124800000005,350004124800000006,350004124800000007,350004124800000010,350004124800000010,350004124800000011,350004124800000011	0-24,0-24,0-24,0-22,0-24,0-24,0-24,0-24,0-24,0-24,0-24,0-24						Isolation and Characterization of Novel Mutations in the mig-10 gene of elegans	www.wpi.edu	0	0		
648	chrIII	8316679	8320039	3500361572	90		8316679	8320039	8421504	4	23,21,23,23	0,2060,2099,3337	c,g	350036157200000020,350036157200000020,350036157200000008,350036157200000008,350036157200000023,350036157200000023,350036157200000011,350036157200000011,350036157200000021,350036157200000021,350036157200000009,350036157200000009,350036157200000022,350036157200000022,350036157200000010,350036157200000010	0-23,0-23,0-23,0-23,0-21,0-21,0-21,0-21,0-23,0-23,0-23,0-23,0-23,0-23,0-23,0-23						EUKARYOTIC CELL DIVISION GENES AND THEIR USE IN DIAGNOSIS AND TREATMENT OF PROLIFERATIVE DISEASES	Echeverri	2001	0		
648	chrIII	8318311	8319165	3500386009	40		8318311	8319165	8421504	2	20,20	0,834	c,g	350038600900000006,350038600900000006,350038600900000007	0-20,0-20,0-20						Supplemental Data Condensins Regulate Meiotic DNA Break Distribution, thus Crossover Frequency, by Controlling Chromosome Structure	mcb.berkeley.edu	0	0		
648	chrIII	8361145	8362013	3500121800	402		8361145	8362013	8421504	2	326,76	0,792	p	350012180000015142,350012180000015145,350012180000015147	0-174,0-180,0-48						49 human secreted proteins	Komatsoulis	2000	0		
649	chrIII	8398899	8398988	3500355142	23		8398899	8398988	8421504	2	8,15	0,74	c	350035514200000266	0-23						 Humanized Collagen Antibodies And Related Methods 	www.docstoc.com	0	0		
649	chrIII	8398899	8398988	3500143419	23		8398899	8398988	8421504	2	8,15	0,74	c	350014341900000315	0-23						Humanized collagen antibodies and related methods - Patent application	www.faqs.org	0	0		
649	chrIII	8398899	8398988	3500083736	23		8398899	8398988	8421504	2	8,15	0,74	c	350008373600000427	0-23						<script type="text/javascript"> if (typeof($) == 'undefined') window.location.pathname = "/p	ww.patentlens.net	0	0		
649	chrIII	8398899	8398988	3500050132	23		8398899	8398988	8421504	2	8,15	0,74	c	350005013200000629	0-23						Humanized collagen antibodies and related methods	J*D*Wo Te Jin Si 	2005	0		
649	chrIII	8399140	8401837	3500274848	1561		8399140	8401837	8421504	6	397,223,130,349,320,142	0,444,713,888,1584,2555	p,g	350027484800000000,350027484800015001	0-1561,0-504						 理论预测是否为分泌蛋白的软件_百度文库	wenku.baidu.com	0	0		
649	chrIII	8399140	8401837	3500015127	1561		8399140	8401837	8421504	6	397,223,130,349,320,142	0,444,713,888,1584,2555	p,g	350001512700000000,350001512700015001	0-1561,0-504						理论预测是否为分泌蛋白的软件_百度文库	wenku.baidu.com	0	0		
649	chrIII	8399228	8401837	3500320608	1014		8399228	8401837	8421504	10	57,75,114,201,60,78,282,8,88,51	0,108,195,356,660,1071,1496,1808,2467,2558	p	350032060800015116,350032060800015104,350032060800015103,350032060800015085,350032060800015066,350032060800015044,350032060800015037,350032060800015023,350032060800015022	0-57,0-75,0-105,0-210,0-294,240-420,186-366,0-96,27-78						Purification of P. c. chabaudi aminopeptidase, and antimalarial effects of the aminopeptidase inhibitor bestatin.	doras.dcu.ie	0	0		
649	chrIII	8399735	8400502	3500141880	92		8399735	8400502	8421504	4	25,21,21,25	0,415,438,742	c,g	350014188000000010,350014188000000010,350014188000000008,350014188000000009,350014188000000009,350014188000000011	0-25,0-25,0-21,0-21,0-21,0-25						Caenorhabditis elegans: Molecular Genetics and Development	www.scribd.com	0	0		
649	chrIII	8403890	8404567	3500364041	63		8403890	8404567	8421504	3	30,25,8	0,600,669	c,g	350036404100000003,350036404100000003,350036404100000002	0-30,0-30,0-33		19822669	10.1083/jcb.200903024	0021-9525	The Journal of Cell Biology	Ubiquilin and p97/VCP bind erasin, forming a complex involved in ERAD	Lim	2009	10		
649	chrIII	8403890	8404515	3500238090	55		8403890	8404515	8421504	2	30,25	0,600	c,g	350023809000000003,350023809000000003,350023809000000002	0-30,0-30,8-33		19822669	10.1083/jcb.200903024		The Journal of Cell Biology	Ubiquilin and p97/VCP bind erasin, forming a complex involved in ERAD	Precious	2009	0		
649	chrIII	8407039	8407067	3500017184	23		8407039	8407067	8421504	2	16,7	0,21	g	350001718400000025	0-23						Transcription factor: SigB	dbtbs.hgc.jp	0	0		
649	chrIII	8439653	8441029	3500439137	546		8439653	8441029	8421504	3	98,127,321	0,182,1055	p	350043913700015081,350043913700015079,350043913700015075,350043913700015073	0-45,0-180,0-174,0-147						Human proteins having transmembrane domains and DNAs encoding these proteins	Kato	2003	0		
649	chrIII	8455894	8455925	3500323196	26		8455894	8455925	8421504	2	13,13	0,18	g	350032319600000187	9-36						>AM398681; Flavobacterium psychrophilum JIP02/86 complete genome CTTTGTGTTCTTTGTGGTTAAAATACAATCGATAT	gale.jouy.inra.fr	0	0		
649	chrIII	8476358	8493646	3500243994	42		8476358	8493646	8421504	3	17,4,21	0,18,17267	g	350024399400000255,350024399400000265	0-21,4-25						Phylogenetic Relationships of Asterella (Aytoniaceae, Marchantiopsida) Inferred from Chloroplast DNA Sequences	www.jstor.org	0	0		
649	chrIII	8487936	8487960	3500242592	24		8487936	8487960	8421504	1	24	0	c,g	350024259200000038,350024259200000038	0-24,0-24						Caenorhabditis elegansban - HOX kontroll?	teo.elte.hu	0	0		
649	chrIII	8497001	8497025	3500275574	23		8497001	8497025	8421504	2	4,19	0,5	c	350027557400000014	0-23						Molecular sexing of avian subjects	Brosius	2012	0		
649	chrIII	8497001	8497025	3500196905	23		8497001	8497025	8421504	2	4,19	0,5	c	350019690500000014	0-23						MOLECULAR SEXING OF AVIAN SUBJECTS	Suh	2012	0		
649	chrIII	8497001	8497025	3500019776	23		8497001	8497025	8421504	2	4,19	0,5	c	350001977600000014	0-23						Molecular sexing of avian subjects	Brosius	2012	0		
649	chrIII	8510344	8510369	3500078842	23		8510344	8510369	8421504	2	10,13	0,12	c	350007884200000293	12-35						<Html><Title> Complet list of 3exb hssp file Complet list of	cnptia.embrapa.br	0	0		
649	chrIII	8513187	8513214	3500442902	23		8513187	8513214	8421504	3	4,14,5	0,5,22	c	350044290200000056	0-23						INTRODUCTION	www.sequenom.com	0	0		
649	chrIII	8513187	8513214	3500249990	23		8513187	8513214	8421504	3	4,14,5	0,5,22	c	350024999000000056	0-23						INTRODUCTION	www.sequenom.com	0	0		
81	chrIII	8518251	8554756	3500343421	40		8518251	8554756	8421504	3	14,6,20	0,16,36485	c	350034342100000079,350034342100000317	19-40,25-45						NOVEL NUCLEIC ACID SEQUENCES AND THEIR USE IN METHODS FOR ACHIEVING PATHOGEN RESISTANCE IN PLANTS - Patent application	www.faqs.org	0	0		
650	chrIII	8538812	8538838	3500026315	24		8538812	8538838	8421504	2	7,17	0,9	g	350002631500000212	9-33						Novel molecules of the card-related protein family and uses thereof - US Patent Application 20050049399 Description	ww.patentstorm.us	0	0		
650	chrIII	8547471	8576207	3500030701	28736		8547471	8576207	8421504	1	28736	0	p,g	350003070100000000,350003070100015000,350003070100015001,350003070100015002	0-28735,0-738,180-969,0-1224						GAME sequence format - BioPerl	bio.perl.org	0	0		
650	chrIII	8555619	8555647	3500284394	23		8555619	8555647	8421504	2	14,9	0,19	g	350028439400000302	18-42						RNAi INHIBITION OF INFLUENZA VIRUS REPLICATION	Fougerolles	2011	0		
650	chrIII	8555619	8555647	3500241875	23		8555619	8555647	8421504	2	14,9	0,19	g	350024187500000302	18-42					Patent	Enhancement of influenza gene expression (Patent US:8227188)	Fougerolles	2012	0		
650	chrIII	8555619	8555647	3500070088	23		8555619	8555647	8421504	2	14,9	0,19	g	350007008800000302	18-42						RNAI INHIBITION OF INFLUENZA VIRUS REPLICATION	Fougerolles	2006	0		
650	chrIII	8555619	8555647	3500019915	23		8555619	8555647	8421504	2	14,9	0,19	g	350001991500000302	18-42						Rnai Inhibition Of Influenza Virus Replication 	.freshpatents.com	0	0		
650	chrIII	8556105	8556705	3500409567	600		8556105	8556705	8421504	1	600	0	g	350040956700000000	0-600						primer3.pm - bio-primer-designer - Lightweight perl wrappers for primer3, epcr, etc - Google Project Hosting 	code.google.com	0	0		
650	chrIII	8584199	8584465	3500442789	42		8584199	8584465	8421504	2	22,20	0,246	c,g	350044278900000019,350044278900000019,350044278900000018,350044278900000018	0-22,0-22,0-20,0-20		22768380	10.1038/srep00487	xxxx-xxxx	Scientific Reports	Genes down-regulated in spaceflight are involved in the control of longevity in Caenorhabditis elegans	Honda	2012	0		
650	chrIII	8584199	8584465	3500149422	42		8584199	8584465	8421504	2	22,20	0,246	c,g	350014942200000019,350014942200000019,350014942200000018,350014942200000018	0-22,0-22,0-20,0-20		22768380	10.1038/srep00487	xxxx-xxxx	Scientific Reports	Genes down-regulated in spaceflight are involved in the control of longevity in Caenorhabditis elegans	Honda	2012	0		
650	chrIII	8584199	8584465	3500062275	42		8584199	8584465	8421504	2	22,20	0,246	c,g	350006227500000019,350006227500000019,350006227500000018,350006227500000018	0-22,0-22,0-20,0-20		22768380	10.1038/srep00487		Scientific Reports	Genes down-regulated in spaceflight are involved in the control of longevity in Caenorhabditis elegans	Yoko	2012	0		
650	chrIII	8588535	8593866	3500278495	40		8588535	8593866	8421504	2	20,20	0,5311	g	350027849500000001,350027849500000000	0-20,0-20						Compartmentalized calcium dynamics in a C. elegans interneuron encode head movement	nars.stanford.edu	0	0		
650	chrIII	8596589	8597433	3500244161	48		8596589	8597433	8421504	2	35,13	0,831	p	350024416100015009	0-48						Helene Touzet	www.lifl.fr	0	0		
650	chrIII	8596592	8597454	3500214246	66		8596592	8597454	8421504	2	32,34	0,828	p	350021424600015013	15-81						Alignement multiple ClustalW	polytech.unice.fr	0	0		
650	chrIII	8617109	8627719	3500394181	43		8617109	8627719	8421504	5	15,6,11,5,6	0,18,10538,10597,10604	c,g	350039418100000334,350039418100000334,350039418100000186	4-26,4-26,1-23						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
650	chrIII	8626907	8627267	3500414548	118		8626907	8627267	8421504	3	26,29,63	0,31,297	g	350041454800000000	0-119						Sean Eddy - Email, Phone Numbers, Public Records & Criminal Background Check! www.123people.com	www.123people.com	0	0		
650	chrIII	8632449	8632477	3500360966	23		8632449	8632477	8421504	2	6,17	0,11	g	350036096600000372	16-39						<HTML> <TITLE>BLAST Search Results   [KDRI]Chlamydomonas reinhardtii EST index  Complet list of	cnptia.embrapa.br	0	0		
654	chrIII	9057542	9057566	3500228395	23		9057542	9057566	8421504	2	19,4	0,20	g	350022839500000214	2-25						<Html><Title> Complet list of 1hxt hssp file Complet list of	cnptia.embrapa.br	0	0		
654	chrIII	9059283	9059546	3500398325	40		9059283	9059546	8421504	2	20,20	0,243	c,g	350039832500000011,350039832500000011,350039832500000012,350039832500000012	0-20,0-20,0-20,0-20						Gelöste Huminstoffe können die Lebensspanne von Caenorhabditis elegans verlängern und seine Genexpression beeinflussen	www2.hu-berlin.de	0	0		
654	chrIII	9061576	9063307	3500400572	40		9061576	9063307	8421504	2	20,20	0,1711	c,g	350040057200000009,350040057200000009,350040057200000008,350040057200000008	0-20,0-20,0-20,0-20						ScienceDirect.com - Developmental Biology - lin-35/Rb and the CoREST ortholog spr-1 coordinately regulate vulval morphogenesis and gonad development in C. elegans	sciencedirect.com	0	0		
654	chrIII	9062458	9062503	3500466198	45		9062458	9062503	8421504	1	45	0	p	350046619800015011	6-51						#QUERY: #Match: All #Classification: Transcription factor #PDB_ID ENTRY_ID PUBMED_ID RESOLUTION SPEC	melolab.org	0	0		
654	chrIII	9062458	9062503	3500429647	45		9062458	9062503	8421504	1	45	0	p	350042964700015016	6-51						#QUERY: #Match: All #Z-DNA: No #PDB_ID ENTRY_ID PUBMED_ID RESOLUTION SPECIES MULTICOMPLEXITY NO_INTE	melolab.org	0	0		
654	chrIII	9062458	9062503	3500425490	45		9062458	9062503	8421504	1	45	0	p	350042549000015011	6-51						#QUERY: #Match: All #Protein-protein interaction: Not applicable (1 protein) #PDB_ID ENTRY_ID PUBMED	melolab.org	0	0		
654	chrIII	9062458	9062503	3500418033	45		9062458	9062503	8421504	1	45	0	p	350041803300015016	6-51						#QUERY: #Match: All #Flipped base(s): No #PDB_ID ENTRY_ID PUBMED_ID RESOLUTION SPECIES MULTICOMPLEXI	melolab.org	0	0		
654	chrIII	9062458	9062503	3500358402	45		9062458	9062503	8421504	1	45	0	p	350035840200015010	6-51						#QUERY: #Match: All #Type of multimerization: Heteromultimeric #PDB_ID ENTRY_ID PUBMED_ID RESOLUTION	melolab.org	0	0		
654	chrIII	9062458	9062503	3500325800	45		9062458	9062503	8421504	1	45	0	p	350032580000015011	6-51						#QUERY: #Match: All #Protein-protein interaction: Not applicable (1 protein) #PDB_ID ENTRY_ID PUBMED	melolab.org	0	0		
654	chrIII	9062458	9062503	3500322771	45		9062458	9062503	8421504	1	45	0	p	350032277100015016	6-51						#QUERY: #Match: All #Open DNA: No #PDB_ID ENTRY_ID PUBMED_ID RESOLUTION SPECIES MULTICOMPLEXITY NO_I	melolab.org	0	0		
654	chrIII	9062458	9062503	3500196412	45		9062458	9062503	8421504	1	45	0	p	350019641200015016	6-51						#QUERY: #Match: All #Open DNA: No #PDB_ID ENTRY_ID PUBMED_ID RESOLUTION SPECIES MULTICOMPLEXITY NO_I	melolab.org	0	0		
654	chrIII	9062458	9062503	3500153976	45		9062458	9062503	8421504	1	45	0	p	350015397600015014	6-51						#QUERY: #Match: All #Nicked DNA: No /N.A. #PDB_ID ENTRY_ID PUBMED_ID RESOLUTION SPECIES MULTICOMPLEX	melolab.org	0	0		
654	chrIII	9062458	9062503	3500148743	45		9062458	9062503	8421504	1	45	0	p	350014874300015011	6-51						#QUERY: #Match: All #Protein-protein interaction: Not applicable (1 protein) #PDB_ID ENTRY_ID PUBMED	melolab.org	0	0		
654	chrIII	9062458	9062503	3500025435	45		9062458	9062503	8421504	1	45	0	p	350002543500015016	6-51						#QUERY: #Match: All #Gapped DNA: No #PDB_ID ENTRY_ID PUBMED_ID RESOLUTION SPECIES MULTICOMPLEXITY NO	melolab.org	0	0		
654	chrIII	9067854	9094053	3500242592	198		9067854	9094053	8421504	9	21,25,20,32,20,20,20,20,20	0,1668,1792,2839,3181,6951,21497,25429,26179	c,g	350024259200000014,350024259200000014,350024259200000012,350024259200000028,350024259200000039,350024259200000027,350024259200000011,350024259200000015,350024259200000016,350024259200000016,350024259200000018,350024259200000018	0-21,0-21,7-32,10-30,0-32,12-32,8-28,8-28,0-20,0-20,0-20,0-20						Caenorhabditis elegansban - HOX kontroll?	teo.elte.hu	0	0		
654	chrIII	9088501	9089296	3500306573	43		9088501	9089296	8421504	2	22,21	0,774	c,g	350030657300000006,350030657300000006,350030657300000005,350030657300000005	0-22,0-22,0-21,0-21						Conservation of glp-1 Regulation and Function in Nematodes	.biochem.wisc.edu	0	0		
654	chrIII	9088501	9089296	3500115571	43		9088501	9089296	8421504	2	22,21	0,774	c,g	350011557100000002,350011557100000002,350011557100000001,350011557100000001	0-22,0-22,0-21,0-21		11156985		0016-6731	Genetics	Conservation of glp-1 Regulation and Function in Nematodes	Rudel	2001	4		
654	chrIII	9090528	9090723	3500428217	195		9090528	9090723	8421504	1	195	0	g	350042821700000000	25-220						载体目录_北京天恩泽	www.tiandz.com	0	0		
654	chrIII	9092258	9117500	3500322748	39		9092258	9117500	8421504	4	14,5,13,7	0,15,25221,25235	c,g	350032274800000284,350032274800000284,350032274800000516	28-47,28-47,9-29						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
654	chrIII	9099022	9099331	3500314609	43		9099022	9099331	8421504	2	21,22	0,287	c,g	350031460900000000,350031460900000000,350031460900000001	0-21,0-21,0-22		18695046	10.1083/jcb.200802128	0021-9525	The Journal of Cell Biology	Maternal mRNAs are regulated by diverse P body–related mRNP granules during early Caenorhabditis elegans development	Noble	2008	10		
654	chrIII	9111968	9111992	3500397435	23		9111968	9111992	8421504	2	13,10	0,14	g	350039743500003317	9-42						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
654	chrIII	9128349	9130167	3500451667	60		9128349	9130167	8421504	3	20,20,20	0,781,1798	c,g	350045166700000005,350045166700000005,350045166700000009,350045166700000009,350045166700000008,350045166700000008	19-39,19-39,19-39,19-39,19-39,19-39		21478858	10.1038/ncb2225		Nature Cell Biology	Mechanisms by which TFG functions in protein secretion and oncogenesis	Kristen	2011	0		
654	chrIII	9141061	9141094	3500426604	27		9141061	9141094	8421504	3	6,16,5	0,7,28	c	350042660400000022,350042660400000023	3-30,0-27		11514616	10.1091/mbc.12.8.2275	1059-1524	Molecular Biology of the Cell	A Conserved Mechanism of Synaptogyrin Localization	Zhao	2001	5		
654	chrIII	9141061	9141094	3500128585	27		9141061	9141094	8421504	3	6,16,5	0,7,28	c	350012858500000023,350012858500000022	0-27,3-30					Molecular Biology of the Cell	A Conserved Mechanism of Synaptogyrin Localization	Hongjuan	2001	0		
655	chrIII	9181414	9185554	3500274188	223		9181414	9185554	8421504	13	22,20,20,20,3,18,20,20,20,5,15,20,20	0,68,528,1341,2291,2537,2585,2981,3051,3201,3454,4034,4120	c,g	350027418800000001,350027418800000002,350027418800000002,350027418800000003,350027418800000003,350027418800000005,350027418800000005,350027418800000007,350027418800000006,350027418800000006,350027418800000009,350027418800000009,350027418800000008,350027418800000008,350027418800000010,350027418800000011,350027418800000011,350027418800000012	0-22,0-20,0-20,0-20,0-20,0-20,0-20,0-21,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20						ScienceDirect.com - Neuron - Mutations in a Cyclic Nucleotide–Gated Channel Lead to Abnormal Thermosensation and Chemosensation in C. elegans	sciencedirect.com	0	0		
655	chrIII	9181715	9182057	3500390138	42		9181715	9182057	8421504	2	20,22	0,320	c,g	350039013800000014,350039013800000014,350039013800000015	0-20,0-20,0-22		22090313	10.1096/fj.11-197798	0892-6638	The FASEB Journal	Light-sensitive coupling of rhodopsin and melanopsin to Gi/o and Gq signal transduction in Caenorhabditis elegans	Cao	2012	6		
655	chrIII	9200468	9200497	3500032438	24		9200468	9200497	8421504	2	15,9	0,20	c	350003243800000059	1-25						用于在木霉属的蛋白酶缺陷突变体中产生多肽的方法	A.Zhan 	2012	0		
655	chrIII	9202778	9202806	3500009852	23		9202778	9202806	8421504	2	11,12	0,16	g	350000985200000420	0-23						Baixa conservação do conteúdo gênico do cromossomo Y em 12 espécies de Drosophila	pct.capes.gov.br	0	0		
655	chrIII	9225094	9225119	3500173570	23		9225094	9225119	8421504	2	8,15	0,10	g	350017357000000005	0-23						RNAi-mediated knockdown of dystrophin expression in adult mice does not lead to overt muscular dystrophy pathology	nne-community.com	0	0		
655	chrIII	9241684	9241710	3500289693	24		9241684	9241710	8421504	2	8,16	0,10	c	350028969300000231	5-42						5’ binding in Red color (shadow in green)	www.nature.com	0	0		
655	chrIII	9241952	9241983	3500038735	25		9241952	9241983	8421504	3	14,6,5	0,17,26	c	350003873500000845	10-35						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
655	chrIII	9242827	9244871	3500200860	124		9242827	9244871	8421504	6	27,18,7,25,23,24	0,564,630,773,874,2020	c,g	350020086000000007,350020086000000005,350020086000000006,350020086000000006,350020086000000000,350020086000000001,350020086000000001	12-39,0-25,0-25,0-25,0-23,0-24,0-24				1521-0111 (Online)	Molecular Pharmacology	The Caenorhabditis elegans GeneT23G5.5 Encodes an Antidepressant- and Cocaine-Sensitive Dopamine Transporter	Jayanthi	1998	0		
655	chrIII	9244555	9246000	3500141678	40		9244555	9246000	8421504	2	20,20	0,1425	c,g	350014167800000002,350014167800000002,350014167800000003	20-40,20-40,0-20						ScienceDirect.com - Neuron - Dopamine Mediates Context-Dependent Modulation of Sensory Plasticity in C. elegans	sciencedirect.com	0	0		
655	chrIII	9248055	9248083	3500254907	24		9248055	9248083	8421504	3	12,6,6	0,13,22	g	350025490700000062	19-48					Patent	DNA molecules that code for enzymes involved in starch synthesis, vectors, bacteria, transgenic plant cells and plants containing said molecules (Patent US:6130367)	Abel	2000	0		
655	chrIII	9248055	9248083	3500000031	24		9248055	9248083	8421504	3	12,6,6	0,13,22	g	350000003100000121	19-48						Dna molecules that code for enzymes involved in starch synthesis, vectors, bacteria, transgenic plant cells and plants containing said molecules	Abel	1997	0		
655	chrIII	9257034	9257062	3500185045	23		9257034	9257062	8421504	2	16,7	0,21	g	350018504500001773	0-23						Gene ID Marker1 Marker2 Marker3	genome.cshlp.org	0	0		
655	chrIII	9260693	9260770	3500036640	23		9260693	9260770	8421504	3	2,16,5	0,54,72	c	350003664000000007	17-40						Isolation and characterization of microsatellite loci in the globally endangered Corncrake, Crex crex Linne´	www.corncrake.net	0	0		
655	chrIII	9262873	9262901	3500285596	23		9262873	9262901	8421504	2	16,7	0,21	g	350028559600000017	3-28						L1: Design of oligonucleotides	xray.bmc.uu.se	0	0		
655	chrIII	9282054	9282079	3500290712	24		9282054	9282079	8421504	2	18,6	0,19	g	350029071200000042	18-42						Method and composition for increasing sterol accumulation in higher plants - US Patent 5306862 Description	ww.patentstorm.us	0	0		
655	chrIII	9291137	9296635	3500376827	165		9291137	9296635	8421504	7	22,21,23,23,35,22,19	0,899,1983,2937,3615,4773,5479	c,g	350037682700000000,350037682700000002,350037682700000010,350037682700000006,350037682700000006,350037682700000009,350037682700000008,350037682700000011,350037682700000011,350037682700000007,350037682700000007,350037682700000001,350037682700000001	0-22,0-21,6-29,0-21,0-21,0-23,22-45,8-43,8-43,7-29,7-29,0-19,0-19		16887832	10.1242/dev.02494	0950-1991	Development	An unusual Zn-finger/FH2 domain protein controls a left/right asymmetric neuronal fate decision in C. elegans	Robert	2006	7		
655	chrIII	9293284	9293308	3500144391	24		9293284	9293308	8421504	1	24	0	c	350014439100000304,350014439100000367	6-30,9-33						SPIDER SILK DRAGLINE POLYNUCLEOTIDES, POLYPEPTIDES AND METHODS OF USE THEREOF - Patent application	www.faqs.org	0	0		
656	chrIII	9331231	9331259	3500030022	25		9331231	9331259	8421504	2	11,14	0,14	c	350003002200000172	4-29						<Html><Title> Complet list of 1xi6 hssp file Complet list of	cnptia.embrapa.br	0	0		
656	chrIII	9331233	9331261	3500451613	23		9331233	9331261	8421504	2	7,16	0,12	c	350045161300000092	0-23						<Html><Title> Complet list of 3pmx hssp file Complet list of	cnptia.embrapa.br	0	0		
656	chrIII	9383834	9387522	3500063695	799		9383834	9387522	8421504	21	1,23,25,93,45,48,32,13,45,12,80,1,45,45,42,42,45,42,45,49,26	0,1744,1890,1918,2014,2107,2158,2255,2319,2367,2440,2566,2570,2666,3137,3185,3230,3281,3379,3472,3662	c,g	350006369500000264,350006369500000587,350006369500000265,350006369500000266,350006369500000267,350006369500000269,350006369500000269,350006369500000270,350006369500000272,350006369500000273,350006369500000274,350006369500000275,350006369500000275,350006369500000277,350006369500000277,350006369500000278,350006369500000279,350006369500000279,350006369500000280,350006369500000281,350006369500000282,350006369500000282,350006369500000284,350006369500000588,350006369500000287	22-48,6-29,0-45,0-48,0-45,0-48,0-48,0-45,0-45,0-45,0-48,0-45,0-45,0-45,0-45,0-42,0-42,0-42,0-45,0-42,0-45,0-45,0-49,5-31,0-19						G protein-coupled receptor-like receptors and modulators thereof - US Patent 7208591 Description	ww.patentstorm.us	0	0		
656	chrIII	9385754	9386001	3500398325	40		9385754	9386001	8421504	2	20,20	0,227	c,g	350039832500000025,350039832500000025,350039832500000026,350039832500000026	0-20,0-20,0-20,0-20						Gelöste Huminstoffe können die Lebensspanne von Caenorhabditis elegans verlängern und seine Genexpression beeinflussen	www2.hu-berlin.de	0	0		
656	chrIII	9388290	9388316	3500032596	23		9388290	9388316	8421504	2	10,13	0,13	c	350003259600000000	0-36						Canine Strangles Case Reveals a New Host Susceptible to Infection with Streptococcus equi	jcm.asm.org	0	0		
657	chrIII	9440527	9440802	3500461285	41		9440527	9440802	8421504	3	19,1,21	0,64,254	c,g	350046128500000067,350046128500000066,350046128500000066	0-20,0-21,0-21						KRUPPEL-LIKE FACTORS AND FAT REGULATION - Patent application	www.faqs.org	0	0		
657	chrIII	9452038	9452065	3500315721	23		9452038	9452065	8421504	3	6,5,12	0,9,15	c	350031572100000397	2-25						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
657	chrIII	9465688	9466978	3500287805	1095		9465688	9466978	8421504	5	72,240,110,535,138	0,126,413,572,1152	p,c	350028780500000006,350028780500015005	0-1091,0-1092						Coding sequence for protein phosphatase methylesterase, recombinant DNA molecules and methods	Pallas	1999	0		
657	chrIII	9466904	9467995	3500169762	88		9466904	9467995	8421504	4	20,23,22,23	0,480,780,1068	c,g	350016976200000000,350016976200000000,350016976200000002,350016976200000003,350016976200000003,350016976200000001	0-20,0-20,10-33,12-34,12-34,12-35			10.1083/jcb.200704049		The Journal of Cell Biology	Barrier to autointegration factor blocks premature cell fusion and maintains adult muscle integrity in C. elegans	Ayelet	2007	0		
657	chrIII	9477416	9477443	3500423818	23		9477416	9477443	8421504	2	6,17	0,10	g	350042381800001132	4-28						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
657	chrIII	9488953	9488998	3500197656	45		9488953	9488998	8421504	1	45	0	p	350019765600015150	0-45						Karakterisatie van neuromedine U-, tachykinine- en GnRH-verwante receptoren	w.scriptiebank.be	0	0		
657	chrIII	9488953	9488998	3500162294	45		9488953	9488998	8421504	1	45	0	p	350016229400015002	0-45						WormBook Search	www.wormbook.org	0	0		
657	chrIII	9490203	9490228	3500276415	24		9490203	9490228	8421504	2	9,15	0,10	c	350027641500000003	9-37						Supporting Information for World Wide Web Edition	www.owczarzy.net	0	0		
657	chrIII	9499246	9499514	3500064176	204		9499246	9499514	8421504	3	144,15,45	0,162,223	p	350006417600015021,350006417600015013	0-144,0-60						A cell-surface superoxide dismutase is a binding protein for peroxinectin, a cell-adhesive peroxidase in crayfish	cs.biologists.org	0	0		
657	chrIII	9501224	9502140	3500015147	40		9501224	9502140	8421504	2	19,21	0,895	g	350001514700000000,350001514700000001	0-19,0-21		10749938	10.1091/mbc.11.4.1401	1059-1524	Molecular Biology of the Cell	EMB-30: An APC4 Homologue Required for Metaphase-to-Anaphase Transitions during Meiosis and Mitosis in Caenorhabditis elegans	Furuta	2000	5		
657	chrIII	9502224	9502252	3500304073	23		9502224	9502252	8421504	2	15,8	0,20	g	350030407300000412	11-34						<Html><Title> Complet list of 2abm hssp file Complet list of	cnptia.embrapa.br	0	0		
657	chrIII	9507051	9507076	3500467340	25		9507051	9507076	8421504	1	25	0	g	350046734000000095	3-28						<Html><Title> Complet list of 1kw3 hssp file Complet list of	cnptia.embrapa.br	0	0		
657	chrIII	9525134	9525161	3500462745	24		9525134	9525161	8421504	3	4,5,15	0,5,12	g	350046274500000067	6-30			10.1104/pp.103.031005		Plant Physiology	Immunophilins and Parvulins. Superfamily of Peptidyl Prolyl Isomerases in Arabidopsis	Zengyong	2004	0		
657	chrIII	9525294	9525317	3500436017	23		9525294	9525317	8421504	1	23	0	g	350043601700000016	0-23			10.1002/dvdy.10259	1097-0177	Developmental Dynamics	Caenorhabditis elegans exoskeleton collagen COL-19: An adult-specific marker for collagen modification and assembly, and the analysis of organismal morphology - Thein - 2003 - Developmental Dynamics - Wiley Online Library	Thein	2003	0		
657	chrIII	9541860	9542271	3500147860	340		9541860	9542271	8421504	2	150,190	0,221	c	350014786000000030	0-340						RUBENS GALDINO FEIJÓ	torio.ufc.br:8080	0	0		
82	chrIII	9553989	9581042	3500394181	41		9553989	9581042	8421504	3	22,13,6	0,27030,27047	g	350039418100000515,350039418100000293	15-37,0-19						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
658	chrIII	9576148	9576172	3500030766	23		9576148	9576172	8421504	2	18,5	0,19	c,g	350003076600001435,350003076600001435	4-27,4-27						>vs_0 TACCAACAGCTACTCCCATGCAAAGCACTTTCTTAAGCTGGAATTTGACCATAGCCTTAGT >vs_1 AGTAACCGCGATTCCAACACAAA	biomedcentral.com	0	0		
658	chrIII	9577473	9577571	3500401546	40		9577473	9577571	8421504	2	20,20	0,78	c,g	350040154600000004,350040154600000004,350040154600000005,350040154600000005	0-20,0-20,0-20,0-20			10.1111/j.1474-9726.2007.00273.x	1474-9726	Aging Cell	Dramatic age-related changes in nuclear and genome copy number in the nematode Caenorhabditis elegans - Golden - 2007 - Aging Cell - Wiley Online Library	Golden	2007	0		
658	chrIII	9586736	9587069	3500461285	40		9586736	9587069	8421504	3	18,2,20	0,69,313	c,g	350046128500000055,350046128500000054,350046128500000054	0-20,0-20,0-20						KRUPPEL-LIKE FACTORS AND FAT REGULATION - Patent application	www.faqs.org	0	0		
658	chrIII	9594109	9607254	3500003185	40		9594109	9607254	8421504	4	7,14,4,15	0,11,13125,13130	c,g	350000318500000039,350000318500000614	13-34,0-19						Anti-bacterial methods and materials	Holden	2000	0		
658	chrIII	9599366	9607444	3500168684	40		9599366	9607444	8421504	3	19,14,7	0,8055,8071	c,g	350016868400001561,350016868400001561,350016868400001406	5-24,5-24,10-31						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
658	chrIII	9616555	9616581	3500037747	23		9616555	9616581	8421504	2	7,16	0,10	g	350003774700000002	17-40						The Kruppel, the Like, the Factor, the 2, and the Ology A DISSERTATION SUBMITTED TO THE FACULTY OF THE GRADUATE SCHOOL OF THE UNIVERSITY OF MINNESOTA BY Michael Alexander Weinreich IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHI	nservancy.umn.edu	0	0		
658	chrIII	9626712	9626760	3500282900	48		9626712	9626760	8421504	1	48	0	p	350028290000015002	3-51						Developmental Cell Article	www.bio.mtu.edu	0	0		
658	chrIII	9626886	9629070	3500217410	46		9626886	9629070	8421504	3	21,3,22	0,576,2162	c,g	350021741000000006,350021741000000005,350021741000000005	0-24,0-22,0-22						Effects of ced-9 dsRNA on Caenorhabditis elegans and Meloidogyne incognita	thescipub.com	0	0		
658	chrIII	9628608	9629051	3500381190	41		9628608	9629051	8421504	2	21,20	0,423	c,g	350038119000000005,350038119000000005,350038119000000006,350038119000000006	0-21,0-21,0-20,0-20						Cell Death and Differentiation	005.pasteur.ac.ir	0	0		
658	chrIII	9628608	9629051	3500065493	41		9628608	9629051	8421504	2	21,20	0,423	c,g	350006549300000005,350006549300000005,350006549300000006,350006549300000006	0-21,0-21,0-20,0-20						C. elegans ced-13 can promote apoptosis and is induced in response to DNA damage. - ResearchGate	.researchgate.net	0	0		
658	chrIII	9628608	9629051	3500003365	41		9628608	9629051	8421504	2	21,20	0,423	c,g	350000336500000005,350000336500000005,350000336500000006,350000336500000006	0-21,0-21,0-20,0-20		15605074	10.1038/sj.cdd.4401539	1350-9047	Cell Death & Differentiation	C. elegans ced-13 can promote apoptosis and is induced in response to DNA damage	Schumacher	2004	9		
658	chrIII	9638102	9638126	3500401505	23		9638102	9638126	8421504	2	4,19	0,5	g	350040150500000108	13-36						ScienceDirect.com - Genomics - A microsatellite-based genetic linkage map of the waterflea, Daphnia pulex: On the prospect of crustacean genomics	sciencedirect.com	0	0		
659	chrIII	9701670	9701695	3500365833	24		9701670	9701695	8421504	2	20,4	0,21	g	350036583300000004	10-34						Volume 18 Number 13 April 7, 2012	www.wjgnet.com	0	0		
659	chrIII	9701670	9701695	3500359577	24		9701670	9701695	8421504	2	20,4	0,21	g	350035957700000002	10-34						T1	www.wjgnet.com	0	0		
659	chrIII	9705836	9705909	3500337162	23		9705836	9705909	8421504	2	14,9	0,64	c	350033716200000049	1-24						Mutated 5-enol pyruvylshikimate-3-phosphate synthase, gene coding for said protein and transformed plants containing said gene	Freyssinet	1998	0		
659	chrIII	9705836	9705909	3500110430	23		9705836	9705909	8421504	2	14,9	0,64	c	350011043000000044	1-24						Chimera gene with several herbicide resistant genes, plant cell and plant resistant to several herbicides	Derose	1999	0		
659	chrIII	9718261	9786697	3500178220	63		9718261	9786697	8421504	6	5,17,16,6,11,8	0,7,35753,35772,68281,68428	c,g	350017822000001304,350017822000000939,350017822000000052	17-39,0-22,5-24						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
659	chrIII	9737494	9737950	3500262937	48		9737494	9737950	8421504	2	25,23	0,433	c,g	350026293700000003,350026293700000003,350026293700000002,350026293700000002	10-35,10-35,10-33,10-33						The Snail-like CES-1 protein of C. eleganscan block the expression of the BH3-onlycell-death activator gene egl-1by antagonizing the function of bHLH proteins	ev.biologists.org	0	0		
659	chrIII	9739881	9760037	3500398582	41		9739881	9760037	8421504	5	11,7,4,4,15	0,458,466,20136,20141	c	350039858200000952,350039858200003148	9-32,6-25						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
659	chrIII	9745107	9745130	3500411180	23		9745107	9745130	8421504	1	23	0	g	350041118000000000	0-23		21611156	10.1371/journal.pone.0019937		PLoS ONE	Determining the Sub-Cellular Localization of Proteins within Caenorhabditis elegans Body Wall Muscle	Barbara	2011	0		
659	chrIII	9746017	9746041	3500075883	23		9746017	9746041	8421504	2	8,15	0,9	c	350007588300000028	19-42						 <HTML> <HEAD><TITLE>adega<<a3a1/4a1i1/4i1/4i1/4aaa3e,aaaaa2aa1/4a1/4aaa3aaaa	www.j-tokkyo.com	0	0		
659	chrIII	9748323	9759798	3500061824	41		9748323	9759798	8421504	2	21,20	0,11455	c,g	350006182400000003,350006182400000004,350006182400000004	0-21,0-20,0-20						Additional Methods and Materials | Schedl Lab	enetics.wustl.edu	0	0		
659	chrIII	9760035	9767647	3500190843	60		9760035	9767647	8421504	6	14,5,6,13,9,13	0,16,2420,2428,7589,7599	c,g	350019084300001223,350019084300001223,350019084300001404,350019084300001353	20-39,20-39,15-34,0-22						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
659	chrIII	9772921	9773253	3500213969	42		9772921	9773253	8421504	3	22,11,9	0,140,323	c,g	350021396900000010,350021396900000010,350021396900000011	0-22,0-22,0-20		19924292	10.1371/journal.pbio.1000245	1545-7885	PLOS Biology	PLOS Biology: Role of CBP and SATB-1 in Aging, Dietary Restriction, and Insulin-Like Signaling	Zhang	2009	0		
659	chrIII	9772921	9773253	3500172109	42		9772921	9773253	8421504	3	22,11,9	0,140,323	c,g	350017210900000010,350017210900000010,350017210900000011	0-22,0-22,0-20		19924292	10.1371/journal.pbio.1000245		PLoS Biology	Role of CBP and SATB-1 in Aging, Dietary Restriction, and Insulin-Like Signaling	Minhua	2009	0		
659	chrIII	9778504	9778958	3500270812	54		9778504	9778958	8421504	2	26,28	0,426	c,g	350027081200000005,350027081200000005,350027081200000004	12-38,12-38,12-40		19675127	10.1242/dev.039008	0950-1991	Development	Systematic analysis of dynamic miRNA-target interactions during C. elegans development	Zhang	2009	7		
659	chrIII	9781761	9782730	3500327444	41		9781761	9782730	8421504	2	20,21	0,948	g	350032744400000000,350032744400000001	0-20,0-21		9305897	10.1074/jbc.272.39.24387	0021-9258	Journal of Biological Chemistry	Three vha Genes Encode Proteolipids ofCaenorhabditis elegans Vacuolar-type ATPase	Oka	1997	5		
659	chrIII	9782654	9783135	3500212106	48		9782654	9783135	8421504	2	26,22	0,459	g	350021210600000006,350021210600000007	4-30,9-31						Supplementary Information	ans.imbb.forth.gr	0	0		
659	chrIII	9815195	9815306	3500249133	100		9815195	9815306	8421504	2	50,50	0,61	c,g	350024913300000031,350024913300000031,350024913300000030,350024913300000030	0-50,0-50,0-50,0-50							roarrays.ucsd.edu	0	0		
659	chrIII	9815296	9815620	3500328606	54		9815296	9815620	8421504	2	51,3	0,321	p	350032860600015051	0-54						Modified Proteins, Designer Toxins, and Methods of Making Thereof - Patent application	www.faqs.org	0	0		
660	chrIII	9866141	9866170	3500075808	23		9866141	9866170	8421504	3	5,7,11	0,8,18	c	350007580800000016	9-32						www.rbej.com - Table 	www.rbej.com	0	0		
660	chrIII	9869009	9869033	3500018725	23		9869009	9869033	8421504	2	19,4	0,20	g	350001872500000248	0-23						<Html><Title> Complet list of 1bu8 hssp file Complet list of	cnptia.embrapa.br	0	0		
660	chrIII	9872123	9872146	3500062653	23		9872123	9872146	8421504	1	23	0	g	350006265300000068	9-38						DELTA 17 DESATURASE AND ITS USE IN MAKING POLYUNSATURATED FATTY ACIDS - Patent application	www.faqs.org	0	0		
660	chrIII	9894990	9895019	3500031581	27		9894990	9895019	8421504	2	13,14	0,15	g	350003158100000087	10-37						U.S. Veterinary Immune Reagent Network Primer Pairs Used for Cloning Target Sequences September 3, 2008	www.umass.edu	0	0		
660	chrIII	9914541	9915418	3500364041	40		9914541	9915418	8421504	2	20,20	0,857	g	350036404100000008,350036404100000009	0-20,0-20		19822669	10.1083/jcb.200903024	0021-9525	The Journal of Cell Biology	Ubiquilin and p97/VCP bind erasin, forming a complex involved in ERAD	Lim	2009	10		
660	chrIII	9914541	9915418	3500238090	40		9914541	9915418	8421504	2	20,20	0,857	g	350023809000000008,350023809000000009	0-20,0-20		19822669	10.1083/jcb.200903024		The Journal of Cell Biology	Ubiquilin and p97/VCP bind erasin, forming a complex involved in ERAD	Precious	2009	0		
660	chrIII	9936119	9936144	3500098009	25		9936119	9936144	8421504	1	25	0	c	350009800900000014	8-33						PROSTATE-SPECIFIC POLYPEPTIDE PAMP AND ENCODING NUCLEIC ACID MOLECULES - Patent application	www.faqs.org	0	0		
661	chrIII	9964880	9964906	3500017403	23		9964880	9964906	8421504	2	6,17	0,9	g	350001740300000134	19-42						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
661	chrIII	9974087	9974111	3500262471	24		9974087	9974111	8421504	1	24	0	g	350026247100000045	0-29						<HTML><HEAD><meta http-equiv="Content-Type" content="text/html; charset=ISO-8859-1"><LINK REL="SHORT	.economie.fgov.be	0	0		
661	chrIII	10012944	10013025	3500196959	28		10012944	10013025	8421504	3	18,5,5	0,68,76	c	350019695900001747	16-44						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
661	chrIII	10016087	10016173	3500214091	42		10016087	10016173	8421504	2	21,21	0,65	c	350021409100000000,350021409100000002	0-21,0-21		10950865	10.1101/gad.14.16.2003	0890-9369	Genes & Development	Multiple RGS proteins alter neural G protein signaling to allow C. elegans to rapidly change behavior when fed	Dong	2000	12		
661	chrIII	10016730	10016774	3500027476	38		10016730	10016774	8421504	3	22,12,4	0,27,40	c	350002747600000029	116-162						<!DOCTYPE HTML PUBLIC i3/4-//IETF//DTD HTML 3.0//ENi3/4> <!- SPECIFICATION OF LANGUAGE-> <HTML> 	wheat.pw.usda.gov	0	0		
661	chrIII	10027786	10027816	3500067594	30		10027786	10027816	8421504	1	30	0	g	350006759400000358	0-38						<HTML> <table width=100%> <tr> <td width=20% bgcolor="#CDC0B0"><div align="center"><a href="ht	ioinformatics.org	0	0		
661	chrIII	10028060	10028089	3500287953	25		10028060	10028089	8421504	2	18,7	0,22	g	350028795300000383	19-44						Method For Increasing Pathogen Resistance In Transgenic Plants - Patent application	www.faqs.org	0	0		
661	chrIII	10028233	10028409	3500464597	44		10028233	10028409	8421504	2	21,23	0,153	c,g	350046459700000006,350046459700000006,350046459700000007,350046459700000007	0-21,0-21,0-23,0-23		21858156	10.1371/journal.pone.0023527	1932-6203	PLOS ONE	PLOS ONE: Lifespan-Extending Effects of Royal Jelly and Its Related Substances on the Nematode Caenorhabditis elegans	Honda	2011	4		
661	chrIII	10028581	10028605	3500319561	24		10028581	10028605	8421504	1	24	0	g	350031956100000007	24-48						daf-28 encodesa C. elegans insulin superfamilymemberthatisregulated byenvironmentalcuesandacts intheDAF-2signalingpathway	enesdev.cshlp.org	0	0		
661	chrIII	10045583	10046100	3500259767	40		10045583	10046100	8421504	2	20,20	0,497	c,g	350025976700000029,350025976700000028,350025976700000028	0-20,0-20,0-20		18828672	10.1371/journal.pbio.0060233		PLoS Biology	Caenorhabditis elegans HCF-1 Functions in Longevity Maintenance as a DAF-16 Regulator	Ji	2008	0		
661	chrIII	10063500	10063528	3500426808	24		10063500	10063528	8421504	3	11,8,5	0,14,23	g	350042680800000103,350042680800000001,350042680800000104	10-33,10-34,10-33						>trnF GCCGGGATAGCTCATTGGTA-GAGCAGAGGACT-GAAAA-TCC-TCGTGTC-----A--- ---CCAGT--------------T-------	.springerplus.com	0	0		
661	chrIII	10071907	10071936	3500190843	24		10071907	10071936	8421504	2	13,11	0,18	c	350019084300001649	10-40						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
662	chrIII	10120726	10120826	3500320950	51		10120726	10120826	8421504	2	18,33	0,67	p	350032095000015040	0-51						Diversity. and specialization of mammalian SWI/SNF complexes	enesdev.cshlp.org	0	0		
662	chrIII	10124828	10124852	3500141839	23		10124828	10124852	8421504	2	6,17	0,7	g	350014183900000028	3-26						在单子叶植物中调控表达的表达盒	H-S*Song 	2013	0		
662	chrIII	10132042	10132071	3500070755	24		10132042	10132071	8421504	3	14,5,5	0,17,24	c	350007075500000045	0-24						β－ガラクトシド－α２，６－シアル酸転移酵素 - 日本たばこ産業株式	www.patentjp.com	0	0		
662	chrIII	10146363	10192831	3500233403	40		10146363	10192831	8421504	4	6,15,6,13	0,7,46446,46455	c,g	350023340300002209,350023340300002209,350023340300000320,350023340300000320	7-30,7-30,5-24,5-24						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
662	chrIII	10154692	10155666	3500152767	43		10154692	10155666	8421504	4	7,14,12,10	0,597,884,964	c	350015276700000015,350015276700000016	0-21,0-22			10.1371/journal.pgen.0030095	1553-7404	PLOS Genetics	PLOS Genetics: No Influence of Indy on Lifespan in Drosophila after Correction for Genetic and Cytoplasmic Background Effects	Toivonen	2007	0		
662	chrIII	10154692	10155666	3500058029	43		10154692	10155666	8421504	4	7,14,12,10	0,597,884,964	c	350005802900000015,350005802900000016	0-21,0-22						No influence of Indy on lifespan in Drosophila after correction for genetic and cytoplasmic background effects.	.biomedsearch.com	0	0		
662	chrIII	10155712	10155739	3500172525	23		10155712	10155739	8421504	2	13,10	0,17	c	350017252500000104	10-36							ultry.mph.msu.edu	0	0		
662	chrIII	10183545	10191922	3500077843	43		10183545	10191922	8421504	2	21,22	0,8355	c,g	350007784300000014,350007784300000018	9-30,7-29		22897658	10.1111/j.1365-2443.2012.01627.x	1365-2443	Genes to Cells	Neuronally expressed Ras-family GTPase Di-Ras modulates synaptic activity in Caenorhabditis elegans - Tada - 2012 - Genes to Cells - Wiley Online Library	Tada	2012	0		
662	chrIII	10183779	10186169	3500355877	42		10183779	10186169	8421504	2	21,21	0,2369	c,g	350035587700000046,350035587700000046,350035587700000045,350035587700000045	0-21,0-21,0-21,0-21		11566876	10.1093/emboj/20.18.5114	ERROR! NO ISSN	The EMBO Journal	jkk-1 and mek-1 regulate body movement coordination and response to heavy metals through jnk-1 in Caenorhabditis elegans	Villanueva	2001	0		
662	chrIII	10184600	10184628	3500026001	24		10184600	10184628	8421504	2	11,13	0,15	g	350002600100000020	21-45						US Patent # 6,887,988. Plant reproduction polynucleotides and methods of use - Patents.com	www.patents.com	0	0		
662	chrIII	10186122	10186150	3500385183	23		10186122	10186150	8421504	2	9,14	0,14	c	350038518300000475	8-34						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
662	chrIII	10186155	10186545	3500149397	390		10186155	10186545	8421504	1	390	0	g	350014939700000028,350014939700000027,350014939700000026,350014939700000024	0-126,43-122,0-129,0-135						Functional tests of enhancer conservation between distantly related species	ev.biologists.org	0	0		
662	chrIII	10186159	10187363	3500265248	55		10186159	10187363	8421504	3	6,28,21	0,7,1183	g	350026524800000014,350026524800000013	6-40,11-32		18369447			PLoS Genetics	Gene Activation Using FLP Recombinase in C. elegans - Scolaris	Davis	2008	0		
662	chrIII	10186159	10187363	3500126534	55		10186159	10187363	8421504	3	6,28,21	0,7,1183	g	350012653400000014,350012653400000013	6-40,11-32						Gene Activation Using FLP Recombinase in C. elegans	logylabs.utah.edu	0	0		
662	chrIII	10187339	10187467	3500372678	41		10187339	10187467	8421504	2	20,21	0,107	g	350037267800000010,350037267800000007	0-20,0-21						ScienceDirect.com - Developmental Biology - Overexpression of PPK-1, the Caenorhabditis elegans Type I PIP kinase, inhibits growth cone collapse in the developing nervous system and causes axonal degeneration in adults	sciencedirect.com	0	0		
662	chrIII	10187339	10187467	3500045200	41		10187339	10187467	8421504	2	20,21	0,107	g	350004520000000010,350004520000000007	0-20,0-21			10.1016/j.ydbio.2007.10.029		Developmental biology	Overexpression of PPK-1, the C. elegans Type 1 PIP kinase, inhibits growth cone collapse in the developing nervous system and causes axonal degeneration in adults	David	2008	0		
662	chrIII	10187393	10187420	3500100672	27		10187393	10187420	8421504	1	27	0	g	350010067200000006	26-53						Supporting Information	www.pnas.org	0	0		
662	chrIII	10187393	10187420	3500063341	27		10187393	10187420	8421504	1	27	0	g	350006334100000006	26-53						Graded synaptic transmission at the Caenorhabditis elegansneuromuscular junction	logylabs.utah.edu	0	0		
662	chrIII	10187865	10187897	3500130734	28		10187865	10187897	8421504	2	13,15	0,17	c	350013073400000134	7-35						<Html><Title> Complet list of 3igz hssp file Complet list of	cnptia.embrapa.br	0	0		
662	chrIII	10189287	10189315	3500100132	24		10189287	10189315	8421504	2	6,18	0,10	g	350010013200000041	6-33						Cyclin-dependent kinase inhibitors and uses thereof - Patent application	www.faqs.org	0	0		
662	chrIII	10197664	10197734	3500115152	42		10197664	10197734	8421504	2	22,20	0,50	c,g	350011515200000008,350011515200000009	0-22,0-20		22363222	10.3390/md10010084		Marine Drugs	Tasco®: A Product of Ascophyllum nodosum Enhances Immune Response of Caenorhabditis elegans Against Pseudomonas aeruginosa Infection	Saveetha	2012	0		
662	chrIII	10203220	10203244	3500292075	23		10203220	10203244	8421504	2	12,11	0,13	g	350029207500001955	10-33						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
662	chrIII	10209224	10209248	3500365490	24		10209224	10209248	8421504	1	24	0	c	350036549000000034	0-24						Process For The Production Of Delta5-unsaturated Fatty Acids In Transgenic Organisms 	.freshpatents.com	0	0		
662	chrIII	10217289	10218553	3500028307	1042		10217289	10218553	8421504	14	13,43,15,6,44,35,19,40,19,9,66,121,232,380	0,14,58,74,81,126,163,183,253,274,324,438,603,884	c,g	350002830700000084,350002830700000083,350002830700000082,350002830700000082,350002830700000081,350002830700000080,350002830700000078,350002830700000078,350002830700000077,350002830700000077,350002830700000156,350002830700000156,350002830700000074,350002830700000074,350002830700000071,350002830700000070,350002830700000068,350002830700000062,350002830700000062,350002830700000059,350002830700000059,350002830700000058,350002830700000058,350002830700000057	0-42,0-35,0-22,0-22,0-57,0-59,0-28,0-28,0-19,0-19,0-780,0-780,0-25,0-25,0-49,0-51,0-26,0-39,0-39,0-19,0-19,0-60,0-60,0-43						114 craig c. mello - 7759463 - rna interference pathway genes as ...	ww.slideshare.net	0	0		
662	chrIII	10217533	10218181	3500402920	237		10217533	10218181	8421504	7	54,11,40,21,24,79,8	0,135,194,294,359,512,640	p	350040292000015061,350040292000015059,350040292000015047,350040292000015045	0-54,6-57,0-45,0-87						Identification and Analysis of Dicer Associated Proteins in Human Cells Inaugurationsdissertation	edoc.unibas.ch	0	0		
663	chrIII	10232467	10232498	3500074925	27		10232467	10232498	8421504	3	17,3,7	0,18,24	g	350007492500000142	9-36						A plant with reduced lignin by modulating dahps gene expression	Jensen	2006	0		
663	chrIII	10246520	10281518	3500343811	44		10246520	10281518	8421504	3	16,8,20	0,20,34978	g	350034381100003936,350034381100002592	11-36,0-20						1531 26.93 2.31 1.16 sequence_4 1 432 (149568) + Gypsy12-ZM_I LTR/Gypsy 	nomics.purdue.edu	0	0		
663	chrIII	10254352	10254380	3500352612	23		10254352	10254380	8421504	2	6,17	0,11	c	350035261200000352	18-44						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
663	chrIII	10256946	10256973	3500449315	24		10256946	10256973	8421504	2	12,12	0,15	c	350044931500000626	2-26						US Patent # 7,491,698. Mixing and matching TC proteins for pest control - Patents.com	www.patents.com	0	0		
663	chrIII	10256946	10256973	3500080694	24		10256946	10256973	8421504	2	12,12	0,15	c	350008069400000596	5-29						MIXING AND MATCHING TC PROTEINS FOR PEST CONTROL - Patent application	www.faqs.org	0	0		
663	chrIII	10293863	10293891	3500097894	23		10293863	10293891	8421504	2	10,13	0,15	g	350009789400000193	9-32						PLANT-SPECIFIC GENETIC ELEMENTS AND TRANSFER CASSETTES FOR PLANT TRANSFORMATION - Patent application	www.faqs.org	0	0		
663	chrIII	10302862	10302892	3500298767	25		10302862	10302892	8421504	2	13,12	0,18	g	350029876700000001,350029876700000000,350029876700000006,350029876700000005	0-26,0-20,0-26,0-20						SIGMA AL E3PIICH FACTURA 111 111 011111111101 111 111	www.ibmb.csic.es	0	0		
663	chrIII	10318941	10319502	3500375753	347		10318941	10319502	8421504	6	25,46,53,61,137,25	0,50,161,238,348,536	p,g	350037575300000000,350037575300015002,350037575300015018,350037575300015017,350037575300015027,350037575300000001	0-25,0-99,0-150,0-150,0-48,0-25						The short coiled-coil domain-containing protein UNC-69 cooperates with UNC-76 to regulate axonal outgrowth and normal presynaptic organization in Caenorhabditis	mit.dspace.org	0	0		
663	chrIII	10318941	10319502	3500154092	50		10318941	10319502	8421504	2	25,25	0,536	g	350015409200000000,350015409200000001	0-25,0-25			10.1186/jbiol39		Journal of Biology	The short coiled-coil domain-containing protein UNC-69 cooperates with UNC-76 to regulate axonal outgrowth and normal presynaptic organization in Caenorhabditis elegans	Cheng-Wen	2006	0		
663	chrIII	10318941	10319502	3500009341	50		10318941	10319502	8421504	2	25,25	0,536	g	350000934100000000,350000934100000001	0-25,0-25		16725058	10.1186/jbiol39	1475-4924	Journal of Biology	The short coiled-coil domain-containing protein UNC-69 cooperates with UNC-76 to regulate axonal outgrowth and normal presynaptic organization in Caenorhabditis elegans	Su	2006	0		
663	chrIII	10322860	10322886	3500209369	23		10322860	10322886	8421504	2	12,11	0,15	g	350020936900000139	23-48						MANIPULATION OF CELLULOSE AND/OR $g(b)-1,4-GLUCAN	Arioli	1999	0		
663	chrIII	10333071	10335304	3500143011	87		10333071	10335304	8421504	5	25,21,1,20,20	0,242,312,2022,2213	c,g	350014301100000002,350014301100000003,350014301100000004,350014301100000004,350014301100000005,350014301100000005	0-25,0-22,0-20,0-20,0-20,0-20		17021039	10.1242/dev.02614	0950-1991	Development	Pax2/5/8 proteins promote cell survival in C. elegans	Park	2006	7		
663	chrIII	10335075	10336986	3500231117	62		10335075	10336986	8421504	3	21,20,21	0,1171,1890	c,g	350023111700000000,350023111700000003,350023111700000003,350023111700000001	9-30,0-20,0-20,9-30						Stress resistant plant	Malik	2004	0		
663	chrIII	10335075	10336986	3500217410	82		10335075	10336986	8421504	4	20,20,20,22	0,70,1816,1889	c,g	350021741000000000,350021741000000002,350021741000000002,350021741000000003,350021741000000001	16-36,0-20,0-20,0-20,8-30						Effects of ced-9 dsRNA on Caenorhabditis elegans and Meloidogyne incognita	thescipub.com	0	0		
663	chrIII	10335133	10336196	3500409609	46		10335133	10336196	8421504	2	22,24	0,1039	c,g	350040960900000005,350040960900000005,350040960900000006,350040960900000006	0-22,0-22,0-24,0-24						IMPROVED METHODS AND CONSTRUCTS FOR MARKER FREE AGROBACTERIUM MEDIATED TRANSFORMATIOM - QUEENSLAND UNIVERSITY OF TECHNOLOGY	www.sumobrain.com	0	0		
663	chrIII	10335293	10335389	3500105711	48		10335293	10335389	8421504	2	36,12	0,84	p	350010571100015129	0-48						BH3 interacting domain death agonist	Korsmeyer	1996	0		
663	chrIII	10339938	10343913	3500329932	84		10339938	10343913	8421504	4	21,20,21,22	0,1577,1618,3953	c,g	350032993200000003,350032993200000000,350032993200000000,350032993200000001,350032993200000001,350032993200000002	0-21,0-20,0-20,0-21,0-21,0-22			10.1111/j.1356-9597.2004.00725.x	1365-2443	Genes to Cells	Caenorhabditis elegans T-box genes tbx-9 and tbx-8 are required for formation of hypodermis and body-wall muscle in embryogenesis - Andachi - 2004 - Genes to Cells - Wiley Online Library	Andachi	2004	0		
82	chrIII	10345472	10367999	3500197929	40		10345472	10367999	8421504	3	19,12,9	0,22503,22518	g	350019792900001992,350019792900001450	17-36,12-33						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
664	chrIII	10355130	10355196	3500115152	40		10355130	10355196	8421504	2	20,20	0,46	c,g	350011515200000005,350011515200000005,350011515200000004,350011515200000004	0-20,0-20,0-20,0-20		22363222	10.3390/md10010084		Marine Drugs	Tasco®: A Product of Ascophyllum nodosum Enhances Immune Response of Caenorhabditis elegans Against Pseudomonas aeruginosa Infection	Saveetha	2012	0		
664	chrIII	10355160	10355356	3500200576	60		10355160	10355356	8421504	3	20,20,20	0,154,176	c,g	350020057600000027,350020057600000027,350020057600000026,350020057600000026,350020057600000028,350020057600000028	0-20,0-20,0-20,0-20,0-20,0-20		18221392	10.1111/j.1462-5822.2008.01124.x	1462-5822	Cellular Microbiology	Resistance to antimicrobial peptides contributes to persistence of Salmonella typhimurium in the C. elegans intestine - Alegado - 2008 - Cellular Microbiology - Wiley Online Library	Alegado	2008	0		
664	chrIII	10381567	10397584	3500226963	48		10381567	10397584	8421504	2	25,23	0,15994	c,g	350022696300000233,350022696300000164	11-36,13-36						<Html><Title> Complet list of 1juk hssp file Complet list of	cnptia.embrapa.br	0	0		
664	chrIII	10397561	10397588	3500028321	27		10397561	10397588	8421504	1	27	0	c	350002832100000148	5-32						<Html><Title> Complet list of 3o4s hssp file Complet list of	cnptia.embrapa.br	0	0		
664	chrIII	10397561	10397587	3500036175	26		10397561	10397587	8421504	1	26	0	c	350003617500000002	0-26						<Html><Title> Complet list of 1jkn hssp file Complet list of	cnptia.embrapa.br	0	0		
664	chrIII	10397562	10397586	3500306261	24		10397562	10397586	8421504	1	24	0	c	350030626100000541	0-24						<Html><Title> Complet list of 2b6p hssp file Complet list of	cnptia.embrapa.br	0	0		
664	chrIII	10397563	10397589	3500458149	26		10397563	10397589	8421504	1	26	0	c	350045814900000023	0-26						<Html><Title> Complet list of 1lbb hssp file Complet list of	cnptia.embrapa.br	0	0		
664	chrIII	10397563	10397587	3500007863	24		10397563	10397587	8421504	1	24	0	c	350000786300000005	7-31						<Html><Title> Complet list of 3doo hssp file Complet list of	cnptia.embrapa.br	0	0		
664	chrIII	10419135	10419164	3500150976	25		10419135	10419164	8421504	2	10,15	0,14	c	350015097600000059	16-41						DNA fragments array from biomining microorganisms and method for detection of them - Patent # 7915031 - PatentGenius	.patentgenius.com	0	0		
664	chrIII	10419183	10419231	3500385499	48		10419183	10419231	8421504	1	48	0	p	350038549900015166,350038549900015064	0-45,3-48						US Patent # 6,603,060. Method for regulating cell death - Patents.com	www.patents.com	0	0		
664	chrIII	10419186	10419231	3500405057	45		10419186	10419231	8421504	1	45	0	p	350040505700015063	3-48						細胞死を調節する方法 - 農林水産省農業生物資源研究所長	www.patentjp.com	0	0		YME1L1
664	chrIII	10464418	10465631	3500434742	1213		10464418	10465631	8421504	1	1213	0	c,g	350043474200000001,350043474200000001,350043474200000002	19-39,19-39,0-1213						RNAi and Knockouts - galindogen677S12	677s12.weebly.com	0	0		
664	chrIII	10467082	10467107	3500205714	23		10467082	10467107	8421504	2	18,5	0,20	c	350020571400000555	18-41						Starchy-endosperm and/or germinating embryo-specific expression in mono-cotyledonous plants - Patent application	www.faqs.org	0	0		AAK1
664	chrIII	10471140	10473077	3500461406	40		10471140	10473077	8421504	3	20,18,2	0,1395,1935	c,g	350046140600000002,350046140600000002,350046140600000003	0-20,0-20,0-20		17914060	10.1091/mbc.E07-03-0243	1059-1524	Molecular Biology of the Cell	Caenorhabditis elegans prom-1 Is Required for Meiotic Prophase Progression and Homologous Chromosome Pairing	Jantsch	2007	5		
664	chrIII	10471140	10473077	3500045766	40		10471140	10473077	8421504	3	20,18,2	0,1395,1935	c,g	350004576600000002,350004576600000002,350004576600000003	0-20,0-20,0-20			10.1091/mbc.E07-03-0243		Molecular Biology of the Cell	Caenorhabditis elegans prom-1 Is Required for Meiotic Prophase Progression and Homologous Chromosome Pairing	Verena	2007	0		
664	chrIII	10471691	10472194	3500383377	40		10471691	10472194	8421504	2	20,20	0,483	c,g	350038337700000009,350038337700000009,350038337700000010,350038337700000010	0-20,0-20,0-20,0-20		23352664	10.1016/j.celrep.2012.12.018	2211-1247	Cell Reports	Cell Reports - A Fasting-Responsive Signaling Pathway that Extends Life Span in C. elegans	Uno	2013	0		
665	chrIII	10492589	10492615	3500110319	24		10492589	10492615	8421504	2	17,7	0,19	c,g	350011031900000060,350011031900000060	0-26,0-26						Regulation der Phosphatmangelgene von Corynebacterium glutamicum durch das Zweikomponenten-System PhoRS	ni-duesseldorf.de	0	0		
665	chrIII	10506229	10506336	3500161519	41		10506229	10506336	8421504	3	20,16,5	0,30,102	c,g	350016151900000026,350016151900000026,350016151900000025	0-20,0-20,0-21						Cell, Volume 136	download.cell.com	0	0		
665	chrIII	10506240	10506503	3500213969	44		10506240	10506503	8421504	2	23,21	0,242	c,g	350021396900000019,350021396900000018,350021396900000018	0-23,0-21,0-21		19924292	10.1371/journal.pbio.1000245	1545-7885	PLOS Biology	PLOS Biology: Role of CBP and SATB-1 in Aging, Dietary Restriction, and Insulin-Like Signaling	Zhang	2009	0		
665	chrIII	10506240	10506503	3500172109	44		10506240	10506503	8421504	2	23,21	0,242	c,g	350017210900000019,350017210900000018,350017210900000018	0-23,0-21,0-21		19924292	10.1371/journal.pbio.1000245		PLoS Biology	Role of CBP and SATB-1 in Aging, Dietary Restriction, and Insulin-Like Signaling	Minhua	2009	0		
665	chrIII	10518206	10528728	3500241381	40		10518206	10528728	8421504	4	15,6,6,13	0,19,10502,10509	g	350024138100000958,350024138100001883	10-34,16-35						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
665	chrIII	10520869	10524172	3500355877	43		10520869	10524172	8421504	2	22,21	0,3282	c,g	350035587700000047,350035587700000047,350035587700000048,350035587700000048	0-22,0-22,0-21,0-21		11566876	10.1093/emboj/20.18.5114	ERROR! NO ISSN	The EMBO Journal	jkk-1 and mek-1 regulate body movement coordination and response to heavy metals through jnk-1 in Caenorhabditis elegans	Villanueva	2001	0		
665	chrIII	10536984	10537016	3500029989	26		10536984	10537016	8421504	3	4,8,14	0,5,18	c,g	350002998900000183,350002998900000183,350002998900000088,350002998900000088,350002998900000069,350002998900000069,350002998900000202,350002998900000202	6-32,6-32,8-34,8-34,6-32,6-32,8-34,8-34						ACID-CLEVABLE LINKERS EXHIBITING ALTERED RATES OF ACID HYDROLYSIS - Patent application	www.faqs.org	0	0		
665	chrIII	10604324	10612731	3500028833	97		10604324	10612731	8421504	3	20,20,57	0,1836,8350	p,g	350002883300000000,350002883300000001,350002883300015000	0-20,0-20,3-60			10.1038/ncb1261		Nature cell biology	Caenorhabditis elegans RME-6, a novel regulator of Rab5 at the clathrin-coated pit	Miyuki	June	0		
666	chrIII	10630859	10630885	3500127573	23		10630859	10630885	8421504	2	10,13	0,13	c	350012757300000061	0-23						Need et al, 2012	.endojournals.org	0	0		
666	chrIII	10668494	10673292	3500241788	41		10668494	10673292	8421504	4	14,7,4,16	0,19,4777,4782	c,g	350024178800003129,350024178800003688	14-35,9-29						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
666	chrIII	10693672	10693700	3500311536	23		10693672	10693700	8421504	2	17,6	0,22	c	350031153600000120	7-30						<Html><Title> Complet list of 1a5y hssp file Complet list of	cnptia.embrapa.br	0	0		
666	chrIII	10703797	10703823	3500137812	23		10703797	10703823	8421504	2	6,17	0,9	c	350013781200000225	8-35						无乳链球菌抗原Ⅰ和Ⅱ	A*Mei Ke 	2010	0		
666	chrIII	10722486	10729805	3500197871	1294		10722486	10729805	8421504	22	3,60,51,27,18,3,27,57,27,39,24,48,123,90,210,21,150,74,20,132,60,30	0,392,562,616,670,1217,1226,1256,2977,3007,3049,3400,4237,4630,4789,5002,5026,5182,5264,5710,6058,7289	p,c,g	350019787100015145,350019787100015135,350019787100015134,350019787100015095,350019787100015079,350019787100015066,350019787100015060,350019787100015053,350019787100000005,350019787100000005,350019787100000006,350019787100000006,350019787100015044,350019787100015033,350019787100000007,350019787100000004,350019787100000004	0-63,6-84,0-105,6-96,0-48,0-213,0-282,12-174,0-20,0-20,0-20,0-20,6-138,6-66,0-20,0-20,0-20						Supporting Online Material for	ww.sciencemag.org	0	0		
666	chrIII	10722486	10729805	3500114832	1294		10722486	10729805	8421504	22	3,60,51,27,18,3,27,57,27,39,24,48,123,90,210,21,150,74,20,132,60,30	0,392,562,616,670,1217,1226,1256,2977,3007,3049,3400,4237,4630,4789,5002,5026,5182,5264,5710,6058,7289	p,c,g	350011483200015145,350011483200015135,350011483200015134,350011483200015095,350011483200015079,350011483200015066,350011483200015060,350011483200015053,350011483200000005,350011483200000005,350011483200000006,350011483200000006,350011483200015044,350011483200015033,350011483200000007,350011483200000004,350011483200000004	0-63,6-84,0-105,6-96,0-48,0-213,0-282,12-174,0-20,0-20,0-20,0-20,6-138,6-66,0-20,0-20,0-20						Role of C. elegans TAT-1 Protein in Maintaining Plasma Membrane Phosphatidylserine Asymmetry Monica Darland-Ransom, www.sciencemag.org (this information is current as of April 24, 2008 )	mcdb.colorado.edu	0	0		
666	chrIII	10740997	10741046	3500444927	49		10740997	10741046	8421504	1	49	0	c	350044492700000065	11-60						1. Potato Dextrose Agar (PDA)	ive.lib.cmu.ac.th	0	0		
666	chrIII	10741005	10741030	3500014029	25		10741005	10741030	8421504	1	25	0	g	350001402900000069	23-48						Développement d’une méthodologie d’analyse de la conservation de synténie chez les plantes. Du génome d’Arabidopsis à celui du Tournesol	s.inp-toulouse.fr	0	0		
666	chrIII	10741022	10741046	3500385897	24		10741022	10741046	8421504	1	24	0	c	350038589700000003	0-24						ScienceDirect.com - Fungal Biology - Ontogeny and phylogeny of a Scutellospora heterogama mutant, with implications for morphological recognition of species in Glomeromycota	sciencedirect.com	0	0		
666	chrIII	10741176	10741708	3500259202	115		10741176	10741708	8421504	4	38,23,25,29	0,287,344,503	c,g	350025920200000508,350025920200000440,350025920200000526,350025920200000395,350025920200000527,350025920200000610,350025920200000383,350025920200000383	0-28,0-29,0-26,0-29,0-23,4-29,0-29,0-29						Nematode Control	Craen	2010	0		
666	chrIII	10741463	10741708	3500318788	77		10741463	10741708	8421504	3	23,25,29	0,57,216	c,g	350031878800000465,350031878800000548,350031878800000333,350031878800000333	0-23,4-29,0-29,0-29						Nematode Control 	.freshpatents.com	0	0		
666	chrIII	10741665	10741695	3500117081	30		10741665	10741695	8421504	1	30	0	c,g	350011708100000000,350011708100000000,350011708100000003	5-35,5-35,5-35						Presentación de PowerPoint	www.ivia.es	0	0		
666	chrIII	10742176	10742199	3500355095	23		10742176	10742199	8421504	1	23	0	c	350035509500000001	0-23		20300184	10.1371/journal.pone.0009655		PLoS ONE	Motor Neuron Synapse and Axon Defects in a C. elegans Alpha-Tubulin Mutant	Renee	2010	0		
666	chrIII	10742176	10742199	3500351463	23		10742176	10742199	8421504	1	23	0	c	350035146300000001	0-23		20300184	10.1371/journal.pone.0009655	1932-6203	PLOS ONE	PLOS ONE: Motor Neuron Synapse and Axon Defects in a C. elegans Alpha-Tubulin Mutant	Baran	2010	4		
666	chrIII	10742196	10742236	3500121931	40		10742196	10742236	8421504	1	40	0	c	350012193100000023	0-40						Supporting Online Material for	mcb.berkeley.edu	0	0		
666	chrIII	10742303	10742326	3500215144	23		10742303	10742326	8421504	1	23	0	c	350021514400000008,350021514400000004	10-32,13-35						Original Article--《细胞学杂志》--医学期刊频道--首席医学网	journal.9med.net	0	0		
666	chrIII	10746790	10747627	3500204591	46		10746790	10747627	8421504	2	24,22	0,815	c,g	350020459100000010,350020459100000009,350020459100000009	0-24,0-22,0-22						Four bait constructs, p32RAPH, p32M10A, p32M10B, and p32M10C were created for use in the yeast two-hybrid system all using the same bait vector, pDEST32™	www.wpi.edu	0	0		
667	chrIII	10753424	10753449	3500040069	25		10753424	10753449	8421504	1	25	0	c	350004006900000000	19-44			10.1093/embo-reports/kvf051	ERROR! NO ISSN	EMBO reports	A heterochromatin protein 1 homologue in Caenorhabditis elegans acts in germline and vulval development	Couteau	2002	0		
667	chrIII	10753643	10755411	3500176962	45		10753643	10755411	8421504	2	23,22	0,1746	c,g	350017696200000003,350017696200000003,350017696200000002	0-23,0-23,0-22		15741313	10.1101/gad.1247705	0890-9369	Genes & Development	Transcriptional silencing of a transgene by RNAi in the soma of C. elegans	Grishok	2005	12		
667	chrIII	10753643	10755411	3500167276	45		10753643	10755411	8421504	2	23,22	0,1746	c,g	350016727600000003,350016727600000003,350016727600000002,350016727600000002	0-23,0-23,0-22,0-22						Transcriptional silencing of a transgene by RNAi in the soma of C. elegans--《基因进展》医学期刊--医学期刊频道--首席医学网	journal.9med.net	0	0		
667	chrIII	10786875	10813826	3500144336	41		10786875	10813826	8421504	4	17,4,14,6	0,18,26927,26945	c,g	350014433600000201,350014433600000520,350014433600000572	23-44,3-23,3-23						Alanine 2,3,aminomutase	Ao Li *J*Ye Sen 	2007	0		
667	chrIII	10808765	10809423	3500404771	45		10808765	10809423	8421504	2	22,23	0,635	c,g	350040477100000009,350040477100000009,350040477100000010,350040477100000010	0-22,0-22,0-23,0-23		15767665	10.1128/MCB.25.7.2583-2592.2005	0270-7306	Molecular and Cellular Biology	HCP-4/CENP-C Promotes the Prophase Timing of Centromere Resolution by Enabling the Centromere Association of HCP-6 in Caenorhabditis elegans	Moore	2005	6		
667	chrIII	10808811	10809806	3500195941	40		10808811	10809806	8421504	2	20,20	0,975	c,g	350019594100000021,350019594100000021,350019594100000022,350019594100000022	19-39,19-39,19-39,19-39						NPG.nature.vol.409.Issue.6820.Feb	www.scribd.com	0	0		
667	chrIII	10809296	10809320	3500414022	24		10809296	10809320	8421504	1	24	0	c	350041402200000006	23-47		15616189	10.1091/mbc.E04-08-0712	1059-1524	Molecular Biology of the Cell	A Spindle Checkpoint Functions during Mitosis in the Early Caenorhabditis elegans Embryo	Encalada	2005	5		
667	chrIII	10812815	10816384	3500081772	84		10812815	10816384	8421504	4	19,20,22,23	0,92,3501,3546	c,g	350008177200000005,350008177200000007,350008177200000007,350008177200000006,350008177200000006,350008177200000004	0-19,0-20,0-20,0-22,0-22,0-23						METHODS FOR IDENTIFYING PESTICIDAL COMPOUNDS - DEVGEN NV	www.sumobrain.com	0	0		
667	chrIII	10814439	10815652	3500199600	40		10814439	10815652	8421504	2	20,20	0,1193	c,g	350019960000000003,350019960000000003,350019960000000002,350019960000000002	0-20,0-20,0-20,0-20						Improvements relating to double-stranded rna inhibition	Thierry	2001	0		
667	chrIII	10814439	10815652	3500166839	40		10814439	10815652	8421504	2	20,20	0,1193	c,g	350016683900000003,350016683900000003,350016683900000002,350016683900000002	0-20,0-20,0-20,0-20						Improvements relating to double-stranded rna inhibition	Bogaert	2001	0		
667	chrIII	10814546	10814693	3500221968	147		10814546	10814693	8421504	1	147	0	p	350022196800015016,350022196800015019	0-147,0-141							ater.cms.udel.edu	0	0		
667	chrIII	10814546	10814693	3500149736	147		10814546	10814693	8421504	1	147	0	p	350014973600015019,350014973600015016	0-141,0-147							128.175.24.176	0	0		
667	chrIII	10815050	10815140	3500126543	90		10815050	10815140	8421504	1	90	0	p	350012654300015004	0-90						BIOKÉMIA GYAKORLATI JEGYZET	elte-biokemia.hu	0	0		ATP2A3
667	chrIII	10816971	10819625	3500073651	2643		10816971	10819625	8421504	10	627,43,34,309,26,180,363,127,332,602	0,628,672,707,1018,1045,1226,1590,1719,2052	g	350007365100000019	5675-8323						用双链rna抑制鉴定基因功能	G*Pu Lai Ting Ke 	2007	0		
667	chrIII	10816971	10819625	3500064404	2648		10816971	10819625	8421504	4	309,1592,495,252	0,311,1905,2402	g	350006440400000019	5675-8323					Patent	用双链rna抑制鉴定基因功能 (Patent CN:1198938)	G*Pu Lai Ting Ke 	2005	0		
667	chrIII	10849137	10854170	3500112419	78		10849137	10854170	8421504	3	36,20,22	0,113,5011	c,g	350011241900000026,350011241900000012,350011241900000012,350011241900000004,350011241900000004,350011241900000005,350011241900000005	7-26,0-20,0-20,8-28,8-28,6-28,6-28			10.1074/jbc.M704235200		The Journal of biological chemistry	BIOSYNTHESIS OF TRUNCATED N-LINKED OLIGOSACCHARIDES RESULTS FROM NON-ORTHOLOGOUS HEXOSAMINIDASE-MEDIATED MECHANISMS IN NEMATODES, PLANTS AND INSECTS	Martin	2007	0		
667	chrIII	10849137	10854170	3500053064	78		10849137	10854170	8421504	3	36,20,22	0,113,5011	c,g	350005306400000026,350005306400000012,350005306400000012,350005306400000004,350005306400000004,350005306400000005	7-26,0-20,0-20,8-28,8-28,6-28		17636254	10.1074/jbc.M704235200	0021-9258	Journal of Biological Chemistry	Biosynthesis of Truncated N-Linked Oligosaccharides Results from Non-orthologous Hexosaminidase-mediated Mechanisms in Nematodes, Plants, and Insects	Gutternigg	2007	5		
667	chrIII	10876683	10876711	3500074991	24		10876683	10876711	8421504	2	11,13	0,15	g	350007499100006755	8-40							www.dartmouth.edu	0	0		
667	chrIII	10877840	10877866	3500316591	24		10877840	10877866	8421504	3	6,13,5	0,7,21	c	350031659100000208	1-25						A Phylogenetic Analysis of Epilobium (Onagraceae) Based on Nuclear Ribosomal DNA Sequences	www.jstor.org	0	0		
668	chrIII	10904054	10904077	3500183594	23		10904054	10904077	8421504	1	23	0	g	350018359400000012	0-23		21562563	10.1038/nature10007		Nature	N-acylethanolamine signaling mediates the effect of diet on lifespan in C. elegans	Mark	2011	0		
668	chrIII	10904094	10906370	3500361132	52		10904094	10906370	8421504	2	25,27	0,2249	g	350036113200000027,350036113200000028	16-41,20-47		16911797	10.1186/1741-7007-4-26	1741-7007	BMC Biology	Initiation of male sperm-transfer behavior in Caenorhabditis elegans requires input from the ventral nerve cord	Schindelman	2006	6		
668	chrIII	10904094	10906370	3500271498	52		10904094	10906370	8421504	2	25,27	0,2249	g	350027149800000003,350027149800000004	15-40,20-47		23994474	10.1016/j.celrep.2013.07.045	2211-1247	Cell Reports	Cell Reports - Nonautonomous Regulation of Neuronal Migration by Insulin Signaling, DAF-16/FOXO, and PAK-1	Kennedy	2013	0		
668	chrIII	10904094	10906370	3500257562	52		10904094	10906370	8421504	2	25,27	0,2249	g	350025756200000003,350025756200000004	15-40,20-47		23994474	10.1016/j.celrep.2013.07.045	2211-1247	Cell Reports	Cell Reports - Nonautonomous Regulation of Neuronal Migration by Insulin Signaling, DAF-16/FOXO, and PAK-1	Kennedy	2013	0		
668	chrIII	10904165	10905419	3500161519	60		10904165	10905419	8421504	3	20,20,20	0,1200,1234	g	350016151900000015,350016151900000017,350016151900000016	0-20,0-20,0-20						Cell, Volume 136	download.cell.com	0	0		
668	chrIII	10904173	10904379	3500222802	206		10904173	10904379	8421504	1	206	0	g	350022280200000008	14-220						载体目录_北京天恩泽	www.tiandz.com	0	0		
668	chrIII	10904176	10909889	3500038223	5713		10904176	10909889	8421504	1	5713	0	g	350003822300000000	0-5713						aagcttcagtaaaagaagtagaattttatagttttttttctgtttgaaaaattctccccatcaatgttctttcaaataaa tacatcactaatgcaaag	faculty.ucr.edu	0	0		
668	chrIII	10904176	10908836	3500380215	2138		10904176	10908836	8421504	10	379,343,287,4,135,135,74,112,381,288	0,381,726,1014,1019,1155,2180,3322,3504,4372	g	350038021500000001,350038021500000010	188-2328,378-2518						SEYDOUX LAB 2007 VECTOR KIT SEQUENCES	www.bs.jhmi.edu	0	0		
668	chrIII	10904176	10905380	3500325483	1196		10904176	10905380	8421504	7	163,215,343,287,4,135,49	0,164,381,726,1014,1019,1155	g	350032548300000016,350032548300000006	0-1202,0-1202						Transgenic C. elegans as a model organism for investigations on Alzheimer's disease	Peraus	1999	0		
668	chrIII	10905058	10908582	3500460501	85		10905058	10908582	8421504	4	20,25,20,20	0,1512,3003,3504	c,g	350046050100000018,350046050100000015,350046050100000012,350046050100000011,350046050100000011	0-20,0-25,0-20,0-20,0-20						Mechanismus der Neuroserpin-Demenz an einem Caenorhabditis elegans-Modell (Maupas, 1900) Dougherty, 1953	ub.uni-hamburg.de	0	0		
668	chrIII	10905153	10908978	3500225027	2335		10905153	10908978	8421504	20	36,4,93,136,90,11,136,180,180,46,4,45,5,136,90,131,266,47,269,430	0,37,42,180,361,511,585,766,991,1216,1273,1306,1453,1530,2251,2345,2527,2836,3106,3395	p,c,g	350022502700000009,350022502700000011,350022502700000013,350022502700000017,350022502700000024,350022502700000020,350022502700000021,350022502700000022,350022502700000018,350022502700000026,350022502700015000,350022502700000046,350022502700000028,350022502700000033,350022502700000045,350022502700000047,350022502700015002,350022502700000048,350022502700000050,350022502700000051,350022502700015005,350022502700000052,350022502700015006,350022502700000053,350022502700015007,350022502700000054,350022502700000055,350022502700015009,350022502700000057,350022502700015011,350022502700000062,350022502700000063,350022502700000064,350022502700000065,350022502700000065,350022502700015014,350022502700000066,350022502700000067,350022502700000068	0-135,3-139,5-95,0-96,0-186,0-51,0-96,0-51,5-50,0-45,0-45,0-45,6-51,0-141,3-93,0-45,0-45,0-45,4-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,5-140,2-138,20-45,0-45,0-45,0-45,0-90,5-51,0-225						Figures	www.bio-soft.net	0	0		
668	chrIII	10906370	10908655	3500077843	40		10906370	10908655	8421504	2	20,20	0,2265	c,g	350007784300000002,350007784300000002,350007784300000003,350007784300000003	0-20,0-20,0-20,0-20		22897658	10.1111/j.1365-2443.2012.01627.x	1365-2443	Genes to Cells	Neuronally expressed Ras-family GTPase Di-Ras modulates synaptic activity in Caenorhabditis elegans - Tada - 2012 - Genes to Cells - Wiley Online Library	Tada	2012	0		
668	chrIII	10907733	10908022	3500464746	42		10907733	10908022	8421504	2	20,22	0,267	c,g	350046474600000004,350046474600000004,350046474600000005,350046474600000005	0-20,0-20,0-22,0-22						生产 C。线虫 | JoVE Video	www.jove.com	0	0		
668	chrIII	10907733	10908022	3500433194	42		10907733	10908022	8421504	2	20,22	0,267	c,g	350043319400000006,350043319400000006,350043319400000007,350043319400000007	0-20,0-20,0-22,0-22						La producción de C. elegans Los transgenes a través de… (Translated to Spanish) | JoVE Video	www.jove.com	0	0		
668	chrIII	10907733	10908022	3500175055	42		10907733	10908022	8421504	2	20,22	0,267	c,g	350017505500000010,350017505500000010,350017505500000011,350017505500000011	0-20,0-20,0-22,0-22						 SpringerImages - Oligonucleotides used for PCR 	pringerimages.com	0	0		
668	chrIII	10908634	10915085	3500085518	182		10908634	10915085	8421504	8	25,23,22,20,31,20,21,20	0,896,2746,3603,3698,4742,6367,6431	c,g	350008551800000004,350008551800000006,350008551800000007,350008551800000005,350008551800000005,350008551800000008,350008551800000008,350008551800000000,350008551800000000,350008551800000002,350008551800000002,350008551800000003,350008551800000003	0-25,0-23,0-22,0-20,0-20,0-31,0-31,0-20,0-20,0-21,0-21,0-20,0-20						ScienceDirect.com - Developmental Biology - M142.2 (cut-6), a novel Caenorhabditis elegans matrix gene important for dauer body shape	sciencedirect.com	0	0		
668	chrIII	10925928	10967144	3500304073	42		10925928	10967144	8421504	3	9,14,19	0,14,41197	c,g	350030407300000382,350030407300000297	15-38,19-38						<Html><Title> Complet list of 2abm hssp file Complet list of	cnptia.embrapa.br	0	0		
668	chrIII	10953189	10953218	3500000902	24		10953189	10953218	8421504	2	17,7	0,22	g	350000090200000425	7-31						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
668	chrIII	10973818	10973842	3500026315	23		10973818	10973842	8421504	2	19,4	0,20	g	350002631500000174	22-45						Novel molecules of the card-related protein family and uses thereof - US Patent Application 20050049399 Description	ww.patentstorm.us	0	0		
668	chrIII	10976563	10976648	3500288532	85		10976563	10976648	8421504	1	85	0	g	350028853200000008	0-85						ScienceDirect.com - Genomics - A combined computational and experimental analysis of two families of snoRNA genes from Caenorhabditis elegans, revealing the expression and evolution pattern of snoRNAs in nematodes	sciencedirect.com	0	0		
668	chrIII	10979591	10979616	3500315721	24		10979591	10979616	8421504	2	9,15	0,10	c	350031572100000169	1-25						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
669	chrIII	11014824	11014850	3500035753	24		11014824	11014850	8421504	2	16,8	0,18	c	350003575300000350	1-25						<Html><Title> Complet list of 2qbq hssp file Complet list of	cnptia.embrapa.br	0	0		
669	chrIII	11014827	11014854	3500369079	24		11014827	11014854	8421504	2	12,12	0,15	c	350036907900000034	8-32						<Html><Title> Complet list of 1omo hssp file Complet list of	cnptia.embrapa.br	0	0		
669	chrIII	11063502	11063531	3500231920	24		11063502	11063531	8421504	2	14,10	0,19	g	350023192000000969	8-41						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
669	chrIII	11066748	11066820	3500059701	72		11066748	11066820	8421504	1	72	0	c	350005970100000000,350005970100000004	0-72,0-66						tRNAPro Promoterofaeukaryotic geneis composedofthree noncontiguous regions	www.pnas.org	0	0		
669	chrIII	11068505	11068550	3500102183	45		11068505	11068550	8421504	1	45	0	p	350010218300015001	3-48			10.1016/j.cell.2006.10.050		Cell	The RSA complex targets Protein Phosphatase 2A to centrosomes and regulates mitotic spindle assembly in C. elegans	Anne-Lore	2007	0		
669	chrIII	11068521	11068548	3500243691	25		11068521	11068548	8421504	2	20,5	0,22	c,g	350024369100002770,350024369100002770	8-37,8-37						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
669	chrIII	11068880	11068907	3500131108	23		11068880	11068907	8421504	2	16,7	0,20	g	350013110800001354	11-34						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
669	chrIII	11091447	11105107	3500314924	2610		11091447	11105107	8421504	14	271,557,208,213,169,122,277,157,19,265,158,103,72,19	0,1074,2331,2895,3271,4046,4452,4779,5939,6113,7089,7481,8333,13641	c,g	350031492400000088,350031492400000052,350031492400000052,350031492400000048,350031492400000048,350031492400000051,350031492400000047,350031492400000047,350031492400000054,350031492400000054,350031492400000059,350031492400000057,350031492400000057,350031492400000056,350031492400000049,350031492400000049,350031492400000055,350031492400000053,350031492400000053,350031492400000061	0-2571,0-21,0-21,0-20,0-20,0-20,0-19,0-19,0-20,0-20,0-19,0-20,0-20,0-20,0-19,0-19,1-21,10-32,10-32,0-19						DEPARTAMENTO DE GENÓMICA Y PROTEÓMICA	www.tdx.cat	0	0		
669	chrIII	11091447	11105107	3500158449	2609		11091447	11105107	8421504	14	271,557,208,213,169,122,277,157,19,264,158,103,72,19	0,1074,2331,2895,3271,4046,4452,4779,5939,6113,7089,7481,8333,13641	c,g	350015844900000088,350015844900000052,350015844900000052,350015844900000048,350015844900000048,350015844900000051,350015844900000051,350015844900000047,350015844900000047,350015844900000054,350015844900000054,350015844900000059,350015844900000057,350015844900000057,350015844900000056,350015844900000056,350015844900000049,350015844900000049,350015844900000055,350015844900000053,350015844900000053,350015844900000061	0-2571,0-21,0-21,0-20,0-20,0-20,0-20,0-19,0-19,0-20,0-20,0-19,0-20,0-20,0-20,0-20,0-19,0-19,0-21,10-32,10-32,0-19						DEPARTAMENTO DE GENÓMICA Y PROTEÓMICA	digital.csic.es	0	0		
669	chrIII	11092097	11092126	3500063777	25		11092097	11092126	8421504	2	14,11	0,18	g	350006377700000012	19-44						利用拟南芥air合成酶筛选除草剂化合物的方法	E*R*Wo De 	2001	0		
669	chrIII	11092673	11092745	3500001891	72		11092673	11092745	8421504	1	72	0	p	350000189100015073	0-72						Comparative gene expression studies of anthelmintic resistance in the parasitic nematode,	www.eblex.org.uk	0	0		
669	chrIII	11103855	11103883	3500305547	24		11103855	11103883	8421504	3	13,7,4	0,16,24	g	350030554700000117	19-49						Fungal variants and uses thereof	Milne	2006	0		
669	chrIII	11106016	11133065	3500174479	145		11106016	11133065	8421504	6	23,28,20,24,24,26	0,11119,26340,26426,26493,27023	c,g	350017447900000010,350017447900000002,350017447900000003,350017447900000005,350017447900000005,350017447900000006,350017447900000006,350017447900000004,350017447900000004	0-23,6-34,0-20,0-24,0-24,0-24,0-24,0-26,0-26		19521497	10.1371/journal.pgen.1000510	1553-7404	PLOS Genetics	PLOS Genetics: A Mechanistic Basis for the Coordinated Regulation of Pharyngeal Morphogenesis in Caenorhabditis elegans by LIN-35/Rb and UBC-18–ARI-1	Mani	2009	0		
669	chrIII	11117506	11117532	3500168684	23		11117506	11117532	8421504	2	16,7	0,19	c	350016868400000346	0-23						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
670	chrIII	11142941	11169871	3500167682	39		11142941	11169871	8421504	4	6,13,6,14	0,9,26909,26916	c,g	350016768200000370,350016768200000432	22-41,14-34						METHODS AND COMPOSITIONS FOR TARGETED POLYNUCLEOTIDE MODIFICATION - Patent application	www.faqs.org	0	0		
670	chrIII	11146038	11146083	3500155190	45		11146038	11146083	8421504	1	45	0	p	350015519000015018	0-45						Incorporation of modified nucleotides by archaeon dna polymerases and related methods	Buzby	2002	0		POLA1
670	chrIII	11146038	11146083	3500018804	45		11146038	11146083	8421504	1	45	0	p	350001880400015018	0-45						Incorporation Of Modified Nucleotides By Archaeon Dna Polymerases And Related Methods 	.freshpatents.com	0	0		POLA1
670	chrIII	11155076	11155102	3500421869	24		11155076	11155102	8421504	2	5,19	0,7	c	350042186900000077	12-37						 <HTML> <HEAD><TITLE>aooa*Y=aa(c)a3a1aa3/4a3ac"aaeoa1/4aaC/a1ae1ae3 - c1ea13i1/4i1/4	www.j-tokkyo.com	0	0		
670	chrIII	11175864	11183624	3500058991	48		11175864	11183624	8421504	3	24,14,10	0,7214,7750	c,g	350005899100000003,350005899100000003,350005899100000002	0-24,0-24,0-24						MPK-1 ERK Controls Membrane Organization in C. elegans Oogenesis via a Sex-Determination Module	enetics.wustl.edu	0	0		
670	chrIII	11177685	11206449	3500329235	42		11177685	11206449	8421504	3	6,15,21	0,11,28743	g	350032923500000354,350032923500002457	16-37,4-25						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
670	chrIII	11181012	11181084	3500244161	72		11181012	11181084	8421504	1	72	0	p	350024416100015014	0-72						Helene Touzet	www.lifl.fr	0	0		
670	chrIII	11181012	11181084	3500214246	72		11181012	11181084	8421504	1	72	0	p	350021424600015008,350021424600015035	15-87,0-54						Alignement multiple ClustalW	polytech.unice.fr	0	0		
670	chrIII	11184763	11184787	3500115985	24		11184763	11184787	8421504	1	24	0	g	350011598500000003	7-31		18305110	10.1074/jbc.M800342200		The Journal of Biological Chemistry	Disturbance of Nuclear and Cytoplasmic TAR DNA-binding Protein (TDP-43) Induces Disease-like Redistribution, Sequestration, and Aggregate Formation	Matthew	2008	0		
670	chrIII	11234524	11234552	3500465226	25		11234524	11234552	8421504	2	8,17	0,11	g	350046522600000223	8-33						US Patent # 7,273,746. Diacylglycerol acyltransferases for alteration of polyunsaturated fatty acids and oil content in oleaginous organisms - Patents.com	www.patents.com	0	0		
670	chrIII	11234524	11234552	3500450372	25		11234524	11234552	8421504	2	8,17	0,11	g	350045037200000000	11-36						The protective role of aquaporins in the freeze-tolerant insect Eurosta solidaginis: functional characterization and tissue abundance of EsAQP1. - ResearchGate	.researchgate.net	0	0		
670	chrIII	11234524	11234552	3500449696	25		11234524	11234552	8421504	2	8,17	0,11	g	350044969600000001	11-36						在线等，关于3‘RACE，求助高手！ - 生物科学 - 小木虫 - 学术 科研 第一站	emuch.net/html/20	0	0		
670	chrIII	11234524	11234552	3500430659	25		11234524	11234552	8421504	2	8,17	0,11	g	350043065900000000	11-36		17700636	10.1038/sj.hdy.6801035	0018-067X	Heredity	Studies of self-incompatibility in wild tomatoes: I. S-allele diversity in Solanum chilense Dun. (Solanaceae)	Igic	2007	5		
670	chrIII	11234524	11234552	3500430030	25		11234524	11234552	8421504	2	8,17	0,11	g	350043003000000000	11-36						关于RT-PCR中反转录酶的问题 - 生物科学 - 小木虫 - 学术 科研 第一站	emuch.net/html/20	0	0		
670	chrIII	11234524	11234552	3500420337	25		11234524	11234552	8421504	2	8,17	0,11	g	350042033700000002	11-36						Nematode PAN and ZP receptor-like sequences	Hresko	2005	0		
670	chrIII	11234524	11234552	3500408927	25		11234524	11234552	8421504	2	8,17	0,11	g	350040892700000006	11-36						Nematode Phosphoethanolamine N-Methyltransferase-Like Sequences - Patent application	www.faqs.org	0	0		
670	chrIII	11234524	11234552	3500395657	25		11234524	11234552	8421504	2	8,17	0,11	g	350039565700000000	11-36		21307072	10.1242/jeb.051276	0022-0949	The Journal of Experimental Biology	The protective role of aquaporins in the freeze-tolerant insect Eurosta solidaginis: functional characterization and tissue abundance of EsAQP1	Philip	2011	3		
670	chrIII	11234524	11234552	3500374380	25		11234524	11234552	8421504	2	8,17	0,11	g	350037438000000002	11-36						Patent Search: US Patent Number 7181884 - Materials and methods for controlling pests	ww.archpatent.com	0	0		
670	chrIII	11234524	11234552	3500364700	25		11234524	11234552	8421504	2	8,17	0,11	g	350036470000000015	11-36			10.1261/rna.209707		RNA	Human and mouse protein-noncoding snoRNA host genes with dissimilar nucleotide sequences show chromosomal synteny	Ritsuko	June	0		
670	chrIII	11234524	11234552	3500363235	25		11234524	11234552	8421504	2	8,17	0,11	g	350036323500000000	11-36						Heredity (2007) 99 2007 Nature Publishing Group All rights reserved 0018-067X/07 ORIGINAL ARTICLE Studies of self-incompatibility in wild tomatoes: I. S-allele diversity in Solanum chilense Dun. (Solanaceae)	.biology.ucsd.edu	0	0		
670	chrIII	11234524	11234552	3500342494	25		11234524	11234552	8421504	2	8,17	0,11	g	350034249400000006	11-36						Concurrent speciation in the eastern woodland salamanders (Genus Plethodon): DNA sequences of the complete albumin nuclear and partial mitochondrial 12s genes	e.oregonstate.edu	0	0		
670	chrIII	11234524	11234552	3500309265	25		11234524	11234552	8421504	2	8,17	0,11	g	350030926500000000	11-36		19042943	10.1093/molbev/msn274		Molecular Biology and Evolution	Molecular Evolution, Functional Variation, and Proposed Nomenclature of the Gene Family That Includes Sphingomyelinase D in Sicariid Spider Venoms	Greta	2009	0		
670	chrIII	11234524	11234552	3500285115	25		11234524	11234552	8421504	2	8,17	0,11	g	350028511500000006	11-36						ScienceDirect.com - Molecular Phylogenetics and Evolution - Concurrent speciation in the eastern woodland salamanders (Genus Plethodon): DNA sequences of the complete albumin nuclear and partial mitochondrial 12s genes	sciencedirect.com	0	0		
670	chrIII	11234524	11234552	3500261702	25		11234524	11234552	8421504	2	8,17	0,11	g	350026170200000020	11-36						Biosynthesis of Steroidal Glycoalkaloids in Solanum chacoense Bitter	cholar.lib.vt.edu	0	0		
670	chrIII	11234524	11234552	3500258078	25		11234524	11234552	8421504	2	8,17	0,11	g	350025807800000002	11-36						Nematode PAN and ZP Receptor-Like Sequences - Patent application	www.faqs.org	0	0		
670	chrIII	11234524	11234552	3500241341	25		11234524	11234552	8421504	2	8,17	0,11	g	350024134100000000	11-36						3'RACE and the polyA tail - Molecular Biology	otocol-online.org	0	0		
670	chrIII	11234524	11234552	3500229010	25		11234524	11234552	8421504	2	8,17	0,11	g	350022901000000006	11-36						IDT社合成オリゴの特長	cdn.idtdna.com	0	0		
670	chrIII	11234524	11234552	3500225571	25		11234524	11234552	8421504	2	8,17	0,11	g	350022557100000001	11-36		20030753	10.1111/j.1365-313X.2009.04111.x	1365-313X	The Plant Journal	Vacuolar sorting receptors (VSRs) and secretory carrier membrane proteins (SCAMPs) are essential for pollen tube growth - Wang - 2009 - The Plant Journal - Wiley Online Library	Wang	2010	0		
670	chrIII	11234524	11234552	3500184898	25		11234524	11234552	8421504	2	8,17	0,11	g	350018489800000000	11-36						δ-Tubulin is a component of intercellular bridges and both the early and mature perinuclear rings during spermatogenesis 10.1016/j.ydbio.2004.01.026 : Developmental Biology | ScienceDirect.com	sciencedirect.com	0	0		
670	chrIII	11234524	11234552	3500177261	25		11234524	11234552	8421504	2	8,17	0,11	g	350017726100000208	11-36						Diacylglycerol Acyltransferases For Alteration Of Polyunsaturated Fatty Acids And Oil Content In Oleaginous Organisms 	.freshpatents.com	0	0		
670	chrIII	11234524	11234552	3500172953	25		11234524	11234552	8421504	2	8,17	0,11	g	350017295300000000	11-36						ミミズ由来のプロテアーゼ （公開公報 2011177105）｜アスタミューゼ - astamuse	astamuse.com	0	0		
670	chrIII	11234524	11234552	3500156285	25		11234524	11234552	8421504	2	8,17	0,11	g	350015628500000000	11-36						【分享】一种高效获取基因5′末端的RACE方法 - 分子生物 - 小木虫 - 学术 科研 第	emuch.net/html/20	0	0		
670	chrIII	11234524	11234552	3500150282	25		11234524	11234552	8421504	2	8,17	0,11	g	350015028200000008	11-36						Identification and Characterization of TTR genes of bat and fish	kb.psu.ac.th	0	0		
670	chrIII	11234524	11234552	3500122730	25		11234524	11234552	8421504	2	8,17	0,11	g	350012273000000121,350012273000000153	11-36,11-36						<HTML><HEAD><meta http-equiv="Content-Type" content="text/html; charset=ISO-8859-1"><LINK REL="SHORT	.economie.fgov.be	0	0		
670	chrIII	11234524	11234552	3500080463	25		11234524	11234552	8421504	2	8,17	0,11	g	350008046300000002	11-36						Diacylglycerol acyltransferases from flax - Patent application	www.faqs.org	0	0		
670	chrIII	11234524	11234552	3500014935	25		11234524	11234552	8421504	2	8,17	0,11	g	350001493500000000	11-36						3'RACE and the polyA tail - Molecular Biology - BioForum	otocol-online.org	0	0		
670	chrIII	11234524	11234552	3500008357	25		11234524	11234552	8421504	2	8,17	0,11	g	350000835700000011	11-36						Tumor suppressor molecules and methods of use	Welch	1999	0		
670	chrIII	11234524	11234552	3500005526	25		11234524	11234552	8421504	2	8,17	0,11	g	350000552600000050	6-31						US Patent # 7,198,937. Mortierella alpina diacylglycerol acyltransferase for alteration of polyunsaturated fatty acids and oil content in oleaginous organisms - Patents.com	www.patents.com	0	0		
670	chrIII	11234525	11234552	3500457026	24		11234525	11234552	8421504	2	7,17	0,10	g	350045702600000022	11-35						pour le DOCTORAT DE L'UNIVERSITÉ DE BORDEAUX 1	mm.u-bordeaux1.fr	0	0		
670	chrIII	11237051	11237985	3500131072	822		11237051	11237985	8421504	3	153,395,274	0,214,660	p	350013107200015099,350013107200015089	0-819,0-822						AMPK PATHWAY COMPONENTS - ELIXIR PHARMACEUTICALS, INC.	www.sumobrain.com	0	0		
670	chrIII	11237051	11237985	3500064585	804		11237051	11237985	8421504	6	153,33,36,129,179,274	0,214,253,295,430,660	p	350006458500015073	0-813						Ampk pathway components	Apfeld	2004	0		
670	chrIII	11248516	11248748	3500249133	100		11248516	11248748	8421504	2	50,50	0,182	c,g	350024913300000012,350024913300000012,350024913300000013,350024913300000013	0-50,0-50,0-50,0-50							roarrays.ucsd.edu	0	0		
670	chrIII	11261037	11261063	3500178220	23		11261037	11261063	8421504	2	7,16	0,10	g	350017822000002216	20-44						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
670	chrIII	11268455	11268480	3500380836	23		11268455	11268480	8421504	3	14,5,4	0,15,21	g	350038083600000161	25-48						US Patent # 7,186,541. 3-hydroxypropionic acid and other organic compounds - Patents.com	www.patents.com	0	0		
670	chrIII	11268455	11268480	3500370305	23		11268455	11268480	8421504	3	14,5,4	0,15,21	g	350037030500000154	25-48						 3 	www.docstoc.com	0	0		
670	chrIII	11268455	11268480	3500166501	23		11268455	11268480	8421504	3	14,5,4	0,15,21	g	350016650100000161	25-48						3-hydroxypropionic acid and other organic compounds - US Patent 7186541 Description	ww.patentstorm.us	0	0		
670	chrIII	11268455	11268480	3500104401	23		11268455	11268480	8421504	3	14,5,4	0,15,21	g	350010440100000161	25-48						3-HYDROXYPROPIONIC ACID AND OTHER ORGANIC COMPOUNDS - Patent application	www.faqs.org	0	0		
671	chrIII	11279657	11286019	3500461794	1680		11279657	11286019	8421504	10	138,126,114,242,88,203,64,170,402,133	0,699,1062,2055,3139,3666,4491,4612,5777,6229	p	350046179400015064,350046179400015053,350046179400015040,350046179400015028,350046179400015017	0-207,0-405,57-420,0-405,0-300						galactosaminyl-transferase with an unusual lectin domain from the platyhelminth parasite Echinococcus granulosus	www.biochemj.org	0	0		
671	chrIII	11280819	11281722	3500300591	23		11280819	11281722	8421504	2	14,9	0,894	c	350030059100000155	25-48						Novel Plant Acyltransferases Specific For Long-Chained, Multiply Unsaturated Fatty Acids - Patent application	www.faqs.org	0	0		
671	chrIII	11311447	11317471	3500357169	206		11311447	11317471	8421504	7	22,22,60,33,27,20,22	0,1150,2214,5231,5364,5479,6002	p,c,g	350035716900000010,350035716900000004,350035716900000004,350035716900015003,350035716900015002,350035716900000003,350035716900000003,350035716900000009,350035716900000009,350035716900000005	0-22,0-22,0-22,3-63,3-63,0-20,0-20,0-19,0-19,0-22		22275078	10.1002/dvdy.23735	1097-0177	Developmental Dynamics	TEG-1 CD2BP2 regulates stem cell proliferation and sex determination in the C. elegans germ line and physically interacts with the UAF-1 U2AF65 splicing factor - Wang - 2012 - Developmental Dynamics - Wiley Online Library	Wang	2012	0		
671	chrIII	11320053	11336492	3500366806	38		11320053	11336492	8421504	4	13,6,7,12	0,16,16415,16427	g	350036680600002125,350036680600002054	0-19,5-24						<HTML> <TITLE>BLAST Search Results  BLAST Search Results  BLAST Search Results  BLAST Search Results  BLAST Search Results  Complet list of 3exb hssp file Complet list of	cnptia.embrapa.br	0	0		
671	chrIII	11340906	11341407	3500386009	40		11340906	11341407	8421504	2	20,20	0,481	c,g	350038600900000008,350038600900000008,350038600900000009	0-20,0-20,0-20						Supplemental Data Condensins Regulate Meiotic DNA Break Distribution, thus Crossover Frequency, by Controlling Chromosome Structure	mcb.berkeley.edu	0	0		
671	chrIII	11372516	11380902	3500349026	117		11372516	11380902	8421504	5	20,29,22,25,21	0,279,574,5341,8365	c,g	350034902600000001,350034902600000003,350034902600000000,350034902600000006,350034902600000004	0-20,9-38,0-22,5-30,9-30		21795395	10.1091/mbc.E10-10-0853	1059-1524	Molecular Biology of the Cell	Genetic interaction between Caenorhabditis elegans teneurin ten-1 and prolyl 4-hydroxylase phy-1 and their function in collagen IV–mediated basement membrane integrity during late elongation of the embryo	Topf	2011	5		
671	chrIII	11372928	11372951	3500036891	23		11372928	11372951	8421504	1	23	0	g	350003689100000004	8-31		12417582	10.1074/jbc.M210381200	0021-9258	Journal of Biological Chemistry	A Hypodermally Expressed Prolyl 4-Hydroxylase from the Filarial Nematode Brugia malayi Is Soluble and Active in the Absence of Protein Disulfide Isomerase	Winter	2003	5		
671	chrIII	11374178	11377750	3500427498	84		11374178	11377750	8421504	4	21,21,21,21	0,335,3522,3551	c,g	350042749800000009,350042749800000009,350042749800000001,350042749800000001,350042749800000011,350042749800000011,350042749800000003,350042749800000003,350042749800000002,350042749800000002,350042749800000010,350042749800000010,350042749800000008,350042749800000008,350042749800000000,350042749800000000	0-21,0-21,0-21,0-21,0-21,0-21,0-21,0-21,0-21,0-21,0-21,0-21,0-21,0-21,0-21,0-21						Assays for modulators of prolyl-4-hydroxylase	Kimble	2000	0		
671	chrIII	11388632	11388677	3500197656	45		11388632	11388677	8421504	1	45	0	p	350019765600015136	0-45						Karakterisatie van neuromedine U-, tachykinine- en GnRH-verwante receptoren	w.scriptiebank.be	0	0		
672	chrIII	11428263	11443328	3500298215	3474		11428263	11443328	8421504	17	169,67,361,159,228,397,529,194,236,424,122,22,310,133,79,22,22	0,179,301,8588,8793,9080,9786,10360,11077,11657,12117,12301,13010,13578,14123,14872,15043	c,g	350029821500000088,350029821500000116,350029821500000009,350029821500000087,350029821500000019,350029821500000019,350029821500000126,350029821500000126,350029821500000014,350029821500000014,350029821500000121,350029821500000121,350029821500000050,350029821500000140,350029821500000148,350029821500000018,350029821500000018,350029821500000125,350029821500000125,350029821500000051,350029821500000051,350029821500000141,350029821500000141,350029821500000020,350029821500000020,350029821500000127,350029821500000127,350029821500000013,350029821500000013,350029821500000120,350029821500000120,350029821500000021,350029821500000021,350029821500000128,350029821500000128,350029821500000122,350029821500000122,350029821500000015,350029821500000015,350029821500000174,350029821500000174,350029821500000006,350029821500000006,350029821500000137,350029821500000137,350029821500000033,350029821500000033,350029821500000017,350029821500000017,350029821500000124,350029821500000124,350029821500000016,350029821500000016,350029821500000123,350029821500000123,350029821500000012,350029821500000119,350029821500000139,350029821500000139,350029821500000045,350029821500000045,350029821500000022,350029821500000022,350029821500000129,350029821500000129,350029821500000136,350029821500000118,350029821500000118,350029821500000011,350029821500000011,350029821500000113,350029821500000113,350029821500000004,350029821500000004,350029821500000023,350029821500000023,350029821500000130,350029821500000130,350029821500000135,350029821500000135,350029821500000031,350029821500000031,350029821500000117,350029821500000117,350029821500000010,350029821500000010,350029821500000061,350029821500000061,350029821500000151,350029821500000151,350029821500000150,350029821500000150,350029821500000060,350029821500000060,350029821500000132,350029821500000132,350029821500000025,350029821500000025,350029821500000134,350029821500000030,350029821500000053,350029821500000143,350029821500000115,350029821500000115,350029821500000008,350029821500000008,350029821500000054,350029821500000054,350029821500000144,350029821500000144,350029821500000055,350029821500000145,350029821500000131,350029821500000131,350029821500000024,350029821500000024,350029821500000133,350029821500000133,350029821500000026,350029821500000026,350029821500000044,350029821500000044,350029821500000138,350029821500000138,350029821500000147,350029821500000057,350029821500000056,350029821500000146	0-169,0-25,0-25,23-3240,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-22,0-22,0-21,0-20,0-20,0-20,0-20,0-22,0-22,0-22,0-22,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-23,0-23,0-23,0-23,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20,11-38,11-38,11-38,11-38,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-22,0-22,0-22,0-22,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-21,0-21,0-21,0-21,0-22,0-22,0-22,0-22,0-20,0-20,0-20,0-20,0-20,0-20,0-22,0-22,0-22,0-22,0-22,0-22,0-22,0-22,0-22,0-22,0-22,0-22,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20,9-37,9-37,9-37,9-37,0-22,0-22,0-22,0-22						Animal models and methods for analysis of lipid metabolism and screening of pharmaceutical and pesticidal agents that modulate lipid metabolism	Costa	1999	0		
672	chrIII	11428320	11442465	3500276765	3339		11428320	11442465	8421504	13	189,361,154,228,397,529,194,236,420,109,310,133,79	0,244,8536,8736,9023,9729,10303,11020,11600,12073,12953,13521,14066	c,g	350027676500000160,350027676500000159,350027676500000159,350027676500000158,350027676500000158,350027676500000157,350027676500000157,350027676500000156,350027676500000155,350027676500000155,350027676500000154,350027676500000154,350027676500000153,350027676500000153,350027676500000152,350027676500000152,350027676500000151,350027676500000151,350027676500000150,350027676500000150,350027676500000149,350027676500000148,350027676500000148,350027676500000147,350027676500000147,350027676500000146,350027676500000146,350027676500000145,350027676500000144,350027676500000144,350027676500000143,350027676500000142,350027676500000142,350027676500000141,350027676500000140,350027676500000139,350027676500000139,350027676500000138,350027676500000137,350027676500000136,350027676500000136,350027676500000135,350027676500000135,350027676500000134,350027676500000134,350027676500000133,350027676500000132,350027676500000131,350027676500000131,350027676500000130,350027676500000130,350027676500000129,350027676500000128,350027676500000128,350027676500000127,350027676500000127,350027676500000126,350027676500000125,350027676500000125,350027676500000124,350027676500000124,350027676500000123,350027676500000123,350027676500000122,350027676500000121,350027676500000120,350027676500000120,350027676500000119,350027676500000118,350027676500000118,350027676500000117,350027676500000116,350027676500000115,350027676500000114,350027676500000113,350027676500000113,350027676500000112,350027676500000111,350027676500000110,350027676500000109,350027676500000108,350027676500000107,350027676500000106,350027676500000105,350027676500000104,350027676500000103,350027676500000103,350027676500000102,350027676500000102,350027676500000101,350027676500000100,350027676500000099,350027676500000099,350027676500000098,350027676500000097,350027676500000097,350027676500000096,350027676500000095,350027676500000094,350027676500000094,350027676500000093,350027676500000093,350027676500000092,350027676500000091,350027676500000091	0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-45,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48						Products and Methods Related to Mono-Methyl Branched-Chain Fatty Acids - Patent application	www.faqs.org	0	0		
672	chrIII	11428675	11428759	3500249133	84		11428675	11428759	8421504	1	84	0	c,g	350024913300000027,350024913300000027,350024913300000014,350024913300000014	0-50,0-50,0-50,0-50							roarrays.ucsd.edu	0	0		
672	chrIII	11439974	11439999	3500008137	25		11439974	11439999	8421504	1	25	0	c	350000813700000269,350000813700000062	12-37,3-28						US Patent # 6,495,740. Manipulation of cellulose and/or .beta.-1,4-Glucan - Patents.com	www.patents.com	0	0		
672	chrIII	11439994	11440293	3500032749	43		11439994	11440293	8421504	2	22,21	0,278	c,g	350003274900000008,350003274900000008,350003274900000007,350003274900000007	0-22,0-22,0-21,0-21						<?xml version="1.0" encoding="UTF-8"?> <!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD 	www.mdpi.com	0	0		
672	chrIII	11472498	11472537	3500354007	34		11472498	11472537	8421504	2	20,14	0,25	c	350035400700000007	0-34						Hidden Markov Models	w.bioinfo.rpi.edu	0	0		
672	chrIII	11472498	11472537	3500051132	34		11472498	11472537	8421504	2	20,14	0,25	c	350005113200000025	0-34						Bioinformatics 1 -- lecture 18 signatures motifs footprints	w.bioinfo.rpi.edu	0	0		
672	chrIII	11477618	11477862	3500135521	40		11477618	11477862	8421504	2	20,20	0,224	c,g	350013552100000002,350013552100000003,350013552100000003	0-20,0-20,0-20		17409084	10.1534/genetics.106.067223	0016-6731	Genetics	Temporal Dynamics and Linkage Disequilibrium in Natural Caenorhabditis elegans Populations	Barriere	2007	4		
673	chrIII	11557043	11557068	3500245053	25		11557043	11557068	8421504	1	25	0	g	350024505300002711	18-43						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
673	chrIII	11558715	11569937	3500329235	40		11558715	11569937	8421504	3	20,14,6	0,11197,11216	g	350032923500001051,350032923500000700	0-20,6-27						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
673	chrIII	11574889	11574916	3500241381	24		11574889	11574916	8421504	2	17,7	0,20	g	350024138100000393	9-33						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
673	chrIII	11581266	11581297	3500134619	26		11581266	11581297	8421504	3	6,6,14	0,7,17	c,g	350013461900000504,350013461900000504	9-36,9-36						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
673	chrIII	11591749	11591775	3500340026	24		11591749	11591775	8421504	3	6,13,5	0,7,21	c	350034002600000027	9-33						Flea serine protease inhibitor proteins	Silver	1996	0		
673	chrIII	11591749	11591775	3500194063	24		11591749	11591775	8421504	3	6,13,5	0,7,21	c	350019406300000027	9-33						 Flea Serine Protease Inhibitor Proteins 	www.docstoc.com	0	0		
673	chrIII	11616658	11616934	3500309883	276		11616658	11616934	8421504	1	276	0	p	350030988300015151	0-276						THAP1, UN REGULATEUR CLE DE LA PROLIFERATION DES CELLULES ENDOTHELIALES : RELATIONS STRUCTURE/FONCTION ET GENES CIBLES	esups.ups-tlse.fr	0	0		
673	chrIII	11625181	11628098	3500461794	885		11625181	11628098	8421504	10	68,79,104,7,44,159,118,90,60,156	0,354,488,1114,1534,1624,1830,2563,2656,2761	p	350046179400015016,350046179400015026,350046179400015039,350046179400015052	0-186,0-72,0-411,0-216						galactosaminyl-transferase with an unusual lectin domain from the platyhelminth parasite Echinococcus granulosus	www.biochemj.org	0	0		
84	chrIII	11657666	11691219	3500381965	40		11657666	11691219	8421504	2	20,20	0,33533	c,g	350038196500000000,350038196500000000,350038196500000001	0-20,0-20,0-20						Insulin Signaling and Dietary Restriction Differentially Influence the Decline of Learning and Memory with Age	io1.princeton.edu	0	0		
674	chrIII	11718415	11718442	3500271198	24		11718415	11718442	8421504	2	11,13	0,14	g	350027119800004497	18-42						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
674	chrIII	11722598	11722627	3500313646	24		11722598	11722627	8421504	3	5,6,13	0,7,16	c,g	350031364600000080,350031364600000080	14-39,14-39						Novel filariid nematode cysteine protease proteins, nucleic acid molecules and uses thereof	Frank	1996	0		
674	chrIII	11722598	11722627	3500265438	24		11722598	11722627	8421504	3	5,6,13	0,7,16	g	350026543800000080	14-39						Novel filariid nematode cysteine protease proteins, nucleic acid molecules and uses thereof	Frank	1998	0		
674	chrIII	11733431	11733454	3500177899	23		11733431	11733454	8421504	1	23	0	g	350017789900000308	3-26						<Html><Title> Complet list of 3f55 hssp file Complet list of	cnptia.embrapa.br	0	0		
674	chrIII	11752872	11752900	3500325148	24		11752872	11752900	8421504	3	5,14,5	0,8,23	c	350032514800000071	16-42						Development and use of microsatellites markers for genetic variation analysis, in the Namibian germplasm, both within and between populations of marama bean Tylosema esculentum	demicjournals.org	0	0		
674	chrIII	11755068	11755091	3500458304	23		11755068	11755091	8421504	1	23	0	g	350045830400000001	5-28							link.springer.com	0	0		
675	chrIII	11809419	11809447	3500059928	23		11809419	11809447	8421504	2	10,13	0,15	c	350005992800000034	18-42						US Patent # 7,078,589. Isolated nematode regulated gene promoter and use thereof - Patents.com	www.patents.com	0	0		
675	chrIII	11834234	11834258	3500338665	23		11834234	11834258	8421504	2	10,13	0,11	g	350033866500000001	1-24		17261848	10.1083/jcb.200605199	0021-9525	The Journal of Cell Biology	A centriole- and RanGTP-independent spindle assembly pathway in meiosis I of vertebrate oocytes	Dumont	2007	10		
675	chrIII	11847855	11847888	3500304082	25		11847855	11847888	8421504	3	11,7,7	0,14,26	g	350030408200000002	20-45						新規核酸プローブ並びにそれを用いる核酸測定方法、及びその方法によ	www.patentjp.com	0	0		
675	chrIII	11853449	11856745	3500298215	80		11853449	11856745	8421504	5	20,20,20,19,1	0,403,1851,2271,3295	c,g	350029821500000043,350029821500000043,350029821500000103,350029821500000103,350029821500000042,350029821500000042,350029821500000102,350029821500000102,350029821500000041,350029821500000041,350029821500000101,350029821500000101,350029821500000040,350029821500000100	0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20,0-20						Animal models and methods for analysis of lipid metabolism and screening of pharmaceutical and pesticidal agents that modulate lipid metabolism	Costa	1999	0		
675	chrIII	11859399	11859427	3500215254	25		11859399	11859427	8421504	2	13,12	0,16	g	350021525400000020	0-31						Dual RpoH Sigma Factors and Transcriptional Plasticity in a Symbiotic Bacterium	jb.asm.org/conten	0	0		
675	chrIII	11874344	11874375	3500235165	31		11874344	11874375	8421504	1	31	0	c	350023516500000063	5-36						Estudio de factores implicados en la regulación de la expresión del elemento LINE- Trypanosoma cruzi y del mecanismo de su retrotransposición de novo	hera.ugr.es	0	0		
675	chrIII	11915232	11915258	3500135228	23		11915232	11915258	8421504	2	7,16	0,10	c	350013522800000043	5-40						 <HTML> <HEAD><TITLE>aa(c)a$?aa1/4a1/4ae'>>aeSSaaeaaec+-aeSSeuc' - c1ei1/4i1/4i1/4i1/4i1/4i1/4	www.j-tokkyo.com	0	0		
675	chrIII	11915684	11917901	3500122780	40		11915684	11917901	8421504	2	20,20	0,2197	c,g	350012278000000000,350012278000000001,350012278000000001	0-20,0-20,0-20		20053678	10.1091/mbc.E09-09-0787	1059-1524	Molecular Biology of the Cell	NPP-16/Nup50 Function and CDK-1 Inactivation Are Associated with Anoxia-induced Prophase Arrest in Caenorhabditis elegans	Hajeri	2010	5		
675	chrIII	11919505	11922276	3500267267	64		11919505	11922276	8421504	3	21,22,21	0,539,2750	c,g	350026726700000002,350026726700000002,350026726700000005,350026726700000005,350026726700000004	18-39,18-39,0-22,0-22,0-21						ScienceDirect.com - Gene - C. elegans homologue of the Caf1 gene, which encodes a subunit of the CCR4-NOT complex, is essential for embryonic and larval development and for meiotic progression	sciencedirect.com	0	0		
84	chrIII	11924918	11928863	3500460626	306		11924918	11928863	8421504	6	48,9,39,60,136,14	0,579,1734,1836,3732,3931	p	350046062600015001,350046062600015027,350046062600015037,350046062600015058	0-48,6-54,0-60,0-150						Support for a 3D structure predicting a Cys-Glu-Lys catalytic triad for Pseudomonas aeruginosa amidase comes from site-dire	www.biochemj.org	0	0		
675	chrIII	11925221	11925246	3500273036	24		11925221	11925246	8421504	2	8,16	0,9	c	350027303600000010	2-26						Molecular characterization of pea (Pisum sativum L	iosrjournals.org	0	0		
675	chrIII	11925221	11925246	3500270678	24		11925221	11925246	8421504	2	8,16	0,9	c	350027067800000010	2-26						Molecular characterization of pea (Pisum sativum L.) using microsatellite markers	www.docstoc.com	0	0		
84	chrIII	11925434	11951702	3500343811	41		11925434	11951702	8421504	4	6,14,12,9	0,10,26246,26259	c,g	350034381100003283,350034381100003283,350034381100000230	14-34,14-34,9-31						1531 26.93 2.31 1.16 sequence_4 1 432 (149568) + Gypsy12-ZM_I LTR/Gypsy 	nomics.purdue.edu	0	0		
676	chrIII	11936556	11936621	3500195762	65		11936556	11936621	8421504	1	65	0	c,g	350019576200000009,350019576200000009	0-65,0-65						Statistical Inference for Well-ordered Structures in Nucleotide Sequences	nces.computer.org	0	0		
676	chrIII	11936595	11936619	3500063739	24		11936595	11936619	8421504	1	24	0	c	350006373900000014	0-24						Invertebrate Micrornas 	.freshpatents.com	0	0		
676	chrIII	11936595	11936619	3500021845	24		11936595	11936619	8421504	1	24	0	c	350002184500000022	0-24						INVERTEBRATE MICRORNAS	Allen	2013	0		
676	chrIII	11936596	11936619	3500415450	23		11936596	11936619	8421504	1	23	0	c	350041545000000014	0-23					Patent	Invertebrate microRNAs (Patent US:8410334)	Allen	2013	0		
676	chrIII	11936596	11936619	3500043993	23		11936596	11936619	8421504	1	23	0	c	350004399300000014,350004399300000087	0-23,0-23						Invertebrate MicroRNAs - Patent application	www.faqs.org	0	0		
676	chrIII	11949922	11960066	3500157872	50		11949922	11960066	8421504	2	27,23	0,10121	c,g	350015787200000003,350015787200000002,350015787200000002	0-27,0-23,0-23		15143192	10.1128/MCB.24.11.5016-5027.2004	0270-7306	Molecular and Cellular Biology	Multiple Genetic Pathways Involving the Caenorhabditis elegans Bloom's Syndrome Genes him-6, rad-51, and top-3 Are Needed To Maintain Genome Stability in the Germ Line	Wicky	2004	6		
676	chrIII	11959992	11960018	3500197929	23		11959992	11960018	8421504	2	5,18	0,8	c	350019792900002345	0-23						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
676	chrIII	11963424	11963447	3500248703	23		11963424	11963447	8421504	1	23	0	g	350024870300000433	25-48						PR-domain containing nucleic acids, polypeptides, antibodies and methods	Huang	1999	0		
676	chrIII	11993961	11993984	3500126089	23		11993961	11993984	8421504	1	23	0	c	350012608900000002	9-32		22223640	10.1074/jbc.M111.316075	0021-9258	Journal of Biological Chemistry	Structural Insights into Apoptotic DNA Degradation by CED-3 Protease Suppressor-6 (CPS-6) from Caenorhabditis elegans	Lin	2012	5		
676	chrIII	11999396	11999427	3500386136	27		11999396	11999427	8421504	2	9,18	0,13	c	350038613600000333	9-36						<Html><Title> Complet list of 1b0k hssp file Complet list of	cnptia.embrapa.br	0	0		
676	chrIII	11999396	11999421	3500301737	25		11999396	11999421	8421504	1	25	0	c	350030173700000197	4-29						<Html><Title> Complet list of 3ihg hssp file Complet list of	cnptia.embrapa.br	0	0		
676	chrIII	11999399	11999427	3500035753	24		11999399	11999427	8421504	2	6,18	0,10	c	350003575300000198	1-25						<Html><Title> Complet list of 2qbq hssp file Complet list of	cnptia.embrapa.br	0	0		
676	chrIII	11999399	11999427	3500031510	24		11999399	11999427	8421504	2	6,18	0,10	c	350003151000000382	1-25						<Html><Title> Complet list of 3iha hssp file Complet list of	cnptia.embrapa.br	0	0		
676	chrIII	11999399	11999426	3500313292	23		11999399	11999426	8421504	2	6,17	0,10	c	350031329200000141	0-23						<Html><Title> Complet list of 3bax hssp file Complet list of	cnptia.embrapa.br	0	0		
676	chrIII	11999400	11999427	3500186062	25		11999400	11999427	8421504	2	18,7	0,20	c	350018606200000324	9-34						<Html><Title> Complet list of 1a2f hssp file Complet list of	cnptia.embrapa.br	0	0		
677	chrIII	12061768	12061795	3500395481	23		12061768	12061795	8421504	2	14,9	0,18	c	350039548100000058	8-31						Apparatus and method for detecting and identifying infectious agents - Patent # 6649356 - PatentGenius	.patentgenius.com	0	0		
677	chrIII	12077384	12089542	3500381993	47		12077384	12089542	8421504	2	19,28	0,12130	g	350038199300000001,350038199300000000	0-19,0-28						20090605_nob-1_b26_L2	gs.washington.edu	0	0		
677	chrIII	12077384	12089542	3500098224	47		12077384	12089542	8421504	2	19,28	0,12130	g	350009822400000001,350009822400000000	0-19,0-28						20090605_nob-1_b26_L1	gs.washington.edu	0	0		
677	chrIII	12080396	12080422	3500413794	24		12080396	12080422	8421504	2	7,17	0,9	g	350041379400000014	2-27						Team:WashU/Notebook/Biobricks - 2010.igem.org	2010.igem.org	0	0		
677	chrIII	12094337	12111783	3500360966	41		12094337	12111783	8421504	4	5,14,17,5	0,8,17422,17441	g	350036096600001430,350036096600000798	17-36,16-38						<HTML> <TITLE>BLAST Search Results AU031386 - AU031386 Rice cDNA from immature leaf including ap gccaacaagccgactcgcgatcnccatcgggcaagaa	e.cc.umanitoba.ca	0	0		
679	chrIII	12367647	12367674	3500438589	27		12367647	12367674	8421504	1	27	0	c	350043858900000025	0-27						caves in south-central and southwestern USA. Journal of Cave and Karst Studies, A NEW GENUS OF THE SUBFAMILY CUBACUBANINAE (INSECTA: ZYGENTOMA: NICOLETIIDAE) FROM CAVES IN SOUTH-CENTRAL AND SOUTHWESTERN USA	www.caves.org	0	0		
679	chrIII	12368030	12368055	3500335071	25		12368030	12368055	8421504	1	25	0	c	350033507100000005	0-25						Maternal Epigenetic Pathways Control Parental Contributions to Arabidopsis Early Embryogenesis	hal.cirad.fr	0	0		
679	chrIII	12375870	12375933	3500439432	63		12375870	12375933	8421504	1	63	0	p	350043943200015014,350043943200015015,350043943200015016,350043943200015017	0-63,0-63,0-63,0-63						Caracterización de fosfatasas de proteínas 2 A en Solanum tuberosum L. y su participación en vías de señalización asociadas a tuberización y estrés	al.bl.fcen.uba.ar	0	0		
679	chrIII	12375870	12375933	3500075162	63		12375870	12375933	8421504	1	63	0	p	350007516200015015,350007516200015019	0-60,0-63						Protein phosphatase stress-related polypeptides and methods of use in plants	Bohnert	2005	0		
679	chrIII	12375870	12375933	3500073367	63		12375870	12375933	8421504	1	63	0	p	350007336700015019,350007336700015015	0-63,0-60						Protein phosphatase stress-related polypeptides and methods of use in plants	Bohnert	2004	0		
679	chrIII	12379641	12379794	3500395114	40		12379641	12379794	8421504	2	20,20	0,133	c,g	350039511400000035,350039511400000035,350039511400000034,350039511400000034	0-20,0-20,0-20,0-20		23103171	10.1016/j.celrep.2012.09.019	2211-1247	Cell Reports	Cell Reports - Antagonism between MES-4 and Polycomb Repressive Complex 2 Promotes Appropriate Gene Expression in C. elegans Germ Cells	Gaydos	2012	0		
679	chrIII	12379641	12379794	3500150118	40		12379641	12379794	8421504	2	20,20	0,133	c,g	350015011800000035,350015011800000035,350015011800000034,350015011800000034	0-20,0-20,0-20,0-20		23103171	10.1016/j.celrep.2012.09.019	2211-1247	Cell Reports	Cell Reports - Antagonism between MES-4 and Polycomb Repressive Complex 2 Promotes Appropriate Gene Expression in C. elegans Germ Cells	Gaydos	2012	0		
679	chrIII	12399264	12415658	3500197871	536		12399264	12415658	8421504	13	95,4,78,31,71,78,15,33,20,20,30,30,31	0,680,693,774,5419,6418,8062,8286,14386,14544,15575,16198,16363	p,c,g	350019787100015147,350019787100015142,350019787100015131,350019787100015130,350019787100015120,350019787100000001,350019787100000003,350019787100000003,350019787100015040,350019787100000002,350019787100000002,350019787100000000,350019787100000000	0-99,0-120,21-81,0-78,12-60,0-20,0-20,0-20,0-60,0-20,0-20,0-20,0-20						Supporting Online Material for	ww.sciencemag.org	0	0		
679	chrIII	12399264	12415658	3500114832	536		12399264	12415658	8421504	13	95,4,78,31,71,78,15,33,20,20,30,30,31	0,680,693,774,5419,6418,8062,8286,14386,14544,15575,16198,16363	p,c,g	350011483200015147,350011483200015142,350011483200015131,350011483200015130,350011483200015120,350011483200000001,350011483200000003,350011483200000003,350011483200015040,350011483200000002,350011483200000002,350011483200000000,350011483200000000	0-99,0-120,21-81,0-78,12-60,0-20,0-20,0-20,0-60,0-20,0-20,0-20,0-20						Role of C. elegans TAT-1 Protein in Maintaining Plasma Membrane Phosphatidylserine Asymmetry Monica Darland-Ransom, www.sciencemag.org (this information is current as of April 24, 2008 )	mcdb.colorado.edu	0	0		
679	chrIII	12407256	12407281	3500179812	23		12407256	12407281	8421504	2	5,18	0,7	g	350017981200000257	0-23						水稻常用SSR分子标记_稻田统计爱好者_新浪博客	blog.sina.com.cn	0	0		
679	chrIII	12407256	12407281	3500017185	23		12407256	12407281	8421504	2	5,18	0,7	g	350001718500000204	0-23							cropwiki.irri.org	0	0		
679	chrIII	12409832	12409860	3500338603	23		12409832	12409860	8421504	3	4,6,13	0,5,15	c	350033860300000034	18-42						特開2009-284832号 耐熱性菌類の検出方法 | アスタミューゼ	astamuse.com	0	0		
679	chrIII	12409832	12409860	3500258652	23		12409832	12409860	8421504	3	4,6,13	0,5,15	c	350025865200000034	18-42						  ec+-aeSSee!a(r)ae$?aoae1ae3 AM398681; Flavobacterium psychrophilum JIP02/86 complete genome CTTTGTGTTCTTTGTGGTTAAAATACAATCGATAT	gale.jouy.inra.fr	0	0		
682	chrIII	12739989	12740012	3500366782	23		12739989	12740012	8421504	1	23	0	c	350036678200000127	0-23						US Patent # 7,446,239. SCA2 knockout animal and methods of use - Patents.com	www.patents.com	0	0		
682	chrIII	12739992	12740015	3500433612	23		12739992	12740015	8421504	1	23	0	c	350043361200000215	21-44						US Patent # 7,132,399. Mammalian cell surface DNA receptor - Patents.com	www.patents.com	0	0		
682	chrIII	12753499	12753523	3500301737	24		12753499	12753523	8421504	1	24	0	c	350030173700000065,350030173700000198	0-19,0-21						 Complet list of 3ihg hssp file Complet list of	cnptia.embrapa.br	0	0		
682	chrIII	12760605	12760634	3500142668	28		12760605	12760634	8421504	2	5,23	0,6	c	350014266800000003	5-33						Molecular Ecology	w3.ualg.pt/~rcast	0	0		
85	chrIII	12785987	13073514	3500381779	32		12785987	13073514	8421504	4	2,3,11,16	0,64,287498,287511	c	350038177900000205	0-32						X1 ATACACACACACAC X2 GAAAAAAAAAAAAAAA X3 TATATATATATGT X4 AAAAAAAAAAAAAAAAAAAAAAAAAAAA X5 CTATCTATCT	www.ucl.ac.uk	0	0		
85	chrIII	12785987	13073514	3500373146	32		12785987	13073514	8421504	4	2,3,11,16	0,64,287498,287511	c	350037314600000205	0-32						X1 ATACACACACACAC X2 GAAAAAAAAAAAAAAA X3 TATATATATATGT X4 AAAAAAAAAAAAAAAAAAAAAAAAAAAA X5 CTATCTATCT	www.ucl.ac.uk	0	0		
85	chrIII	12785987	13073510	3500381779	28		12785987	13073510	8421504	4	2,3,11,12	0,64,287498,287511	c	350038177900000295	0-28						X1 ATACACACACACAC X2 GAAAAAAAAAAAAAAA X3 TATATATATATGT X4 AAAAAAAAAAAAAAAAAAAAAAAAAAAA X5 CTATCTATCT	www.ucl.ac.uk	0	0		
85	chrIII	12785987	13073510	3500373146	28		12785987	13073510	8421504	4	2,3,11,12	0,64,287498,287511	c	350037314600000295	0-28						X1 ATACACACACACAC X2 GAAAAAAAAAAAAAAA X3 TATATATATATGT X4 AAAAAAAAAAAAAAAAAAAAAAAAAAAA X5 CTATCTATCT	www.ucl.ac.uk	0	0		
682	chrIII	12794528	12794554	3500391068	23		12794528	12794554	8421504	2	16,7	0,19	g	350039106800002022	18-45						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
683	chrIII	12859774	12859808	3500004951	26		12859774	12859808	8421504	3	14,6,6	0,18,28	g	350000495100000565	8-36						Transcriptional Regulator 	.freshpatents.com	0	0		
683	chrIII	12871375	12874992	3500110229	112		12871375	12874992	8421504	5	20,28,20,22,22	0,2569,3062,3564,3595	c,g	350011022900000004,350011022900000006,350011022900000006,350011022900000005,350011022900000005,350011022900000002,350011022900000000,350011022900000000	0-20,0-28,0-28,0-20,0-20,0-22,0-22,0-22		17215300	10.1242/dev.02771	0950-1991	Development	MRG-1, an autosome-associated protein, silences X-linked genes and protects germline immortality in Caenorhabditis elegans	Takasaki	2007	7		
683	chrIII	12939147	12942555	3500361132	57		12939147	12942555	8421504	2	29,28	0,3380	c,g	350036113200000037,350036113200000037,350036113200000038	13-42,13-42,19-47		16911797	10.1186/1741-7007-4-26	1741-7007	BMC Biology	Initiation of male sperm-transfer behavior in Caenorhabditis elegans requires input from the ventral nerve cord	Schindelman	2006	6		
683	chrIII	12940338	12940365	3500435354	24		12940338	12940365	8421504	2	8,16	0,11	c	350043535400000072	16-40						Novel Wheat Allergens - Patent application	www.faqs.org	0	0		
683	chrIII	12941797	12942582	3500149397	778		12941797	12942582	8421504	2	755,23	0,762	c,g	350014939700000002,350014939700000004,350014939700000006,350014939700000008,350014939700000010,350014939700000012,350014939700000014	0-133,0-130,0-125,0-125,0-134,0-110,8-31						Functional tests of enhancer conservation between distantly related species	ev.biologists.org	0	0		
683	chrIII	12942571	12942601	3500093930	30		12942571	12942601	8421504	1	30	0	c,g	350009393000000001,350009393000000001	7-37,7-37						Programmed elimination of cells by caspase-independent cell extrusion in C. elegans	web.mit.edu	0	0		
683	chrIII	12955022	12966829	3500181039	124		12955022	12966829	8421504	8	20,20,10,13,21,20,18,2	0,30,200,1598,1679,10088,10202,11805	c,g	350018103900000002,350018103900000002,350018103900000003,350018103900000003,350018103900000011,350018103900000010,350018103900000010,350018103900000009,350018103900000009,350018103900000008	0-20,0-20,8-28,8-28,0-23,0-21,0-21,0-20,0-20,0-20		23717214	10.1371/journal.pgen.1003522	1553-7404	PLOS Genetics	PLOS Genetics: ttm-1 Encodes CDF Transporters That Excrete Zinc from Intestinal Cells of C. elegans and Act in a Parallel Negative Feedback Circuit That Promotes Homeostasis	Roh	2013	0		
683	chrIII	12965033	12965063	3500313374	26		12965033	12965063	8421504	2	14,12	0,18	g	350031337400000140	0-26						<Html><Title> Complet list of 1y2d hssp file Complet list of	cnptia.embrapa.br	0	0		
683	chrIII	12968120	12971671	3500276765	909		12968120	12971671	8421504	9	189,96,25,23,240,96,96,69,75	0,237,429,1386,1457,3001,3193,3337,3476	c,g	350027676500000275,350027676500000274,350027676500000274,350027676500000273,350027676500000272,350027676500000270,350027676500000270,350027676500000269,350027676500000266,350027676500000264,350027676500000263,350027676500000263,350027676500000262,350027676500000262,350027676500000261,350027676500000261,350027676500000260,350027676500000256,350027676500000255,350027676500000252,350027676500000252,350027676500000251,350027676500000249,350027676500000249,350027676500000248,350027676500000247,350027676500000247	0-45,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48						Products and Methods Related to Mono-Methyl Branched-Chain Fatty Acids - Patent application	www.faqs.org	0	0		
684	chrIII	12978054	12978151	3500004187	48		12978054	12978151	8421504	2	14,34	0,63	p	350000418700015021	0-48						Substrates And Methods For Assaying Deubiquitinating Enzymes 	.freshpatents.com	0	0		
684	chrIII	12982013	12982038	3500378538	24		12982013	12982038	8421504	2	16,8	0,17	g	350037853800000033,350037853800000032	8-35,8-35						Unix and perl	rflab.ucdavis.edu	0	0		
684	chrIII	12982013	12982038	3500235735	24		12982013	12982038	8421504	2	16,8	0,17	g	350023573500000033,350023573500000034	8-35,8-35						unix and perl v3.1	rflab.ucdavis.edu	0	0		
684	chrIII	12983916	12983941	3500433305	23		12983916	12983941	8421504	2	10,13	0,12	g	350043330500000044	0-23						PLANT-DERIVED RESISTANCE GENE - PLANT BIOSCIENCE LIMITED	www.sumobrain.com	0	0		
684	chrIII	12998142	12998168	3500261505	23		12998142	12998168	8421504	2	11,12	0,14	c	350026150500002333,350026150500002334	16-39,15-38						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
684	chrIII	13019368	13019394	3500071183	23		13019368	13019394	8421504	2	9,14	0,12	c	350007118300000480	1-24						Molekulargenetische Untersuchungen beim Hund: Genomweite Analysen zur generalisierten Progressiven Retina Atrophie und mitochondriale sowie Y-chromosomale Studien zur genealogischen Abstammung	uhr-uni-bochum.de	0	0		
684	chrIII	13029780	13074216	3500106028	43		13029780	13074216	8421504	3	17,6,20	0,19,44416	g	350010602800000254,350010602800000159	3-26,4-24						<Html><Title> Complet list of 3sqc hssp file Complet list of	cnptia.embrapa.br	0	0		
684	chrIII	13051778	13052220	3500386009	42		13051778	13052220	8421504	2	22,20	0,422	c,g	350038600900000010,350038600900000010,350038600900000011,350038600900000011	0-22,0-22,0-20,0-20						Supplemental Data Condensins Regulate Meiotic DNA Break Distribution, thus Crossover Frequency, by Controlling Chromosome Structure	mcb.berkeley.edu	0	0		
684	chrIII	13070907	13073884	3500381895	636		13070907	13073884	8421504	5	197,76,75,141,147	0,381,978,1089,2830	p	350038189500015010,350038189500015006,350038189500015022	0-348,42-102,0-288						Evolution of 7SK RNA and its Protein Partners in Metazoa	nf.uni-leipzig.de	0	0		
684	chrIII	13072154	13072180	3500158435	23		13072154	13072180	8421504	3	6,4,13	0,8,13	g	350015843500000329	0-24						<Html><Title> Complet list of 1ccg hssp file Complet list of	cnptia.embrapa.br	0	0		
685	chrIII	13188034	13204349	3500461794	2085		13188034	13204349	8421504	12	108,264,119,335,332,186,129,111,105,102,129,165	0,163,1992,3156,6393,7857,9474,12635,12780,14351,15730,16150	p	350046179400015010,350046179400015021,350046179400015034,350046179400015047,350046179400015049,350046179400015048,350046179400015059	0-402,0-426,0-423,0-381,0-384,0-390,0-237						galactosaminyl-transferase with an unusual lectin domain from the platyhelminth parasite Echinococcus granulosus	www.biochemj.org	0	0		
685	chrIII	13189919	13189954	3500352612	28		13189919	13189954	8421504	3	9,5,14	0,11,21	g	350035261200001416	7-35						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
685	chrIII	13207664	13207689	3500013195	23		13207664	13207689	8421504	2	13,10	0,15	g	350001319500000328	8-37						<Html><Title> Complet list of 1sug hssp file Complet list of	cnptia.embrapa.br	0	0		
685	chrIII	13225076	13225105	3500344270	29		13225076	13225105	8421504	1	29	0	c	350034427000000935	0-29						@IL23_3198:2:1:0:199/1 NCGGAACCGGGCGGAAACACCATCGTATGCCGTCTTC + &0;;;;:9:;:7;;;;;;;;;;;;;;;;;;;;;;;:8	rse.iop.kcl.ac.uk	0	0		
686	chrIII	13254411	13254434	3500346374	23		13254411	13254434	8421504	1	23	0	g	350034637400000079,350034637400000075	15-38,15-38						<PRE> <PRE> <PRE> <HTML> <TITLE>BLAST Search Results  Complet list of	cnptia.embrapa.br	0	0		
688	chrIII	13515338	13523992	3500276765	2583		13515338	13523992	8421504	18	78,153,29,163,19,29,384,384,48,96,144,144,300,276,143,49,81,63	0,1265,1466,2531,2742,2808,2885,3317,3749,3845,4037,4229,4421,4952,5276,5787,5884,8591	c,g	350027676500000600,350027676500000600,350027676500000599,350027676500000598,350027676500000597,350027676500000596,350027676500000594,350027676500000593,350027676500000592,350027676500000591,350027676500000591,350027676500000589,350027676500000587,350027676500000587,350027676500000586,350027676500000586,350027676500000585,350027676500000585,350027676500000584,350027676500000584,350027676500000583,350027676500000582,350027676500000581,350027676500000581,350027676500000580,350027676500000578,350027676500000578,350027676500000577,350027676500000577,350027676500000576,350027676500000575,350027676500000574,350027676500000574,350027676500000573,350027676500000573,350027676500000572,350027676500000571,350027676500000571,350027676500000569,350027676500000569,350027676500000567,350027676500000567,350027676500000566,350027676500000566,350027676500000563,350027676500000562,350027676500000562,350027676500000561,350027676500000561,350027676500000559,350027676500000559,350027676500000558,350027676500000557,350027676500000555,350027676500000555,350027676500000554,350027676500000554,350027676500000553,350027676500000553,350027676500000552,350027676500000551,350027676500000551,350027676500000550,350027676500000549,350027676500000548,350027676500000548,350027676500000547,350027676500000547,350027676500000546,350027676500000546,350027676500000545,350027676500000545,350027676500000544,350027676500000544,350027676500000542,350027676500000541,350027676500000540,350027676500000539,350027676500000537,350027676500000537,350027676500000536,350027676500000535,350027676500000535	0-45,0-45,0-45,0-45,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48,0-48						Products and Methods Related to Mono-Methyl Branched-Chain Fatty Acids - Patent application	www.faqs.org	0	0		
688	chrIII	13518078	13520307	3500249302	45		13518078	13520307	8421504	2	19,26	0,2203	c,g	350024930200000001,350024930200000001,350024930200000000	0-19,0-19,0-26		10557211		0890-9369	Genes & Development	The coronin-like protein POD-1 is required for anterior–posterior axis formation and cellular architecture in the nematode Caenorhabditis elegans	Rappleye	1999	12		
688	chrIII	13563387	13566473	3500411180	43		13563387	13566473	8421504	2	22,21	0,3065	c,g	350041118000000007,350041118000000006	10-32,0-21		21611156	10.1371/journal.pone.0019937		PLoS ONE	Determining the Sub-Cellular Localization of Proteins within Caenorhabditis elegans Body Wall Muscle	Barbara	2011	0		
688	chrIII	13599740	13599763	3500245053	23		13599740	13599763	8421504	1	23	0	g	350024505300003185	9-44						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
688	chrIII	13602981	13607492	3500173453	288		13602981	13607492	8421504	11	23,24,31,19,18,24,25,20,22,59,23	0,1378,1412,1452,1474,1653,1694,1977,2658,2967,4488	c,g	350017345300000001,350017345300000030,350017345300000017,350017345300000019,350017345300000023,350017345300000003,350017345300000026,350017345300000029,350017345300000020,350017345300000016,350017345300000016,350017345300000012,350017345300000000	0-23,0-24,0-22,0-22,10-35,0-43,0-24,0-25,20-40,0-22,0-22,29-88,0-23		15872090	10.1091/mbc.E04-12-1061	1059-1524	Molecular Biology of the Cell	ACT-5 Is an Essential Caenorhabditis elegans Actin Required for Intestinal Microvilli Formation	MacQueen	2005	5		
688	chrIII	13604359	13607492	3500249518	228		13604359	13607492	8421504	8	24,31,24,25,20,22,59,23	0,34,275,316,599,1280,1589,3110	c,g	350024951800000030,350024951800000017,350024951800000019,350024951800000023,350024951800000026,350024951800000029,350024951800000020,350024951800000016,350024951800000016,350024951800000012,350024951800000000	0-24,0-22,0-22,10-35,0-24,0-25,20-40,0-22,0-22,29-88,0-23			10.1091/mbc.E04-12-1061		Molecular Biology of the Cell	ACT-5 Is an Essential Caenorhabditis elegans Actin Required for Intestinal Microvilli Formation	A.	July	0		
688	chrIII	13604483	13604507	3500448349	24		13604483	13604507	8421504	1	24	0	c	350044834900000003	0-24		16946189	10.1176/appi.ajp.163.9.1622	0002-953X	American Journal of Psychiatry	 PsychiatryOnline | American Journal of Psychiatry | Association of a Functional Deficit of the BKCa Channel, a Synaptic Regulator of Neuronal Excitability, With Autism and Mental Retardation 	Laumonnier	2006	13		
688	chrIII	13605035	13605058	3500043344	23		13605035	13605058	8421504	1	23	0	c	350004334400000015	0-23		11752021		1046-6673	Journal of the American Society of Nephrology	IP-10 and Mig Production by Glomerular Cells in Human Proliferative Glomerulonephritis and Regulation by Nitric Oxide	Romagnani	2002	10		
688	chrIII	13605571	13605596	3500346680	25		13605571	13605596	8421504	1	25	0	c	350034668000000004	0-25						Myoblasts and macrophages share molecular components that contribute to cell – cell fusion	jcb.rupress.org	0	0		
688	chrIII	13605573	13605597	3500396150	24		13605573	13605597	8421504	1	24	0	c	350039615000000003	0-24			10.1152/ajpendo.00247.2002		American Journal of Physiology - Endocrinology and Metabolism	1α,25(OH)2-vitamin D3 inhibits HGF synthesis and secretion from MG-63 human osteosarcoma cells	Chattopadhyay	2003	0		POTEF
688	chrIII	13605576	13605611	3500032540	35		13605576	13605611	8421504	1	35	0	c	350003254000000020,350003254000000014	0-20,0-24						ScienceDirect.com - Cancer Cell - Control of Cyclin D1 and Breast Tumorigenesis by the EglN2 Prolyl Hydroxylase	sciencedirect.com	0	0		POTEH
688	chrIII	13605581	13605605	3500216269	24		13605581	13605605	8421504	1	24	0	c,g	350021626900000002,350021626900000002	0-24,0-24		23887392	10.1038/srep02292	xxxx-xxxx	Scientific Reports	Development associated profiling of chitinase and microRNA of Helicoverpa armigera identified chitinase repressive microRNA	Agrawal	2013	0		POTEE
688	chrIII	13605581	13605605	3500169664	24		13605581	13605605	8421504	1	24	0	c,g	350016966400000002,350016966400000002	0-24,0-24		23887392	10.1038/srep02292	xxxx-xxxx	Scientific Reports	Development associated profiling of chitinase and microRNA of Helicoverpa armigera identified chitinase repressive microRNA	Agrawal	2013	0		POTEF
688	chrIII	13605587	13605612	3500180906	25		13605587	13605612	8421504	1	25	0	c	350018090600000002	19-44		11441106		0022-1767	The Journal of Immunology	Glucocorticoid Augmentation of Macrophage Capacity for Phagocytosis of Apoptotic Cells Is Associated with Reduced p130Cas Expression, Loss of Paxillin/pyk2 Phosphorylation, and High Levels of Active Rac	Giles	2001	6		KDM4C,POTEM
688	chrIII	13605587	13605610	3500182926	23		13605587	13605610	8421504	1	23	0	c	350018292600000015	0-23		21411528	10.1128/JVI.02154-10		Journal of Virology	Cardiomyopathy Syndrome of Atlantic Salmon (Salmo salar L.) Is Caused by a Double-Stranded RNA Virus of the Totiviridae Family	Oyvind	June	0		KDM4C,POTEF
688	chrIII	13605589	13605613	3500166783	24		13605589	13605613	8421504	1	24	0	c	350016678300000006	0-24						Rollin, Mol Vis 2004; 10:15-22. Table 1.	www.molvis.org	0	0		POTEE
688	chrIII	13605690	13605737	3500262132	47		13605690	13605737	8421504	1	47	0	c	350026213200000006	74-121						Physiologische Grundlagen der Arbeitsteilung bei der Honigbiene (Apis mellifera L.)	opus.kobv.de	0	0		
688	chrIII	13605690	13605737	3500125064	47		13605690	13605737	8421504	1	47	0	c	350012506400000006	74-121						Physiologische Grundlagen der Arbeitsteilung bei der Honigbiene (Apis mellifera L.)	opus4.kobv.de	0	0		
688	chrIII	13605699	13605722	3500401089	23		13605699	13605722	8421504	1	23	0	g	350040108900000010	1-24						Quantitative Genotyping for the Astringency Locus in Hexaploid Persimmon Cultivars using Quantitative Real-time PCR	spublications.org	0	0		
688	chrIII	13605716	13605739	3500231694	23		13605716	13605739	8421504	1	23	0	c	350023169400000000	0-23						水稻锌高效营养相关基因的定位与克隆 - 豆丁网	www.docin.com	0	0		
688	chrIII	13605810	13605836	3500308239	24		13605810	13605836	8421504	3	11,5,8	0,12,18	g	350030823900000000	0-24						estudiantes del primer: Topics by Science.gov	www.science.gov	0	0		
688	chrIII	13605810	13605836	3500232353	24		13605810	13605836	8421504	3	11,5,8	0,12,18	g	350023235300000002	0-24						universal robust analysis: Topics by Science.gov	www.science.gov	0	0		
688	chrIII	13605810	13605836	3500186128	24		13605810	13605836	8421504	3	11,5,8	0,12,18	g	350018612800000000	0-24						curculionidae primer registro: Topics by Science.gov	www.science.gov	0	0		
688	chrIII	13605810	13605836	3500026121	24		13605810	13605836	8421504	3	11,5,8	0,12,18	g	350002612100000000	0-24						primer estudio nacional: Topics by Science.gov	www.science.gov	0	0		
688	chrIII	13605810	13605836	3500025901	24		13605810	13605836	8421504	3	11,5,8	0,12,18	g	350002590100000000	0-24						para primer grado: Topics by Science.gov	www.science.gov	0	0		
688	chrIII	13608918	13609103	3500148414	26		13608918	13609103	8421504	2	17,9	0,176	c	350014841400000559	0-26						Development of novel anti-microbial agents based on bacteriophage genomics	Pelletier	1999	0		
688	chrIII	13618766	13618792	3500007448	25		13618766	13618792	8421504	2	21,4	0,22	c	350000744800000985	3-28						<HTML><HEAD><meta http-equiv="Content-Type" content="text/html; charset=ISO-8859-1"><LINK REL="SHORT	.economie.fgov.be	0	0		
688	chrIII	13618767	13618799	3500337945	32		13618767	13618799	8421504	1	32	0	c	350033794500000019	11-43						By Clone or Sequence Name - BioInfo (public_page) [13 Sep 2013 09:10:34 ]	cs.nimr.mrc.ac.uk	0	0		
688	chrIII	13618768	13618800	3500223858	32		13618768	13618800	8421504	1	32	0	c	350022385800000425	0-32							biomedcentral.com	0	0		
688	chrIII	13618768	13618798	3500378224	30		13618768	13618798	8421504	1	30	0	c	350037822400000001	0-30						研究開発課題の事後評価書	www.s.affrc.go.jp	0	0		IQCH
688	chrIII	13618768	13618798	3500361332	30		13618768	13618798	8421504	1	30	0	c	350036133200000000	0-30						Beef Cattle Sciences 2010 Edition	s.oregonstate.edu	0	0		VPS13A
688	chrIII	13618768	13618798	3500324548	30		13618768	13618798	8421504	1	30	0	c	350032454800000015	0-30						Region Name: cure for cancer protein Nucleotides: ATGCCACTATGGTAG Nuc. Counts: [4, 3, 4, 4] Total Ma	cs.washington.edu	0	0		ASPN
688	chrIII	13618768	13618798	3500185342	30		13618768	13618798	8421504	1	30	0	c	350018534200000015	0-30						Region Name: cure for cancer protein Nucleotides: ATGCCACTATGGTAG Nuc. Counts: [4, 3, 4, 4] Total Ma	cs.washington.edu	0	0		VPS13A
688	chrIII	13618768	13618798	3500030619	30		13618768	13618798	8421504	1	30	0	c	350003061900000007	0-30						cure for cancer protein ATGCCACTATGGTAG captain picard hair growth protein ATgCCAACATGgATGCCcGATAtGG	cs.washington.edu	0	0		ASPN
688	chrIII	13618768	13618795	3500436879	27		13618768	13618795	8421504	1	27	0	c	350043687900000000	0-27						70 human secreted proteins	Ruben	2002	0		CDKN2B
688	chrIII	13618768	13618795	3500364060	27		13618768	13618795	8421504	1	27	0	c	350036406000000001	0-27						Population Structure of the Alligator Snapping Turtle, Macrochelys Temminckii On the Western Ed	www.scribd.com	0	0		VPS13A
688	chrIII	13621368	13622104	3500274026	405		13621368	13622104	8421504	4	193,110,16,86	0,236,586,650	p	350027402600015039,350027402600015037,350027402600015041	0-123,0-180,6-108						Stony Brook University : BIO 204 : 26816710 Methods in Cell Biology PDF 1	ww.coursehero.com	0	0		
688	chrIII	13621368	13622104	3500119832	405		13621368	13622104	8421504	4	193,110,16,86	0,236,586,650	p	350011983200015028,350011983200015026,350011983200015030	0-123,0-180,0-102						Methods Of Cell Biology	www.docstoc.com	0	0		
689	chrIII	13641709	13641733	3500325360	23		13641709	13641733	8421504	2	7,16	0,8	g	350032536000000323	1-24							biomedcentral.com	0	0		
689	chrIII	13642690	13642758	3500027547	63		13642690	13642758	8421504	3	23,21,19	0,25,49	c,g	350002754700000009,350002754700000014,350002754700000014,350002754700000008,350002754700000008	0-23,0-21,0-21,0-19,0-19			10.1371/journal.pgen.0010017	1553-7404	PLOS Genetics	PLOS Genetics: New Genes Tied to Endocrine, Metabolic, and Dietary Regulation of Lifespan from a Caenorhabditis elegans Genomic RNAi Screen	Hansen	2005	0		
689	chrIII	13642690	13642758	3500010528	63		13642690	13642758	8421504	3	23,21,19	0,25,49	c,g	350001052800000009,350001052800000014,350001052800000014,350001052800000008,350001052800000008	0-23,0-21,0-21,0-19,0-19			10.1371/journal.pgen.0010017		PLoS Genetics	New Genes Tied to Endocrine, Metabolic, and Dietary Regulation of Lifespan from a Caenorhabditis elegans Genomic RNAi Screen	Malene	July	0		
689	chrIII	13643948	13643972	3500189284	23		13643948	13643972	8421504	2	7,16	0,8	c,g	350018928400000245,350018928400000245	7-35,7-35						IDENTIFICATION OF A NEW CLASS OF EPSP SYNTHASES - Patent application	www.faqs.org	0	0		
689	chrIII	13649450	13649475	3500433524	25		13649450	13649475	8421504	1	25	0	c,g	350043352400000014,350043352400000014	10-36,10-36						Maize transcriptome analysis upon Fusarium infection in relation with host and pathogen genotypes.	online.unicatt.it	0	0		
689	chrIII	13664026	13664051	3500397262	24		13664026	13664051	8421504	2	10,14	0,11	g	350039726200000177	12-37						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
689	chrIII	13677568	13685346	3500125252	185		13677568	13685346	8421504	9	22,22,20,19,21,20,22,20,19	0,93,1134,2441,2610,4560,4667,6110,7759	c,g	350012525200000011,350012525200000018,350012525200000018,350012525200000010,350012525200000010,350012525200000012,350012525200000012,350012525200000016,350012525200000016,350012525200000008,350012525200000017,350012525200000014,350012525200000014,350012525200000015,350012525200000015	19-41,0-22,0-22,19-39,19-39,19-38,19-38,24-45,24-45,0-20,24-46,18-38,18-38,19-38,19-38						Supporting Information 	www.pnas.org	0	0		
689	chrIII	13688769	13689683	3500383377	40		13688769	13689683	8421504	2	20,20	0,894	c,g	350038337700000011,350038337700000011,350038337700000012,350038337700000012	0-20,0-20,0-20,0-20		23352664	10.1016/j.celrep.2012.12.018	2211-1247	Cell Reports	Cell Reports - A Fasting-Responsive Signaling Pathway that Extends Life Span in C. elegans	Uno	2013	0		
86	chrIII	13722770	13765914	3500426115	41		13722770	13765914	8421504	2	21,20	0,43124	c	350042611500000673,350042611500001110	6-27,15-35						ENGINEERED MICROORGANISMS WITH ENHANCED FERMENTATION ACTIVITY - Patent application	www.faqs.org	0	0		
86	chrIII	13722770	13765914	3500370254	41		13722770	13765914	8421504	2	21,20	0,43124	c	350037025400000385,350037025400000822	6-27,15-35						ENGINEERED MICROORGANISMS WITH ENHANCED FERMENTATION ACTIVITY - Patent application	www.faqs.org	0	0		
86	chrIII	13722770	13765914	3500254468	41		13722770	13765914	8421504	2	21,20	0,43124	c	350025446800000665,350025446800001102	6-27,15-35						ENGINEERED MICROORGANISMS WITH ENHANCED FERMENTATION ACTIVITY - Patent application	www.faqs.org	0	0		
86	chrIII	13722770	13765914	3500194838	41		13722770	13765914	8421504	2	21,20	0,43124	c	350019483800000673,350019483800001110	6-27,15-35						 Engineered Microorganisms With Enhanced Fermentation Activity 	www.docstoc.com	0	0		
86	chrIII	13722770	13765914	3500099901	41		13722770	13765914	8421504	2	21,20	0,43124	c	350009990100000380,350009990100000817	6-27,15-35						ENGINEERED MICROORGANISMS WITH ENHANCED FERMENTATION ACTIVITY - Patent application	www.faqs.org	0	0		
690	chrIII	13767358	13773146	3500420792	76		13767358	13773146	8421504	3	25,24,27	0,4058,5761	c,g	350042079200000000,350042079200000001,350042079200000003,350042079200000003	14-39,9-33,21-48,21-48						Nematodes as model organisms for the investigation of neurodegenerative diseases, in particular parkinsons disease, uses and methods for the discovery of substances and genes which can used in the treatment of the above disease states and identification o	Hoener	2008	0		
690	chrIII	13767358	13773146	3500417089	76		13767358	13773146	8421504	3	25,24,27	0,4058,5761	c,g	350041708900000000,350041708900000001,350041708900000003,350041708900000003	14-39,9-33,21-48,21-48					Patent	Nematodes as model organisms for the investigation of neurodegenerative diseases, in particular parkinsons disease, uses and methods for the discovery of substances and genes which can used in the treatment of the above disease states and identification o	Hoener	2008	0		
690	chrIII	13767358	13773146	3500380059	76		13767358	13773146	8421504	3	25,24,27	0,4058,5761	c,g	350038005900000000,350038005900000001,350038005900000003,350038005900000003	14-39,9-33,21-48,21-48						Nematodes as model organisms for the investigation of neurodegenerative diseases, in particular parkinsons disease, uses and methods for the discovery of substances and genes which can used in the treatment of the above disease states and identification o	Hoener	2001	0		
690	chrIII	13767358	13773146	3500152833	76		13767358	13773146	8421504	3	25,24,27	0,4058,5761	c,g	350015283300000000,350015283300000001,350015283300000003,350015283300000003	14-39,9-33,21-48,21-48						Nematodes as model organisms for the investigation of neurodegenerative diseases, in particular parkinsons disease, uses and methods for the discovery of substances and genes which can used in the treatment of the above disease states and identification o	Hoener	2008	0		
690	chrIII	13767358	13773146	3500036746	76		13767358	13773146	8421504	3	25,24,27	0,4058,5761	c,g	350003674600000000,350003674600000001,350003674600000003,350003674600000003	14-39,9-33,21-48,21-48					Patent	Nematodes as model organisms for the investigation of neurodegenerative diseases, in particular parkinsons disease, uses and methods for the discovery of substances and genes which can used in the treatment of the above disease states and identification o	Hoener	2012	0		
690	chrIII	13768699	13771122	3500446855	2046		13768699	13771122	8421504	6	210,753,372,493,112,106	0,256,1196,1618,2161,2317	c,g	350044685500000003,350044685500000015,350044685500000051,350044685500000051,350044685500000049,350044685500000049,350044685500000047,350044685500000047,350044685500000045,350044685500000045,350044685500000044,350044685500000044,350044685500000043,350044685500000041,350044685500000041,350044685500000039,350044685500000039,350044685500000037,350044685500000037,350044685500000035,350044685500000035,350044685500000014,350044685500000014,350044685500000033,350044685500000033	0-2045,0-571,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-56,0-56,0-59,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-60,0-30,0-30,0-60,0-60						Étude de la fonction des Rho GAP au cours du développement embryonnaire du nématode caenorhabditis elegans	.archipel.uqam.ca	0	0		
690	chrIII	13777841	13777866	3500015244	25		13777841	13777866	8421504	1	25	0	g	350001524400000019	10-35						Methods for generating resistance against CGMMV in plants	Onstenk	2002	0		
585	chrIV	829	47226	3500063914	44		829	47226	8421504	2	22,22	0,46375	c,g	350006391400000002,350006391400000002,350006391400000003,350006391400000003	0-22,0-22,0-22,0-22		11641227		0950-1991	Development	The C. elegans maternal-effect gene clk-2 is essential for embryonic development, encodes a protein homologous to yeast Tel2p and affects telomere length	Benard	2001	7		
585	chrIV	829	47226	3500050461	44		829	47226	8421504	2	22,22	0,46375	c,g	350005046100000002,350005046100000003,350005046100000003	0-22,0-22,0-22		11641227		0950-1991	Development	The C. elegans maternal-effect gene clk-2 is essential for embryonic development, encodes a protein homologous to yeast Tel2p and affects telomere length	Benard	2001	7		
585	chrIV	41474	41500	3500118398	24		41474	41500	8421504	3	12,4,8	0,13,18	c	350011839800000001	9-33						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
585	chrIV	41506	41533	3500231029	26		41506	41533	8421504	2	4,22	0,5	c	350023102900002872	0-26						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
585	chrIV	69118	69225	3500259767	46		69118	69225	8421504	2	26,20	0,87	g	350025976700000050,350025976700000051	0-26,0-20		18828672	10.1371/journal.pbio.0060233		PLoS Biology	Caenorhabditis elegans HCF-1 Functions in Longevity Maintenance as a DAF-16 Regulator	Ji	2008	0		
585	chrIV	91002	91031	3500336276	25		91002	91031	8421504	2	9,16	0,13	g	350033627600001359	1-26						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
585	chrIV	106034	106073	3500250812	39		106034	106073	8421504	1	39	0	c	350025081200000004,350025081200000005	0-39,0-39		23072806	10.1038/ncomms2136	2041-1733	Nature Communications	Endocannabinoid-Goα signalling inhibits axon regeneration in Caenorhabditis elegans by antagonizing Gqα-PKC-JNK signalling	Pastuhov	2012	0		
585	chrIV	106071	106096	3500249257	23		106071	106096	8421504	2	10,13	0,12	c	350024925700000057	0-23					Patent	Insect-specific paralytic neurotoxin genes for use in biological insect control: methods and compositions (Patent US:5266317)	Miller	1993	0		
585	chrIV	106071	106096	3500037822	23		106071	106096	8421504	2	10,13	0,12	c	350003782200000057	0-23					Patent	Insect-specific paralytic neurotoxin genes for use in biological insect control: methods and compositions (Patent US:5266317)	Miller	1993	0		
586	chrIV	136158	136187	3500082902	24		136158	136187	8421504	2	12,12	0,17	g	350008290200000201	7-45						B组链球菌抗原	B*R*Bu Luo Duo Yi Er 	2001	0		
586	chrIV	143981	144054	3500415441	73		143981	144054	8421504	1	73	0	c	350041544100000113,350041544100000111,350041544100000110	0-73,0-73,1-73						Genomic tRNA Database: Caenorhabditis brenneri (WUGSC 4.0 Jan 2007)	gtrnadb.ucsc.edu	0	0		
586	chrIV	143981	144009	3500386452	28		143981	144009	8421504	1	28	0	c	350038645200000233,350038645200000225	0-28,0-28						NEUROPROTECTIVE MOLECULES AND METHODS OF TREATING NEUROLOGICAL DISORDERS AND INDUCING STRESS GRANULES	Anderson	2011	0		
586	chrIV	143981	144009	3500235647	28		143981	144009	8421504	1	28	0	c	350023564700000225,350023564700000233,350023564700001026,350023564700001018	0-28,0-28,0-28,0-28						NEUROPROTECTIVE MOLECULES AND METHODS OF TREATING NEUROLOGICAL DISORDERS AND INDUCING STRESS GRANULES - Patent application	www.faqs.org	0	0		
586	chrIV	159682	159711	3500306662	24		159682	159711	8421504	2	15,9	0,20	c	350030666200000058	17-41						Nematode Fatty Acid Desaturase-Like Sequences - Patent application	www.faqs.org	0	0		
586	chrIV	159682	159711	3500288335	24		159682	159711	8421504	2	15,9	0,20	c	350028833500000058	17-41						Nematode Fatty Acid Desaturase-Like Sequences - Patent application	www.faqs.org	0	0		
586	chrIV	184647	184671	3500456123	24		184647	184671	8421504	1	24	0	g	350045612300000132	4-30						Expression cassettes for seed-preferential expression in plants - Patent application	www.faqs.org	0	0		
586	chrIV	184647	184671	3500329088	24		184647	184671	8421504	1	24	0	g	350032908800000132	4-30						Expression cassettes for seed-preferential expression in plants - US Patent 7790873 Description	ww.patentstorm.us	0	0		
586	chrIV	203881	205042	3500097635	249		203881	205042	8421504	2	135,114	0,1047	p,c,g	350009763500015043,350009763500000066,350009763500000066,350009763500000068,350009763500000068,350009763500000070,350009763500000070	0-180,0-59,0-59,0-60,0-60,0-24,0-24						terms and conditions of use	.era.lib.ed.ac.uk	0	0		
586	chrIV	253632	253655	3500394181	23		253632	253655	8421504	1	23	0	g	350039418100000407	7-30						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
73	chrIV	260783	266286	3500203630	160		260783	266286	8421504	8	20,20,20,20,20,20,20,20	0,93,303,532,605,1153,1184,5483	c,g	350020363000000004,350020363000000003,350020363000000003,350020363000000010,350020363000000007,350020363000000007,350020363000000012,350020363000000006,350020363000000011,350020363000000005,350020363000000001	0-20,0-20,0-20,0-20,0-20,0-20,0-20,5-25,0-20,20-40,0-20						Nematode homologue of PQBP1, a mental retardation causative gene, is involved in lipid metabolism. - ResearchGate	.researchgate.net	0	0		
587	chrIV	380017	383179	3500310054	3162		380017	383179	8421504	1	3162	0	c,g	350031005400000175,350031005400000177,350031005400000177,350031005400000000,350031005400000176,350031005400000176	0-3162,9-33,9-33,9-35,9-34,9-34						SPHINGOSINE-1-PHOSPHATE LYASE POLYPEPTIDES, POLYNUCLEOTIDES AND MODULATING AGENTS AND METHODS OF USE THEREFOR - Patent application	www.faqs.org	0	0		
587	chrIV	380017	383179	3500277392	49		380017	383179	8421504	2	24,25	0,3137	c,g	350027739200000003,350027739200000002,350027739200000002	9-33,9-34,9-34					Patent	Method for the diagnosing of sphingolipid metabolism (Patent EP:1517989)	Fyrst	2009	0		
587	chrIV	380017	383179	3500104818	3162		380017	383179	8421504	1	3162	0	c,g	350010481800000180,350010481800000180,350010481800000178,350010481800000179,350010481800000179	9-33,9-33,0-3162,9-34,9-34						COMPOSITIONS AND METHODS FOR PROTECTION AGAINST CARDIAC AND/OR CENTRAL NERVOUS SYSTEM TISSUE INJURY BY INHIBITING SPHINGOSINE-1-PHOSPHATE LYASE - Patent application	www.faqs.org	0	0		
587	chrIV	389000	389026	3500279979	23		389000	389026	8421504	2	5,18	0,8	c	350027997900000028	1-24						<!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.0//EN" "http://www.w3.org/TR/REC-html40/strict.dtd"> <HTML	www7.inra.fr	0	0		
588	chrIV	399274	401736	3500273984	47		399274	401736	8421504	2	21,26	0,2436	g	350027398400000007,350027398400000004	0-21,9-35						Cell Metabolism Article	sciencedirect.com	0	0		
588	chrIV	401872	401920	3500383952	48		401872	401920	8421504	1	48	0	p	350038395200015059	120-168						Yeast cells expressing modified g proteins and methods of use therefor	Benegal	2000	0		
588	chrIV	401872	401920	3500197802	48		401872	401920	8421504	1	48	0	p	350019780200015033	111-159						Yeast cells engineered to produce pheromone system protein surrogates and uses therefor	Fowlkes	2002	0		
588	chrIV	401872	401920	3500166324	48		401872	401920	8421504	1	48	0	p	350016632400015059	120-168						Yeast cells expressing modified g proteins and methods of use therefor	Benegal	1999	0		
588	chrIV	401872	401920	3500046024	48		401872	401920	8421504	1	48	0	p	350004602400015035	111-159						Yeast cells engineered to produce pheromone system protein surrogates, and uses therefor - US Patent 7235648 Description	ww.patentstorm.us	0	0		
588	chrIV	408826	408886	3500370121	60		408826	408886	8421504	1	60	0	p	350037012100015000	0-60		17699606	10.1242/dev.005181	0950-1991	Development	GLH-1, the C. elegans P granule protein, is controlled by the JNK KGB-1 and by the COP9 subunit CSN-5	Orsborn	2007	7		
588	chrIV	408826	408886	3500138443	60		408826	408886	8421504	1	60	0	p	350013844300015000	0-60		17699606	10.1242/dev.005181	0950-1991	Development	GLH-1, the C. elegans P granule protein, is controlled by the JNK KGB-1 and by the COP9 subunit CSN-5	Orsborn	2007	7		
588	chrIV	418204	418359	3500232650	50		418204	418359	8421504	2	25,25	0,130	c,g	350023265000000016,350023265000000016,350023265000000015	0-25,0-25,0-25						PhD Thesis	uni-goettingen.de	0	0		
588	chrIV	420425	425148	3500271498	49		420425	425148	8421504	2	25,24	0,4699	c,g	350027149800000002,350027149800000002,350027149800000001	16-41,16-41,12-36		23994474	10.1016/j.celrep.2013.07.045	2211-1247	Cell Reports	Cell Reports - Nonautonomous Regulation of Neuronal Migration by Insulin Signaling, DAF-16/FOXO, and PAK-1	Kennedy	2013	0		
588	chrIV	420425	425148	3500257562	49		420425	425148	8421504	2	25,24	0,4699	c,g	350025756200000002,350025756200000002,350025756200000001,350025756200000001	16-41,16-41,12-36,12-36		23994474	10.1016/j.celrep.2013.07.045	2211-1247	Cell Reports	Cell Reports - Nonautonomous Regulation of Neuronal Migration by Insulin Signaling, DAF-16/FOXO, and PAK-1	Kennedy	2013	0		
588	chrIV	422956	423737	3500330042	44		422956	423737	8421504	2	22,22	0,759	c,g	350033004200000004,350033004200000002,350033004200000002	0-22,0-22,0-22						Clustering of Genetically Defined Allele Classes in the Caenorhabditis elegans DAF-2 Insulin/IGF-1 Receptor--《遗传学杂志》--医学期刊频道--首席医学ߵ	journal.9med.net	0	0		
588	chrIV	422956	423737	3500287802	44		422956	423737	8421504	2	22,22	0,759	c,g	350028780200000004,350028780200000002,350028780200000002	0-22,0-22,0-22						Clustering of Genetically Defined Allele Classes in the Caenorhabditis elegans DAF-2 Insulin/IGF-1 Receptor	www.genetics.org	0	0		
588	chrIV	455725	457025	3500432950	777		455725	457025	8421504	4	232,213,163,169	0,656,917,1131	c,g	350043295000000000,350043295000000000	0-777,0-777						Caenorhabditis elegans metridin-like ShK toxin family member (4B209), mRNA. , NM_067532.1 - GenScript	www.genscript.com	0	0		
588	chrIV	459426	459450	3500164671	23		459426	459450	8421504	2	13,10	0,14	c	350016467100000054	11-34						Grapevine virus A ב םיפצר ןויפיא	www.agri.gov.il	0	0		
588	chrIV	495519	495543	3500058223	24		495519	495543	8421504	1	24	0	g	350005822300000013	12-36						<Html><Title> Complet list of 1ua2 hssp file Complet list of	cnptia.embrapa.br	0	0		
588	chrIV	506436	506459	3500382122	23		506436	506459	8421504	1	23	0	c	350038212200001596	0-23						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
588	chrIV	514672	514695	3500093930	23		514672	514695	8421504	1	23	0	c	350009393000000005	20-43						Programmed elimination of cells by caspase-independent cell extrusion in C. elegans	web.mit.edu	0	0		
588	chrIV	518788	519857	3500292448	60		518788	519857	8421504	3	20,20,20	0,505,1049	c,g	350029244800000003,350029244800000003,350029244800000001,350029244800000001,350029244800000000	0-20,0-20,0-20,0-20,0-20		16774992	10.1242/dev.02447	0950-1991	Development	The C. elegans MELK ortholog PIG-1 regulates cell size asymmetry and daughter cell fate in asymmetric neuroblast divisions	Cordes	2006	7		
589	chrIV	587624	587652	3500211468	25		587624	587652	8421504	3	5,13,7	0,6,21	c	350021146800000060	16-42						Insect-specific paralytic neurotoxin genes for use in biological insect control: methods and compositions	Tomalski	1990	0		
589	chrIV	587685	587712	3500190843	26		587685	587712	8421504	2	11,15	0,12	c	350019084300000483	11-37						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
589	chrIV	593279	593306	3500380743	23		593279	593306	8421504	2	11,12	0,15	g	350038074300000270	8-31						<Html><Title> Complet list of 1ldm hssp file Complet list of	cnptia.embrapa.br	0	0		
589	chrIV	605341	605370	3500026001	25		605341	605370	8421504	2	12,13	0,16	g	350002600100000362	16-47						US Patent # 6,887,988. Plant reproduction polynucleotides and methods of use - Patents.com	www.patents.com	0	0		
589	chrIV	651069	651094	3500190843	24		651069	651094	8421504	2	6,18	0,7	c	350019084300000948	5-29						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
590	chrIV	657917	658400	3500164379	165		657917	658400	8421504	2	101,64	0,419	p	350016437900015099	87-252						SEINE AVAL 2 : L’ANALYSE ET LA GESTION DES RISQUES	ne-aval.crihan.fr	0	0		
590	chrIV	658180	658266	3500005329	83		658180	658266	8421504	2	35,48	0,38	g	350000532900000042	0-83						TaiLieu.VN: Báo cáo y học: "Evolutionary dynamics of eukaryotic selenoproteomes: large selenoproteomes may associate with aquatic life and small with terrestrial lif" 	tailieu.vn/doc/ba	0	0		
591	chrIV	793866	831015	3500241007	42		793866	831015	8421504	4	13,6,13,10	0,18,37123,37139	c,g	350024100700002469,350024100700004170	4-23,1-25						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
591	chrIV	795182	795220	3500121931	38		795182	795220	8421504	1	38	0	c,g	350012193100000038,350012193100000038	0-38,0-38						Supporting Online Material for	mcb.berkeley.edu	0	0		
591	chrIV	824021	824196	3500380743	26		824021	824196	8421504	3	6,6,14	0,8,161	c	350038074300000220	21-47						<Html><Title> Complet list of 1ldm hssp file Complet list of	cnptia.embrapa.br	0	0		
591	chrIV	824021	824196	3500143070	26		824021	824196	8421504	3	6,6,14	0,8,161	c	350014307000000509	18-44						<Html><Title> Complet list of 3a2p hssp file Complet list of	cnptia.embrapa.br	0	0		
591	chrIV	824021	824195	3500401199	25		824021	824195	8421504	3	6,6,13	0,8,161	c	350040119900000120	24-49						<Html><Title> Complet list of 1i1n hssp file Complet list of	cnptia.embrapa.br	0	0		
591	chrIV	824021	824192	3500369079	27		824021	824192	8421504	3	6,10,11	0,8,160	c	350036907900000687	6-33						<Html><Title> Complet list of 1omo hssp file Complet list of	cnptia.embrapa.br	0	0		
591	chrIV	824021	824192	3500331014	27		824021	824192	8421504	3	6,10,11	0,8,160	c	350033101400000014	2-29						<Html><Title> Complet list of 1wsr hssp file Complet list of	cnptia.embrapa.br	0	0		
591	chrIV	824021	824192	3500014387	24		824021	824192	8421504	2	14,10	0,161	c	350001438700000088	2-27						<Html><Title> Complet list of 1u5h hssp file Complet list of	cnptia.embrapa.br	0	0		
592	chrIV	936011	936039	3500149404	23		936011	936039	8421504	2	15,8	0,20	g	350014940400000099	6-42						Use Of Stomatin (STM1) Polynucleotides For Achieving A Pathogen Resistance In Plants - Patent application	www.faqs.org	0	0		
592	chrIV	941485	941512	3500362698	23		941485	941512	8421504	2	12,11	0,16	g	350036269800000074	19-42						Rubber tree genome download sequences	ww4a.biotec.or.th	0	0		
592	chrIV	951156	951319	3500044376	163		951156	951319	8421504	1	163	0	g	350004437600000006,350004437600000003	0-162,174-292						Tc4, a Caenorhabditis elegans Transposable Element with an Unusual Fold- Back Structure	www.jstor.org	0	0		
592	chrIV	977518	977544	3500394585	25		977518	977544	8421504	2	13,12	0,14	c	350039458500000485,350039458500000483,350039458500000498	0-20,0-25,0-19						Electronic supplement to: Oberprieler, C. & Vogt, R.: The taxonomic position of Matricaria macrotis (Compositae-Anthemideae). Willdenowia 36 (Special Issue): 329-338. – ISSN 0511-9618; © 2006 BGBM Berlin-Dahlem. Alignment	www.bgbm.org	0	0		
592	chrIV	988202	988253	3500328692	51		988202	988253	8421504	1	51	0	p	350032869200015026	0-51						DNA sequence-enabled reassembly of the green fluorescent protein. - ResearchGate	.researchgate.net	0	0		
592	chrIV	988202	988253	3500322275	51		988202	988253	8421504	1	51	0	p	350032227500015021	0-51						Site Specific Detection of DNA Methylation Utilizing mCpG-SEER	.chem.arizona.edu	0	0		
592	chrIV	990262	990288	3500394430	26		990262	990288	8421504	1	26	0	c	350039443000000383	19-45						1. INTRODUÇÃO 1.1- O parasita	www.bdtd.ucb.br	0	0		
592	chrIV	1019221	1019244	3500455249	23		1019221	1019244	8421504	1	23	0	c	350045524900000042,350045524900000043	0-23,0-22						<HTML> <HEAD> <TITLE>CSM cDNA AFH551   
Homology AFH551 vs CSM-cDNA
 
 Complet list of 3hdn hssp file Complet list of	cnptia.embrapa.br	0	0		
593	chrIV	1092058	1092083	3500148414	24		1092058	1092083	8421504	2	17,7	0,18	c	350014841400000748	6-30						Development of novel anti-microbial agents based on bacteriophage genomics	Pelletier	1999	0		
593	chrIV	1112468	1112497	3500102528	23		1112468	1112497	8421504	3	4,6,13	0,5,16	g	350010252800000000	6-29						Interrogating the Molecular Basis for Multiple Macrolactone Ring Formation by the Pikromycin Polyketide Synthase	chembio.umich.edu	0	0		
594	chrIV	1195074	1195101	3500375490	25		1195074	1195101	8421504	2	14,11	0,16	g	350037549000000477	12-38						PHYLOGENETIC RELATIONSHIPS IN THE FAMILY AMARYLLIDACEAE	etd.uovs.ac.za	0	0		
74	chrIV	1238013	1752225	3500203734	53		1238013	1752225	8421504	5	12,6,6,3,26	0,236497,322607,514182,514186	c	350020373400000005	16-69						 MAQGene -> SAMTools -> IGV - SEQanswers	seqanswers.com	0	0		
594	chrIV	1250563	1250639	3500115152	40		1250563	1250639	8421504	2	20,20	0,56	c,g	350011515200000013,350011515200000013,350011515200000012,350011515200000012	0-20,0-20,0-20,0-20		22363222	10.3390/md10010084		Marine Drugs	Tasco®: A Product of Ascophyllum nodosum Enhances Immune Response of Caenorhabditis elegans Against Pseudomonas aeruginosa Infection	Saveetha	2012	0		
594	chrIV	1260992	1261019	3500080694	23		1260992	1261019	8421504	3	5,13,5	0,7,22	g	350008069400000066	6-29						MIXING AND MATCHING TC PROTEINS FOR PEST CONTROL - Patent application	www.faqs.org	0	0		
594	chrIV	1265318	1265351	3500236306	27		1265318	1265351	8421504	3	8,14,5	0,11,28	g	350023630600000003	4-31						OmegaPlus 2.0	sco.h-its.org	0	0		
594	chrIV	1265318	1265351	3500200762	27		1265318	1265351	8421504	3	8,14,5	0,11,28	g	350020076200000003	4-31						OmegaPlus 2.0	sco.h-its.org	0	0		
594	chrIV	1268726	1268752	3500087224	23		1268726	1268752	8421504	2	5,18	0,8	c	350008722400000050	4-27						Programmed cell death and ich-3	Fishman	1999	0		
594	chrIV	1299159	1299187	3500118398	25		1299159	1299187	8421504	2	13,12	0,16	g	350011839800002735	19-44						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
595	chrIV	1325305	1325334	3500107470	24		1325305	1325334	8421504	3	12,6,6	0,16,23	g	350010747000000509	20-48						Transmembrane protein amigo and uses thereof - Patent application	www.faqs.org	0	0		
74	chrIV	1348071	1473072	3500290159	55		1348071	1473072	8421504	3	23,10,22	0,76791,124979	c	350029015900000000	127-183						Evolutionary dynamics of conserved non-coding DNA elements: Big bang or gradual accretion?	www.inf.ed.ac.uk	0	0		
595	chrIV	1429742	1429766	3500382623	23		1429742	1429766	8421504	2	12,11	0,13	c	350038262300000016	8-31						Solenopsis invicta virus-1A (SINV-1A): Distinct species or genotype of SINV-1?	www.ars.usda.gov	0	0		
74	chrIV	1437964	1443898	3500030003	891		1437964	1443898	8421504	4	210,268,388,25	0,261,4379,5909	p	350003000300015063,350003000300015047,350003000300015024,350003000300015010	0-183,0-222,0-255,0-231						Did Transposable Elements Contribute to Proteomes	download.cell.com	0	0		
596	chrIV	1445859	1445884	3500227525	25		1445859	1445884	8421504	1	25	0	c	350022752500000008	0-25						REAL-TIME RT-PCR AND PROTEOMIC ANALYSIS OF ADIPOSE TISSUE FROM OB/OB MICE TREATED WITH LEPTIN WEI ZHANG	aeum.libs.uga.edu	0	0		
596	chrIV	1542636	1562593	3500209433	39		1542636	1562593	8421504	3	20,5,14	0,19935,19943	g	350020943300002846,350020943300000471	21-41,10-29						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
596	chrIV	1548079	1548109	3500380586	26		1548079	1548109	8421504	2	15,11	0,19	g	350038058600000400	0-43						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
597	chrIV	1649912	1686267	3500245053	41		1649912	1686267	8421504	4	6,13,15,7	0,7,36329,36348	g	350024505300001560,350024505300002851	6-25,8-35						TransTermHP v2.07 (built on Jan 21 2009) 25 bins; sample size is 20000000 --pval-conf=/fs/szasmg2/ca	term.cbcb.umd.edu	0	0		
597	chrIV	1659830	1659888	3500033242	58		1659830	1659888	8421504	1	58	0	g	350003324200000000	54-112						1.用perl 程序怎么把文件中的空格去掉 2.怎么让文件以>单独一行开头。_百度知&#x	zhidao.baidu.com	0	0		
598	chrIV	1710265	1710920	3500227717	456		1710265	1710920	8421504	2	100,356	0,299	p,c,g	350022771700000001,350022771700000001,350022771700015000	0-456,0-456,0-453						KEGG T00019: K08D12.3	www.genome.jp	0	0		
598	chrIV	1721084	1721507	3500259200	69		1721084	1721507	8421504	3	24,27,18	0,42,405	p	350025920000015003	24-138						physiological perturbations	n.library.ethz.ch	0	0		
598	chrIV	1721091	1722294	3500153414	147		1721091	1722294	8421504	7	15,24,27,18,18,15,30	0,246,531,657,1035,1107,1173	p	350015341400015006,350015341400015008	51-174,3-126						<HTML> <HEAD> <TITLE>Information for JCVI_SCAF_1096627313527